Figures and data in The structure of the endogenous ESX-3 secretion system

Figures
Tables
Additional files

7 figures, 2 tables and 4 additional files

Figures

Figure 1 with 6 supplements

Download asset Open asset

Overview of the ESX-3 tagging, purification, and structure.

(A) The ESX-3 operon in *M. smegmatis* and the placement of the purification tag. Genomic deletion of *ideR* derepresses ESX-3 to boost expression for purification. (B) SDS-PAGE of purified ESX-3 shows four major bands corresponding to EccB₃, EccC₃, EccD₃, and EccE₃. (C) Blue native page of the purified ESX-3 complex shows a large molecular weight band around 900 kDa. (D) Merged maps of all focused refinement maps (gray transparency) of the ESX-3 dimer filtered to 10 Å resolution. The transmembrane and upper cytoplasmic focused maps (3.7 Å) are segmented by subunit showing one copy per protomer of EccB₃ (pink), EccC₃ (blue), EccE₃ (orange), EccD_3-bent (yellow), and EccD_3-extended (green). (E) Atomic models of the transmembrane and upper cytoplasmic regions. (F) A combined map of the full complex filtered to 10 Å resolution (gray transparency) with full models for each protein, EccD_3-bent (yellow), EccD_3-extended (green), EccE₃ (orange), EccC₃ (blue), and EccB₃ (pink).

Figure 1—figure supplement 1

Download asset Open asset

ORBIT tagging of the chromosomal copy of EccE₃.

(A) Diagram of the ESX-3 operon in *M. smegmatis* mc(2)155. (B) The targeting oligo used to insert the *attP* site into the chromosome. (C) The tagging plasmid.(D) Cartoon of the resulting change to the chromosome after ORBIT.

Figure 1—figure supplement 2

Download asset Open asset

ESX-3 dimer purification optimization.

(A) Western blot of solubilized cell material with EccE3 tagged with EGFP. Lane 1, wild type background. Lane 2, *ΔideR* background. (B) Size exclusion profile for the ESX-3 dimer purified on a Superose 6 10/300column.

Figure 1—figure supplement 3

Download asset Open asset

Examination of the void volume.

(A) Size exclusion profile with void volume and peak fractions indicated. (B) SDS-PAGE of all fractions from the beginning of elution until the end of the peak fraction. (C) BN-PAGE of the void and peak fractions (D) Cryo-EM of the void volume. Scale bar 50 nm (E) 2D class averages of the particles picked from the void volume, some classes reveal possible higher order oligomers. Scale bar 20 nm.

Figure 1—figure supplement 4

Download asset Open asset

Initial data collection and initial model generation.

An initial data set was collected on a Talos Arctica microscope. The final refinement from this data processing was used as the starting model for future data processing.

Figure 1—figure supplement 5

Download asset Open asset

Data processing workflow for final data collection.

Data was collected on a Titan Krios. Particles from the final reconstruction were subsequently used for focused classification and refinement.

Figure 1—figure supplement 6

Download asset Open asset

Consensus and focused refinements.

(A) Consensus refinement map and FSC curve for the ESX-3 complex. Focused refinement maps and FSC curves for (B) the left protomer of the ESX-3 complex, (C) the right protomer of the ESX-3 complex, (D) a symmetry expanded protomer, (E) the periplasmic domain of EccB and (F) the lower ATPase domains of EccC. All maps are unsharpened and unmasked.

Figure 2 with 1 supplement

Download asset Open asset

The structure of EccD₃.

(A) EccD_3-bent (yellow) and EccD_3-extended (green) in the context of the overall ESX-3 dimer (gray transparency). (B) Atomic models of EccD_3-bent and EccD_3-extended (C) An unsharpened electron microscopy density map of the ESX-3 dimer shows extra densities consistent with lipid or detergent molecules (teal) on the periplasmic face of the EccD₃ cavity. (D) EccD_3-bent (yellow) and EccD_3-extended (green) aligned based on the transmembrane regions shows two distinct conformations of the EccD₃ cytoplasmic domains. Amino acids 100–127 of EccD₃ adopt a bent (yellow) and an extended (green) conformation.

Figure 2—figure supplement 1

Download asset Open asset

EccD₃ map and model.

Map to model fits for EccD_3-bent for (A) transmembrane helix 1, amino acids 136–153, (B) transmembrane α-helix 1, amino acids 385–402, and (C) soluble domain β-strands amino acids 10–15 and 90–96. Map to model fits for EccD_3-extended for (D) transmembrane helix 1, amino acids 163–181 (E) transmembrane helix 11, amino acids 446–469 (F) soluble loop, amino acids 297–315. (G) Conservation mapping onto the residues of the EccD₃ linker, amino acids 100–127. (H) Amino acids 100–127 from EccD_3-bent (yellow) interact with EccB₃ (pink) and EccC₃ (blue). (I) Amino acids 100–127 of EccD_3-extended (green), in a distinct conformation, interact with EccE₃ (orange) and EccD_3-bent (yellow).

Figure 3 with 1 supplement

Download asset Open asset

The structure and protein-protein interactions of EccE₃.

(A) The placement of EccE₃ in the overall ESX-3 dimer. (B) Atomic model of EccE₃ (C) Transmembrane helix 1 of EccE₃ interacts with transmembrane helix 11 of EccD_3-bent (D) Two soluble helices of EccE₃ interact with EccD_3-extended and EccD_3-bent.

Figure 3—figure supplement 1

Download asset Open asset

EccE₃ map and model.

(A) Map and model comparison for transmembrane helix 1, amino acids 1 to 18. (B) Beta strand separation, amino acids amino acids 221 to 240. (C) A single beta strand, amino acids 117 to 126. (D) Conservation mapping onto transmembrane helix1 of EccE₃ and transmembrane helix11 of EccD_3-bent. (E) Comparison between the structure of EccE₃ and the top DALI hit 5FXF-B. (F) Close up on the FADH (cyan) binding pocket of 5fxf-B which is not present in EccE₃. (G) Conservation mapping onto the protein-protein interaction soluble helix of EccE₃. (H) Residues 133–163 of EccE₃ interact substantially with EccD_3-bent and EccD_3-extended, holding the flexible linker of EccD_3-extended in the extended conformation. (H) EccE₃ (orange) stabilizes the extended conformation of EccD_3-extended (green) and sterically hinders it from adopting the bent conformation (neon green).

Figure 4 with 2 supplements

Download asset Open asset

The structure and protein-protein interactions of EccC₃.

(A) The placement of EccC₃ in the overall ESX-3 dimer. (B) Atomic model of the EccC₃ DUF (C) The stalk helices of EccC₃ interact with EccB₃, EccD_3-bent, and EccD_3-extended (D) Interactions between EccC₃ and the ubiquitin-like domains of EccD_3-bent and EccD_3-extended in the cytoplasm.

Figure 4—figure supplement 1

Download asset Open asset

EccC₃ map and model.

(A) Map and model of the EccC DUF domain, amino acids amino acids 97 to 130. (B) Two beta strands in the EccC DUF domain, amino acids 314 to 319 and 337 to 343. (C) Beta strand in the EccC DUF domain, amino acids 314 to 319. (D) Overlay of the model of the EccC DUF domain with the top DALI hit, 4NH0-A (white). (E) Close up of the ATP binding pocket of 4NH0-A. The ATPase fold remains intact in the DUF domain.

Figure 4—figure supplement 2

Download asset Open asset

Conformational differences between protomer i and protomer ii.

(A) Overlay of the focused refined maps of the transmembrane and upper cytoplasmic regions of protomer i (red) and protomer ii (blue). The two protomers are nearly identical except in the transmembrane domains of EccC₃ and the N-terminal tail of EccB₃. (B) Density subtraction of the two protomers in A highlights the regions of difference. Specifically, the transmembrane helixes of EccC₃ adopt distinct conformations across protomers. (C) In protomer i, 4NH0, the crystal structure of EccC from *T. curvata*, fits well in the density. In protomer ii, ATPase 2 and 3 fit well into the density but the position of ATPase 1 in the crystal structure, shown by the red dotted circle, does not fit into the density. A density of about the right size for ATPase 1 is shown in yellow. Fitting of ATPase 1 in this density requires the disruption of the interface between ATPase 1 and ATPase 2.

Figure 5 with 1 supplement

Download asset Open asset

The periplasmic multimerization domain.

(A) EccB₃ (pink) in the context of the overall ESX-3 dimer (gray transparency). EccB₃ has a single-pass transmembrane domain which extends into a large periplasmic domain which was resolved at 5.8 Å resolution. (B) Atomic models of the EccB₃ cytoplasmic and transmembrane domains, amino acids 14–93 and 32–93. (C) The N-terminus of EccB₃ forms extensive cross-protomer contacts with EccC₃ (blue), EccD_3-bent (yellow), and EccD_3-extended (green). (D) An unsharpened map of the ESX-3 dimer reveals ordered densities consistent with lipids or detergent molecules mediating the interactions between the EccB₃ transmembrane helix (marked with a pink dot) and the EccC₃ transmembrane helices.

Figure 5—figure supplement 1

Download asset Open asset

EccB₃ maps and models.

(A) Fit between map and model in the linker helix, amino acids 34 to 54. (B) Fit between map and model in the transmembrane helix, amino acids 65 to 85. (C) Fit between homology models of the soluble domain of EccB₃ and the periplasmic focused refinement map.

Figure 6 with 1 supplement

Download asset Open asset

Two models of the ESX-3 translocon complex.

ATPase activity entails, at a minimum, oligomerization of ATPase 1 to bring the R-finger (R) into proximity of the catalytic site, marked by the Walker A motif (WA). This requires at least 65 Å of movement from the position seen in the structure. (A) The first model of ESX substrate secretion involves trimerization of the ESX-3 dimer followed by multimerization of the EccC ATPase domains into a stack of one to four rings of ATPases (B) The second model shown through the function of a single protomer of the ESX-3 complex. Substrates are selected by interaction with ATPase 3 of EccC and transported via the upper cytoplasmic region to the EccD cavity for secretion.

Figure 6—figure supplement 1

Download asset Open asset

A hexameric model of the ESX-3 dimer.

(A) Fit of three copies of the transmembrane and upper cytoplasmic regions of the ESX-3 translocon complex into the ESX-5 hexameric structure (EMDB 3596). The ESX-3 translocon complex was filtered to 6 Å resolution to permit easy visualization of the EccC₃ transmembrane helices. (B) The model of the ESX-3 translocon complex for the full transmembrane and upper cytoplasmic domains (including homology models of the EccC3 transmembrane helices accurate to 6 Å resolution) colored by protein. (C) The full model of the ESX-3 translocon complex including homology models for all three EccC₃ ATPase domains and the periplasmic domain of EccB₃ docked into the ESX-5 negative stain map. Red represents areas were atoms clash substantially.

Author response image 1

Download asset Open asset

Tables

Table 1

Data collection and refinement statistics.

Collection parameters for initial test data set and void peak analysis on the Talos Arctica and final collection on Titan Krios microscopes. Refinement details for initial model, consensus map, and focused refinements.

Data Collection
Collection	Initial Screening	Collection 1	Collection 2	Void peak
Microscope	Talos Arctica	Titan Krios	Titan Krios	Talos Arctica
Voltage (kV)	200	300	300	200
Detector	Gatan K2	Gatan K2	Gatan K2	Gatan K3
Pixel size (Å/pixel)	1.14	0.82	0.82	0.9
Exposure Time (s)	9	10	10	11.7
Electron dose (e-/Å²)	63	80	67	58
Defocus range (µm)	1.5-2.5	0.4-1.2	0.6-1.4	1.5-2.5
Number of micrographs	2,499	2,705	4,632	1,215
Consensus Reconstruction
Data Set	Initial Screening	Collection 1 & 2		Void peak
Software	Relion 2.1, cisTEM, and cryosparc	Relion 3.0		cisTEM
# of particles, picked	240,000	778,149		259,333
# of particles post, Class2D	138,000	554,901		640
# of particles post, Class3D	46,830	362,438		NA
# of particles post, skip align Class3D	NA	90,479		NA
Symmetry	C1	C1		NA
Map sharpening B-factor (Å²)	NA	-160		NA
Final resolution (Å)	4.7 Å	4.0 Å		NA
Focused Refinements
Location of focus	# of particles	Resolution
Protomer i	76,967	3.8
Protomer ii	90,479	3.8
Symmetry expanded protomer	52,067	3.7
Periplasmic EccB3	70,000	5.8
ATPase 1, 2, and 3	30,000	7

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional Information
Biological sample Mycobacterium smegmatis	mc(2)155	ATCC	700084	Wild type strain
Biological sample Mycobacterium smegmatis	mc(2)155 with ideR::mγδ200 (KanR)	Dussurget et al., 1996, Provided by GM Rodriguez
Biological sample Mycobacterium smegmatis	mc(2)155, MSMEG_0626-3C-EGFP	This paper
Biological sample Mycobacterium smegmatis	mc(2)155 with ideR::mγδ200 (KanR), MSMEG_0626-3C-EGFP	This paper
Recombinant DNA reagent	pKM444	Murphy et al., 2018	Addgene Plasmid #108319	Plasmid encoding for Che9c phage RecT and Bxb1 phage Integrase
Recombinant DNA reagent	pKM444 - zeo	This paper		Addition of zeocin resistance cassette to pKM444 plasmid
Recombinant DNA reagent	pKM468-3C-EGFP	This paper		Modified ORBIT tagging plasmid
Sequenced-based reagent	ORBIT targeting oligonucleotide	This paper	Oligo	5’ TGTGCGTTCCACTGGTTCCCCGGCAACCACCTGCTGCACGTGAGCCAGCCGGACTACCTAGGTTTGTACCGTACACCACTGAGACCGCGGTGGTTGACCAGACAAACCCGCCGGATGACCCGCTTCCTGCGCGGCTTCATGTTCGACTGAACCCTTCACCGAGGTCCG 3’
Antibody	Anti-GFP stabilized antibody preparation	Roche	Cat. #: 11814460001	Dilution 1:10000
Antibody	Anti-mouse IgG HRP-conjugated antibody	R&D Systems	Cat. #: HAF007	Dilution 1:5000
Antibody	Goat anti-rabbit IgG antibody HRP	GenScript	Cat. #: A00098	Dilution 1:5000
Antibody	Rabbit anti-GroEL	Sigma-Aldrich	Cat. #: G6532-.5ML	Dilution 1:5000
Peptide, recombinant protein	Human Rhinovirus (HRV) 3C Protease	Thermo Scientific Pierce	Cat. #: 88946
Commercial assay or kit	Superose 6 Increase 10/300 GL	GE Healthcare	Cat. #: 29091596
Chemical compound, detergent	DDM, n-Dodecyl-β-D-Maltopyranoside	Inalco	Cat. #: 1758-1350
Chemical compound, detergent	GDN, glyco-diosgenin	Anatrace	Cat. #: GDN101
Other	NativePAGE 3-12% Bis-Tris Protein Gels, 1.0 mm, 10-well	ThermoFisher Scientific	Cat. #: BN1001BOX
Commercial assay or kit	Pierce Silver Stain Kit	Pierce	Cat. #: PI24612
Software, algorithm	SerialEM	Mastronarde, 2005		https://bio3d.colorado.edu/SerialEM/
Software, algorithm	MotionCor2	Zheng et al., 2017		http://msg.ucsf.edu/em/software/motioncor2.html
Software, algorithm	CTFfind4	Rohou and Grigorieff, 2015		https://grigoriefflab.umassmed.edu/ctffind4
Software, algorithm	RELION	Scheres, 2012		cam.ac.uk/relion/index.php/Download_%26_install
Software, algorithm	cisTEM	Grant et al., 2018		https://cistem.org/
Software, algorithm	cryosparc	Punjani et al., 2017		https://cryosparc.com/docs/reference/install/
Software, algorithm	pyem	Asarnow et al., 2019		https://github.com/asarnow/pyem
Software, algorithm	coot	Emsley et al., 2010		https://www2.mrc-lmb.cam.
Software, algorithm	raptorX	Källberg et al., 2012		http://raptorx.uchicago.edu/
Software, algorithm	phenix real space refine	Afonine et al., 2018		https://www.phenix-online.
Software, algorithm	MDFF	Trabuco et al., 2009		org/documentation/reference/refinement.html
Software, algorithm	namdinator	Kidmose et al., 2019		https://namdinator.au.dk/
Software, algorithm	pisa	Krissinel, 2015		http://www.ccp4.ac.uk/pisa/
Software, algorithm	chimera	Pettersen et al., 2004		https://www.cgl.ucsf.edu/chimera/
Software, algorithm	chimeraX	Goddard et al., 2018		https://www.cgl.ucsf.edu/chimerax/
Software, algorithm	DALI	Holm and Laakso, 2016		http://ekhidna2.biocenter.helsinki.fi/dali/