Age and genotype of the larvae are mentioned in respective panels. (A–A') Model of lymph gland of third early and third late instar stages depicting anterior primary lobes and posterior lobes. (A’). …
Contains numerical data plotted in Figure 1D and G.
Age and genotype of the larvae are mentioned in respective panels. (A–B) Expression of Pvf2 in Dome- pre-progenitors in third early instar lymph gland (A) late third instar lymph glands lack Pvf2 …
Age and genotype of the larvae are mentioned in respective panels. (A–A'') LipidTOX labeling neutral lipids in Pvf2+ pre-progenitors in the early third instar lymph gland. (B–B''). LipidTOX labeling …
Contains numerical data plotted in Figure 1—figure supplement 2C and F.
(A) Schematic representation of fatty acid β-oxidation within the mitochondria of a cell. (B–D) Compared to control (B) decrease in differentiation (red, reported by P1 immunostaining) and increment …
Contains numerical data plotted in Figure 2D,G and X.
(A) Quantitative analysis of results from Figure 2H–I''. p-Value for progenitors of dome-GAL4, UAS-GFP; whd1/whd1 = 5.7×10−14 compared to control. p-Value for Intermediate progenitors of dome-GAL4, …
Contains numerical data plotted in Figure 2—figure supplement 1A,B,C,G,M and Q.
Hnf4 is a transcription factor implicated in mobilization of fatty acids and its oxidation in Drosophila. Hnf4 as well as members of FAO expresses in the hemocyte progenitors, loss of either one of …
Genotype of the larvae are mentioned in respective panels. (A–C) The difference in proliferation status (reported by EdU incorporation) in the lymph gland of third late instar control larvae (A–A') …
Contains numerical data plotted in Figure 3C,Dʹ, Eʹ and F.
Genotype of the larvae are mentioned in respective panels. (A–C) Elevated levels of Ci155 in the lymph gland of whd1 homozygous mutants (B) compared to control (A). (A'' and B''): Heat map is …
Contains numerical data plotted in Figure 3—figure supplement 1C and F.
Age and genotype of the larvae are mentioned in respective panels. (A–C) Comparison of differentiation (marked by P1) levels in dome > GFP lymph gland of control (A) and L-carnitine supplemented (B) …
Contains numerical data plotted in Figure 4C,F,K,N,Oʹ, Pʹ, and Q.
Age and genotype of the larvae are mentioned in respective panels. (A–E) Status of progenitors (dome > GFP) and differentiated hemocytes P1 in control (A), whd1 homozygous (B), whd1 heterozygous (C) …
Contains numerical data plotted in Figure 4—figure supplement 1E.
(A) ATP levels in control and whd1/whd1 whole larvae. p-Value of whd1/whd1compared to control = 5.327×10−2. (B–D) Glucose incorporation (marked by 2-NBDG uptake) levels in control dome-MESO-EBFP2/+ …
Contains numerical data plotted in Figure 5A,D,G,H,M and R.
(A–B) Glucose incorporation (marked by 2-NBDG uptake) levels in control dome-MESO-EBFP2/+; Hml-DsRed lymph glands (A–A'''). (B) Quantitative analysis of results from A–A'''. p-Value for IPs = 3.64×10…
Contains numerical data plotted in Figure 5—figure supplement 1B.
(A–H) Comparison of differentiation (marked by P1) levels in dome > GFP lymph gland of control (A) with progenitor-specific downregulation of (B) chm, (C) Gcn5, (D) AcCoAS and (E) whd1/whd1, (F) …
Contains numerical data plotted in Figure 6H,J,L,N and P.
(A–D) Clonal analysis of histone acetylation in GFP-positive hsFlp/Ay-GAL4 based mock clonal patches and immunostaining with H3K9 acetylation (A–A''') and H4 pan acetylation (B–B''') antibodies. (B).…
Contains numerical data plotted in Figure 6—figure supplement 1B,D,G,J and M.
(A–E) Comparison of differentiation (marked by P1) levels in dome > GFP lymph gland of control (A) dome > GFP supplemented with acetate (B) dome > GFP; whd1/whd1 (C) and dome > GFP; whd1/whd1 …
Contains numerical data plotted in Figure 7E,G,L,O and Q.
(A–C) Comparison of differentiation (marked by P1) levels in dome > GFP lymph gland of control (A), and bsk/JNK knockdown in hemocyte progenitors by dome-GAL4, UAS-GFP; tubGAL80ts20 > UAS-bskDN (B). …
Contains numerical data plotted in Figure 8C,H,I,K,M,O,T and Y.
(A–B''') Clonal analysis of histone acetylation in GFP-positive hsFlp/Ay-GAL4-based clonal patches expressing the dominant-negative form of bsk and immunostaining with H3K9 acetylation (A–A''') and …
Contains numerical data plotted in Figure 8—figure supplement 1E,H,K and P.
ROS-JNK link has been previously shown to be essential for differentiation (Owusu-Ansah and Banerjee, 2009). The G2-M arrested hemocyte progenitors employ β-oxidation for their differentiation. …
Five optical sections of 1µm thickness from the middle of the Z stack (No. 9-13) were merged into a single section for this panel.
Five optical sections of 1µm thickness from the middle of the Z stack (No. 7-11) were merged into a single section for this panel.
Five optical sections of 1µm thickness from the middle of the Z stack (No. 10-14) were merged into a single section for this panel.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Drosophila melanogaster) | dome | Flybase:FB2020_01 | FLYB:FBgn 0043903 | |
Gene (Drosophila melanogaster) | Hml | Flybase:FB2020_01 | FLYB:FBgn 0029167 | |
Gene (Drosophila melanogaster) | Tep4 | Flybase:FB2020_01 | FLYB:FBgn 0031888 | |
Gene (Drosophila melanogaster) | CG3902 | Flybase:FB2020_01 | FLYB:FBgn 0036824 | |
Gene (Drosophila melanogaster) | Mtpα | Flybase:FB2020_01 | FLYB:FBgn 0041180 | |
Gene (Drosophila melanogaster) | Mtpβ | Flybase:FB2020_01 | FLYB:FBgn 0025352 | |
Gene (Drosophila melanogaster) | whd | Flybase:FB2020_01 | FLYB:FBgn 0261862 | |
Gene (Drosophila melanogaster) | Hnf4 | Flybase:FB2020_01 | FLYB:FBgn 0041180 | |
Gene (Drosophila melanogaster) | chm | Flybase:FB2020_01 | FLYB:FBgn 0028387 | |
Gene (Drosophila melanogaster) | Gcn5 | Flybase:FB2020_01 | FLYB:FBgn 0020388 | |
Gene (Drosophila melanogaster) | AcCoAS | Flybase:FB2020_01 | FLYB:FBgn 0012034 | |
Gene (Drosophila melanogaster) | Glut1 | Flybase:FB2020_01 | FLYB:FBgn 0264574 | |
Gene (Drosophila melanogaster) | ATPCL | Flybase:FB2020_01 | FLYB:FBgn 0020236 | |
Gene (Drosophila melanogaster) | sea | Flybase:FB2020_01 | FLYB:FBgn 0037912 | |
Gene (Drosophila melanogaster) | bsk | Flybase:FB2020_01 | FLYB:FBgn 0000229 | |
Genetic reagent(Drosophila melanogaster) | dome-GAL4 | BloomingtonDrosophilaStock Center | BDSC:81010; FLYB:FBti0022298; RRID:BDSC_81010 | FlyBase symbol: P{GawB}domePG14 |
Genetic reagent (Drosophila melanogaster) | Hml-dsRed.Δ | Makhijani et al., 2011 | FLYB:FBgn 0041180 | FlyBase symbol: P{Hml-dsRed.Δ} |
Genetic reagent (Drosophila melanogaster) | HmlΔ-GAL4 | Sinenko and Mathey-Prevot, 2004 | FLYB: FBgn 0040877 | FlyBase symbol: P{Hml-GAL4.Δ} |
Genetic reagent (Drosophila melanogaster) | Pvf2-lacZ | Choi et al., 2008 | FLYB:FBtp0052107 | FlyBase symbol: P{Pvf2-lacZ.C} |
Genetic reagent (Drosophila melanogaster) | TepIV-GAL4 | Kyoto Stock Center | DGGR:105442; FLYB:FBti0037434; RRID:DGGR_105442 | FlyBase symbol: P{GawB}NP7379 |
Genetic reagent (Drosophila melanogaster) | CG3902-YFP | Kyoto Stock Center | DGGR:115356; FLYB:FBti0143519; RRID:DGGR_115356 | FlyBase symbol: PBac{566 .P.SVS-1}CG3902CPTI100004 |
Genetic reagent (Drosophila melanogaster) | Mtpα[KO] | Kyoto Stock Center | DGGR:116261; FLYB:FBal0267653; RRID:DGGR_116261 | FlyBase symbol: MtpαKO |
Genetic reagent (Drosophila melanogaster) | Mtpβ[KO] | Kyoto Stock Center | DGGR:116262; FLYB:FBal0267654; RRID:DGGR_116262 | FlyBase symbol: MtpβKO |
Genetic reagent (Drosophila melanogaster) | UAS-whd RNAi [KK] | ViennaDrosophila RNAi Center | VDRC:v105400; FLYB:FBti0116709; RRID:FlyBase_FBst0477227 | FlyBase symbol: P{KK100935}VIE-260B |
Genetic reagent (Drosophila melanogaster) | OreR | BloomingtonDrosophilaStock Center | BDSC:5; FLYB:FBsn0000277; RRID:BDSC_5 | FlyBase symbol: Oregon-R-C |
Genetic reagent (Drosophila melanogaster) | w[1118] | BloomingtonDrosophilaStock Center | BDSC:3605; FLYB:FBal0018186;RRID:BDSC_3605 | FlyBase symbol: w1118 |
Genetic reagent (Drosophila melanogaster) | UAS-Hnf4.miRNA | BloomingtonDrosophilaStock Center | BDSC:44398; FLYB:FBti0152533;RRID:BDSC_44398 | FlyBase symbol: P{UAS-Hnf4.miRNA}attP16 |
Genetic reagent (Drosophila melanogaster) | UAS-whd RNAi | BloomingtonDrosophilaStock Center | BDSC:34066; FLYB:FBal0263076; RRID:BDSC_34066 | FlyBase symbol: whdHMS00040 |
Genetic reagent (Drosophila melanogaster) | UAS-FOXO.P | BloomingtonDrosophilaStock Center | BDSC:9575; FLYB:FBtp0017636; RRID:BDSC_9575 | FlyBase symbol: P{UAS-foxo.P} |
Genetic reagent (Drosophila melanogaster) | Hnf4-GAL4 | BloomingtonDrosophilaStock Center | BDSC:47618; FLYB:FBti0136396; RRID:BDSC_47618 | FlyBase symbol: P{GMR50A12-GAL4}attP2 |
Genetic reagent (Drosophila melanogaster) | UAS-FUCCI | BloomingtonDrosophilaStock Center | BDSC:55121; RRID:BDSC_55121 | FlyBase symbol: P{UAS-GFP.E2f1.1–230}32; P{UAS-mRFP1.NLS.CycB.1–266}19 |
Genetic reagent (Drosophila melanogaster) | UAS-mito-HA-GFP | BloomingtonDrosophilaStock Center | BDSC:8442; FLYB:FBti0040803; RRID:BDSC_8442 | FlyBase symbol: P{UAS-mito-HA-GFP.AP}2 |
Genetic reagent (Drosophila melanogaster) | UAS-chm RNAi | BloomingtonDrosophilaStock Center | BDSC:27027; FLYB:FBal0220716; RRID:BDSC_27027 | FlyBase symbol: chmJF02348 |
Genetic reagent (Drosophila melanogaster) | UAS-Gcn5 RNAi | BloomingtonDrosophilaStock Center | BDSC:33981; FLYB:FBal0257611; RRID:BDSC_33981 | FlyBase symbol: Gcn5HMS00941 |
Genetic reagent (Drosophila melanogaster) | UAS-AcCoAS RNAi | BloomingtonDrosophilaStock Center | BDSC:41917; FLYB:FBal0279313; RRID:BDSC_41917 | FlyBase symbol: AcCoASHMS02314 |
Genetic reagent (Drosophila melanogaster) | UAS-Glut1RNAi | BloomingtonDrosophilaStock Center | BDSC:28645; FLYB:FBal0239561; RRID:BDSC_28645 | FlyBase symbol: Glut1JF03060 |
Genetic reagent (Drosophila melanogaster) | ATPCL[01466] | BloomingtonDrosophilaStock Center | BDSC:11055; FLYB:FBal0007976; RRID:BDSC_11055 | FlyBase symbol: ATPCL01466 |
Genetic reagent (Drosophila melanogaster) | sea[EP3364] | BloomingtonDrosophilaStock Center | BDSC:17118; FLYB:FBal0131420; RRID:BDSC_17118 | FlyBase symbol: seaEP3364 |
Genetic reagent (Drosophila melanogaster) | UAS-bsk[DN] | BloomingtonDrosophilaStock Center | BDSC:6409; FLYB:FBti0021048; RRID:BDSC_6409 | FlyBase symbol: P{UAS-bsk.DN}2 |
Genetic reagent (Drosophila melanogaster) | UAS-mCD8::GFP | BloomingtonDrosophilaStock Center | BDSC:5137; FLYB:FBti0180511; RRID:BDSC_5137 | FlyBase symbol: P{UAS-mCD8::GFP.L}2 |
Genetic reagent (Drosophila melanogaster) | UAS-mCD8::RFP | BloomingtonDrosophilaStock Center | BDSC:27400; FLYB:FBti0115747; RRID:BDSC_27400 | FlyBase symbol: P{UAS-mCD8.mRFP.LG}28a |
Genetic reagent (Drosophila melanogaster) | U-6;sgRNA-whd-KO | BloomingtonDrosophilaStock Center | BDSC:77066; FLYB:FBal0335953; RRID:BDSC_77066 | FlyBase symbol: whdTKO.GS00854 |
Genetic reagent (Drosophila melanogaster) | U-6;sgRNA-whd-OE | BloomingtonDrosophilaStock Center | BDSC:68139; FLYB:FBal0337690; RRID:BDSC_68139 | FlyBase symbol: whdTOE.GS00536 |
Genetic reagent (Drosophila melanogaster) | whd[1] | BloomingtonDrosophilaStock Center | BDSC:441; FLYB:FBal0018515; RRID:BDSC_441 | FlyBase symbol: whd1 |
Genetic reagent (Drosophila melanogaster) | Hnf4[Δ33] | BloomingtonDrosophilaStock Center | BDSC:43634; FLYB:FBal0240651; RRID:BDSC_43634 | FlyBase symbol: Hnf4Δ33 |
Genetic reagent (Drosophila melanogaster) | Hnf4[Δ17] | BloomingtonDrosophilaStock Center | BDSC:44218; FLYB:FBal0240650; RRID:BDSC_44218 | FlyBase symbol: Hnf4Δ17 |
Genetic reagent (Drosophila melanogaster) | tubGAL80[ts20] | BloomingtonDrosophilaStock Center | BDSC:7109; FLYB:FBti0027796; RRID:BDSC_7109 | FlyBase symbol: P{tubP-GAL80ts}20 |
Genetic reagent (Drosophila melanogaster) | hsFlp | BloomingtonDrosophilaStock Center | BDSC:1929; FLYB:FBti0000784; RRID:BDSC_1929 | FlyBase symbol: P{hsFLP}12 |
Genetic reagent (Drosophila melanogaster) | Ay-GAL4, UAS-GFP | BloomingtonDrosophilaStock Center | BDSC:4411; FLYB:FBti0012290;FBti0003040RRID:BDSC_4411 | FlyBase symbol: P{AyGAL4}25; P{UAS-GFP.S65T}Myo31DFT2 |
Antibody | anti-P1 (Mouse monoclonal) | Kurucz et al., 2007 | Cat# NimC1, RRID:AB_2568423 | IF(1:50) |
Antibody | anti-Pxn (Mouse) | Nelson et al., 1994 | IF(1:400) | |
Antibody | anti-proPO (Rabbit polyclonal) | Jiang et al., 1997 | IF(1:1000) | |
Antibody | anti-DE-cadherin (Rat polyclonal) | Developmental Studies Hybridoma Bank | Cat# DE-cad, RRID:AB_2314298 | IF(1:50) |
Antibody | anti-Ci155(Rat polyclonal) | Developmental Studies Hybridoma Bank | Cat# 2A1, RRID:AB_2109711 | IF(1:2) |
Antibody | anti-GFP (Rabbit polyclonal) | Invitrogen | Cat# A-11122, RRID:AB_221569 | IF(1:100) |
Antibody | anti-H3 (Rabbit polyclonal) | Cell Signaling Technologies | Cat# 9927, RRID:AB_330200 | IF(1:400), WB(1:1000) |
Antibody | anti-H3K9 acetylation (Rabbit polyclonal) | Cell Signaling Technologies | Cat# 9927, RRID:AB_330200 | IF(1:300), WB(1:1000) |
Antibody | anti-H4 pan acetylation (Rabbit polyclonal) | Cell Signaling Technologies | Cat# 06–598, RRID:AB_2295074 | IF(1:500) |
Chemical compound, drug | Sodium butyrate | EMD Millipore | 19–137 | |
Chemical compound, drug | Nicotinamide | Sigma-Aldrich | 72345 | |
Chemical compound, drug | Etomoxir | Cayman Chemicals | Cay11969 | 5 µM |
Chemical compound, drug | Mildronate | Cayman Chemicals | Cay15997 | 100 µM |
Chemical compound, drug | L-carnitine hydrochloride | Sigma-Aldrich | C0283 | 100 mM |
Chemical compound, drug | 2-DG | Sigma-Aldrich | D8375 | 100 mM |
Chemical compound, drug | Sodium acetate | Sigma-Aldrich | 71196 | 50 mM |
Chemical compound, drug | 2-NBDG | Invitrogen | N13195 | 0.25 mM |
Chemical compound, drug | LipidTOX | Molecular Probes | H34477 | 1:1000 |
Chemical compound, drug | Streptavidin-Cy3 | Molecular Probes | SA1010 | 1:200 |
Chemical compound, drug | Nile red | Molecular Probes | N1142 | 0.5 ug/mL |
Chemical compound, drug | DHE (Dihydroxy Ethidium) | Molecular Probes | D11347 | 0.3 µM |
Sequence-based reagent | Pfk_F | This paper | PCR primers | ATCGTATTTTGGCTTGCCGC |
Sequence-based reagent | Pfk_R | This paper | PCR primers | CCAGAGAGATGACCACTGGC |
Sequence-based reagent | Hex_F | This paper | PCR primers | CTGCTTCTAACGGACGAACAG |
Sequence-based reagent | Hex_R | This paper | PCR primers | GCCTTGGGATGTGTATCCTTGG |
Sequence-based reagent | whd_F | This paper | PCR primers | GGCCAATGTGATTTCCCTGC |
Sequence-based reagent | whd_R | This paper | PCR primers | TGCCCTGAACCATGATAGGC |
Sequence-based reagent | Act5C_F | This paper | PCR primers | ACACATTTTGTAAGATTTGGTGTGT |
Sequence-based reagent | Act5C_R | This paper | PCR primers | CCGTTTGAGTTGTGCTGT |
Sequence-based reagent | Mcad_F | This paper | PCR primers | GGCCTGGATCTCGATGTGTT |
Sequence-based reagent | Mcad_R | This paper | PCR primers | GATCACAGGAGTTTGGCCCAG |
Sequence-based reagent | Mtpα_F | This paper | PCR primers | ATCACTGTTGGTGACGGACC |
Sequence-based reagent | Mtpα_R | This paper | PCR primers | CTGCAGCAGTCTGATGGCTT |
Sequence-based reagent | scully_F | This paper | PCR primers | GATCAAGAACGCCGTTTCCC |
Sequence-based reagent | scully_R | This paper | PCR primers | CAGATCGGCCAGGATCACG |
Sequence-based reagent | Mtpβ_F | This paper | PCR primers | CAGGCACTCGCTTTTGTCAT |
Sequence-based reagent | Mtpβ_R | This paper | PCR primers | CCTGGCAATGTTGGAGGTCT |
Sequence-based reagent | yip2_F | This paper | PCR primers | TCTGCCGCAACCAAAGGTAT |
Sequence-based reagent | yip2_R | This paper | PCR primers | TTAAGACCGGCAGCATCCAG |
Software, algorithm | Fiji | Fiji | RRID:SCR_002285 | |
Software, algorithm | Photoshop CC | Adobe | RRID:SCR_014199 | |
Software, algorithm | Imaris | Bitplane | RRID:SCR_007370 | |
Commercial assay or kit | Click-iT EdU plus (DNA replication kit) | Invitrogen | C10639 | |
Commercial assay or kit | ATP bioluminescence kit HSII | Sigma | 11699709001 | |
Commercial assay or kit | Histone extraction kit | Abcam | ab113476 | |
Commercial assay or kit | RNAeasy Mini Kit | Qiagen | 74104 |