1. Structural Biology and Molecular Biophysics
Download icon

The structure of the endogenous ESX-3 secretion system

  1. Nicole Poweleit
  2. Nadine Czudnochowski
  3. Rachel Nakagawa
  4. Donovan D Trinidad
  5. Kenan C Murphy
  6. Christopher M Sassetti
  7. Oren S Rosenberg  Is a corresponding author
  1. University of California, San Francisco, United States
  2. University of Massachusetts Medical School, United States
Research Article
Cite this article as: eLife 2019;8:e52983 doi: 10.7554/eLife.52983
7 figures, 2 tables, 2 data sets and 4 additional files

Figures

Figure 1 with 6 supplements
Overview of the ESX-3 tagging, purification, and structure.

(A) The ESX-3 operon in M. smegmatis and the placement of the purification tag. Genomic deletion of ideR derepresses ESX-3 to boost expression for purification. (B) SDS-PAGE of purified ESX-3 shows four major bands corresponding to EccB3, EccC3, EccD3, and EccE3. (C) Blue native page of the purified ESX-3 complex shows a large molecular weight band around 900 kDa. (D) Merged maps of all focused refinement maps (gray transparency) of the ESX-3 dimer filtered to 10 Å resolution. The transmembrane and upper cytoplasmic focused maps (3.7 Å) are segmented by subunit showing one copy per protomer of EccB3 (pink), EccC3 (blue), EccE3 (orange), EccD3-bent (yellow), and EccD3-extended (green). (E) Atomic models of the transmembrane and upper cytoplasmic regions. (F) A combined map of the full complex filtered to 10 Å resolution (gray transparency) with full models for each protein, EccD3-bent (yellow), EccD3-extended (green), EccE3 (orange), EccC3 (blue), and EccB3 (pink).

Figure 1—figure supplement 1
ORBIT tagging of the chromosomal copy of EccE3.

(A) Diagram of the ESX-3 operon in M. smegmatis mc(2)155. (B) The targeting oligo used to insert the attP site into the chromosome. (C) The tagging plasmid.(D) Cartoon of the resulting change to the chromosome after ORBIT.

Figure 1—figure supplement 2
ESX-3 dimer purification optimization.

(A) Western blot of solubilized cell material with EccE3 tagged with EGFP. Lane 1, wild type background. Lane 2, ΔideR background. (B) Size exclusion profile for the ESX-3 dimer purified on a Superose 6 10/300column.

Figure 1—figure supplement 3
Examination of the void volume.

(A) Size exclusion profile with void volume and peak fractions indicated. (B) SDS-PAGE of all fractions from the beginning of elution until the end of the peak fraction. (C) BN-PAGE of the void and peak fractions (D) Cryo-EM of the void volume. Scale bar 50 nm (E) 2D class averages of the particles picked from the void volume, some classes reveal possible higher order oligomers. Scale bar 20 nm.

Figure 1—figure supplement 4
Initial data collection and initial model generation.

An initial data set was collected on a Talos Arctica microscope. The final refinement from this data processing was used as the starting model for future data processing.

Figure 1—figure supplement 5
Data processing workflow for final data collection.

Data was collected on a Titan Krios. Particles from the final reconstruction were subsequently used for focused classification and refinement.

Figure 1—figure supplement 6
Consensus and focused refinements.

(A) Consensus refinement map and FSC curve for the ESX-3 complex. Focused refinement maps and FSC curves for (B) the left protomer of the ESX-3 complex, (C) the right protomer of the ESX-3 complex, (D) a symmetry expanded protomer, (E) the periplasmic domain of EccB and (F) the lower ATPase domains of EccC. All maps are unsharpened and unmasked.

Figure 2 with 1 supplement
The structure of EccD3.

(A) EccD3-bent (yellow) and EccD3-extended (green) in the context of the overall ESX-3 dimer (gray transparency). (B) Atomic models of EccD3-bent and EccD3-extended (C) An unsharpened electron microscopy density map of the ESX-3 dimer shows extra densities consistent with lipid or detergent molecules (teal) on the periplasmic face of the EccD3 cavity. (D) EccD3-bent (yellow) and EccD3-extended (green) aligned based on the transmembrane regions shows two distinct conformations of the EccD3 cytoplasmic domains. Amino acids 100–127 of EccD3 adopt a bent (yellow) and an extended (green) conformation.

Figure 2—figure supplement 1
EccD3 map and model.

Map to model fits for EccD3-bent for (A) transmembrane helix 1, amino acids 136–153, (B) transmembrane α-helix 1, amino acids 385–402, and (C) soluble domain β-strands amino acids 10–15 and 90–96. Map to model fits for EccD3-extended for (D) transmembrane helix 1, amino acids 163–181 (E) transmembrane helix 11, amino acids 446–469 (F) soluble loop, amino acids 297–315. (G) Conservation mapping onto the residues of the EccD3 linker, amino acids 100–127. (H) Amino acids 100–127 from EccD3-bent (yellow) interact with EccB3 (pink) and EccC3 (blue). (I) Amino acids 100–127 of EccD3-extended (green), in a distinct conformation, interact with EccE3 (orange) and EccD3-bent (yellow).

Figure 3 with 1 supplement
The structure and protein-protein interactions of EccE3.

(A) The placement of EccE3 in the overall ESX-3 dimer. (B) Atomic model of EccE3 (C) Transmembrane helix 1 of EccE3 interacts with transmembrane helix 11 of EccD3-bent (D) Two soluble helices of EccE3 interact with EccD3-extended and EccD3-bent.

Figure 3—figure supplement 1
EccE3 map and model.

(A) Map and model comparison for transmembrane helix 1, amino acids 1 to 18. (B) Beta strand separation, amino acids amino acids 221 to 240. (C) A single beta strand, amino acids 117 to 126. (D) Conservation mapping onto transmembrane helix1 of EccE3 and transmembrane helix11 of EccD3-bent. (E) Comparison between the structure of EccE3 and the top DALI hit 5FXF-B. (F) Close up on the FADH (cyan) binding pocket of 5fxf-B which is not present in EccE3. (G) Conservation mapping onto the protein-protein interaction soluble helix of EccE3. (H) Residues 133–163 of EccE3 interact substantially with EccD3-bent and EccD3-extended, holding the flexible linker of EccD3-extended in the extended conformation. (H) EccE3 (orange) stabilizes the extended conformation of EccD3-extended (green) and sterically hinders it from adopting the bent conformation (neon green).

Figure 4 with 2 supplements
The structure and protein-protein interactions of EccC3.

(A) The placement of EccC3 in the overall ESX-3 dimer. (B) Atomic model of the EccC3 DUF (C) The stalk helices of EccC3 interact with EccB3, EccD3-bent, and EccD3-extended (D) Interactions between EccC3 and the ubiquitin-like domains of EccD3-bent and EccD3-extended in the cytoplasm.

Figure 4—figure supplement 1
EccC3 map and model.

(A) Map and model of the EccC DUF domain, amino acids amino acids 97 to 130. (B) Two beta strands in the EccC DUF domain, amino acids 314 to 319 and 337 to 343. (C) Beta strand in the EccC DUF domain, amino acids 314 to 319. (D) Overlay of the model of the EccC DUF domain with the top DALI hit, 4NH0-A (white). (E) Close up of the ATP binding pocket of 4NH0-A. The ATPase fold remains intact in the DUF domain.

Figure 4—figure supplement 2
Conformational differences between protomer i and protomer ii.

(A) Overlay of the focused refined maps of the transmembrane and upper cytoplasmic regions of protomer i (red) and protomer ii (blue). The two protomers are nearly identical except in the transmembrane domains of EccC3 and the N-terminal tail of EccB3. (B) Density subtraction of the two protomers in A highlights the regions of difference. Specifically, the transmembrane helixes of EccC3 adopt distinct conformations across protomers. (C) In protomer i, 4NH0, the crystal structure of EccC from T. curvata, fits well in the density. In protomer ii, ATPase 2 and 3 fit well into the density but the position of ATPase 1 in the crystal structure, shown by the red dotted circle, does not fit into the density. A density of about the right size for ATPase 1 is shown in yellow. Fitting of ATPase 1 in this density requires the disruption of the interface between ATPase 1 and ATPase 2.

Figure 5 with 1 supplement
The periplasmic multimerization domain.

(A) EccB3 (pink) in the context of the overall ESX-3 dimer (gray transparency). EccB3 has a single-pass transmembrane domain which extends into a large periplasmic domain which was resolved at 5.8 Å resolution. (B) Atomic models of the EccB3 cytoplasmic and transmembrane domains, amino acids 14–93 and 32–93. (C) The N-terminus of EccB3 forms extensive cross-protomer contacts with EccC3 (blue), EccD3-bent (yellow), and EccD3-extended (green). (D) An unsharpened map of the ESX-3 dimer reveals ordered densities consistent with lipids or detergent molecules mediating the interactions between the EccB3 transmembrane helix (marked with a pink dot) and the EccC3 transmembrane helices.

Figure 5—figure supplement 1
EccB3 maps and models.

(A) Fit between map and model in the linker helix, amino acids 34 to 54. (B) Fit between map and model in the transmembrane helix, amino acids 65 to 85. (C) Fit between homology models of the soluble domain of EccB3 and the periplasmic focused refinement map.

Figure 6 with 1 supplement
Two models of the ESX-3 translocon complex.

ATPase activity entails, at a minimum, oligomerization of ATPase 1 to bring the R-finger (R) into proximity of the catalytic site, marked by the Walker A motif (WA). This requires at least 65 Å of movement from the position seen in the structure. (A) The first model of ESX substrate secretion involves trimerization of the ESX-3 dimer followed by multimerization of the EccC ATPase domains into a stack of one to four rings of ATPases (B) The second model shown through the function of a single protomer of the ESX-3 complex. Substrates are selected by interaction with ATPase 3 of EccC and transported via the upper cytoplasmic region to the EccD cavity for secretion.

Figure 6—figure supplement 1
A hexameric model of the ESX-3 dimer.

(A) Fit of three copies of the transmembrane and upper cytoplasmic regions of the ESX-3 translocon complex into the ESX-5 hexameric structure (EMDB 3596). The ESX-3 translocon complex was filtered to 6 Å resolution to permit easy visualization of the EccC3 transmembrane helices. (B) The model of the ESX-3 translocon complex for the full transmembrane and upper cytoplasmic domains (including homology models of the EccC3 transmembrane helices accurate to 6 Å resolution) colored by protein. (C) The full model of the ESX-3 translocon complex including homology models for all three EccC3 ATPase domains and the periplasmic domain of EccB3 docked into the ESX-5 negative stain map. Red represents areas were atoms clash substantially.

Author response image 1

Tables

Table 1
Data collection and refinement statistics.

Collection parameters for initial test data set and void peak analysis on the Talos Arctica and final collection on Titan Krios microscopes. Refinement details for initial model, consensus map, and focused refinements.

Data Collection
CollectionInitial ScreeningCollection 1Collection 2Void peak
MicroscopeTalos ArcticaTitan KriosTitan KriosTalos Arctica
Voltage (kV)200300300200
DetectorGatan K2Gatan K2Gatan K2Gatan K3
Pixel size (Å/pixel)1.140.820.820.9
Exposure Time (s)9101011.7
Electron dose (e-/Å2)63806758
Defocus range (µm)1.5-2.50.4-1.20.6-1.41.5-2.5
Number of micrographs2,4992,7054,6321,215
Consensus Reconstruction
Data SetInitial ScreeningCollection 1 & 2Void peak
SoftwareRelion 2.1, cisTEM, and cryosparcRelion 3.0cisTEM
# of particles, picked240,000778,149259,333
# of particles post, Class2D138,000554,901640
# of particles post, Class3D46,830362,438NA
# of particles post, skip align Class3DNA90,479NA
SymmetryC1C1NA
Map sharpening B-factor (Å2)NA-160NA
Final resolution (Å)4.7 Å4.0 ÅNA
Focused Refinements
Location of focus# of particlesResolution
Protomer i76,9673.8
Protomer ii90,4793.8
Symmetry expanded protomer52,0673.7
Periplasmic EccB370,0005.8
ATPase 1, 2, and 330,0007
Key resources table
Reagent type (species)
or resource
DesignationSource or
reference
IdentifiersAdditional
Information
Biological sample Mycobacterium smegmatismc(2)155ATCC700084Wild type strain
Biological sample Mycobacterium smegmatismc(2)155 with ideR::mγδ200 (KanR)Dussurget et al., 1996, Provided by GM Rodriguez
Biological sample Mycobacterium smegmatismc(2)155, MSMEG_0626-3C-EGFPThis paper
Biological sample Mycobacterium smegmatismc(2)155 with ideR::mγδ200 (KanR), MSMEG_0626-3C-EGFPThis paper
Recombinant DNA reagentpKM444Murphy et al., 2018Addgene Plasmid #108319Plasmid encoding for Che9c phage RecT and Bxb1 phage Integrase
Recombinant DNA reagentpKM444 - zeoThis paperAddition of zeocin resistance cassette to pKM444 plasmid
Recombinant DNA reagentpKM468-3C-EGFPThis paperModified ORBIT tagging plasmid 
Sequenced-based reagentORBIT targeting oligonucleotideThis paperOligo5’ TGTGCGTTCCACTGGTTCCCCGGCAACCACCTGCTGCACGTGAGCCAGCCGGACTACCTAGGTTTGTACCGTACACCACTGAGACCGCGGTGGTTGACCAGACAAACCCGCCGGATGACCCGCTTCCTGCGCGGCTTCATGTTCGACTGAACCCTTCACCGAGGTCCG 3’
AntibodyAnti-GFP stabilized antibody preparationRocheCat. #: 11814460001Dilution 1:10000
AntibodyAnti-mouse IgG HRP-conjugated antibodyR&D SystemsCat. #: HAF007Dilution 1:5000
AntibodyGoat anti-rabbit IgG antibody HRPGenScriptCat. #: A00098Dilution 1:5000
AntibodyRabbit anti-GroELSigma-AldrichCat. #: G6532-.5MLDilution 1:5000
Peptide, recombinant proteinHuman Rhinovirus (HRV) 3C ProteaseThermo Scientific PierceCat. #: 88946
Commercial assay or kitSuperose 6 Increase 10/300 GLGE HealthcareCat. #: 29091596
Chemical compound, detergentDDM, n-Dodecyl-β-D-MaltopyranosideInalcoCat. #: 1758-1350
Chemical compound, detergentGDN, glyco-diosgeninAnatraceCat. #: GDN101
OtherNativePAGE 3-12% Bis-Tris Protein Gels, 1.0 mm, 10-wellThermoFisher ScientificCat. #: BN1001BOX
Commercial assay or kitPierce Silver Stain KitPierceCat. #: PI24612
Software, algorithmSerialEMMastronarde, 2005https://bio3d.colorado.edu/SerialEM/
Software, algorithmMotionCor2Zheng et al., 2017http://msg.ucsf.edu/em/software/motioncor2.html
Software, algorithmCTFfind4Rohou and Grigorieff, 2015https://grigoriefflab.umassmed.edu/ctffind4
Software, algorithmRELIONScheres, 2012cam.ac.uk/relion/index.php/Download_%26_install
Software, algorithmcisTEMGrant et al., 2018https://cistem.org/
Software, algorithmcryosparcPunjani et al., 2017https://cryosparc.com/docs/reference/install/
Software, algorithmpyemAsarnow et al., 2019https://github.com/asarnow/pyem
Software, algorithmcootEmsley et al., 2010https://www2.mrc-lmb.cam.
Software, algorithmraptorXKällberg et al., 2012http://raptorx.uchicago.edu/
Software, algorithmphenix real space refineAfonine et al., 2018https://www.phenix-online.
Software, algorithmMDFFTrabuco et al., 2009org/documentation/reference/refinement.html
Software, algorithmnamdinatorKidmose et al., 2019https://namdinator.au.dk/
Software, algorithmpisaKrissinel, 2015http://www.ccp4.ac.uk/pisa/
Software, algorithmchimeraPettersen et al., 2004https://www.cgl.ucsf.edu/chimera/
Software, algorithmchimeraXGoddard et al., 2018https://www.cgl.ucsf.edu/chimerax/
Software, algorithmDALIHolm and Laakso, 2016http://ekhidna2.biocenter.helsinki.fi/dali/

Data availability

The map files have been deposited at the EMDB with code 20820. The entry is online at https://www.ebi.ac.uk/pdbe/entry/emdb/EMD-20820. The model has been deposited at the PDB with the code 6UMM. It is online at http://www.rcsb.org/structure/6UMM.

The following data sets were generated
  1. 1
    RCSB Protein Data Bank
    1. N Poweleit
    2. OS Rosenberg
    (2019)
    ID 6UMM. A complete structure of the ESX-3 translocon complex.
  2. 2
    Electron Microscopy Data Bank
    1. N Poweleit
    2. OS Rosenberg
    (2019)
    ID 20820. A complete structure of the ESX-3 translocon complex.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)