ZCWPW1 is recruited to recombination hotspots by PRDM9 and is essential for meiotic double strand break repair
- The Wellcome Centre for Human Genetics, Roosevelt Drive, University of Oxford, United Kingdom
- Department of Statistics, University of Oxford, United Kingdom
Figures
Figure 1 with 1 supplement
Domain organisation (A) and evolutionary conservation (B) of ZCWPW1, and co-evolution with PRDM9 (C,D).
(A) Protein domains in the human and mouse proteins (source: UniProt). Amino acid start and end positions of each domain are shown above and below the rectangles, respectively. Prediction of SCP-1 …
-
Figure 1—source data 1
ZCWPW1 identified orthologues.
Notes on Table columns: aThe number of 31 perfectly conserved amino acids within strong ZCWPW1 orthologues that match, and are sequenced/align, respectively. bThe number of 78 moderately conserved (entropy <1) amino acids within strong ZCWPW1 orthologues that match, and are sequenced/align, respectively. cStart and end positions of alignment to human reference ZCWPW1. dThe taxonomic relationship of this species to the closest species possessing a copy of PRDM9 with a likely functional SET domain (Baker et al., 2017). eThe number of 37 amino acids, which do not vary in species also shown to possess a copy of PRDM9 with a likely functional SET domain (Baker et al., 2017), which mismatch the expected amino acid in this copy of ZCWPW1 (0 for cases with a perfect match).
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig1-data1-v2.xlsx
-
Figure 1—source data 2
PRDM9 orthologues (Baker et al., 2017).
Notes on Table columns: fThe taxonomic relationship of this species to the closest species possessing a copy of ZWPW1 we annotated. gData are reproduced from Baker et al., 2017, so columns A, B, C are taken directly from Supplementary File 1 in that paper. hIn Supplementary File 1 (Baker et al., 2017) the identified domains of PRDM9 are given in each observed orthologue. We identified a species-based ‘maximum’ domain set by recording which of three N-terminal domains (SET, KRAB, SSXRD) were present in that species (in one or more orthologues of PRDM9 identified in that species). iIn Supplementary File 1 (Baker et al., 2017), the presence/absence of each of three catalytic tyrosine residues (Y276,341,357) of the human PRDM9 SET domain is given for each PRDM9 ortholog, and we summed these to make a total (0–3). We constructed a species-based maximum value for this sum ‘Y276,341,357.Max.sum’ by taking the maximum value of this sum observed across all PRDM9 orthologues identified in a given species.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig1-data2-v2.xlsx
Figure 1—figure supplement 1
ZCWPW1 is specifically expressed in testis in humans.
Data Source: GTEx Analysis Release V7 (dbGaP Accession phs000424.v7.p2). (A) Total expression by human tissue type. (B) Isoforms of ZCWPW1 expressed in human testis.
Figure 2 with 2 supplements
Expression of ZCWPW1 across meiosis prophase I in mouse testis.
Nuclear spreads from 9 to 10 weeks old WT mice were immunostained with antibodies against ZCWPW1 (red) and the synaptonemal complex protein SYCP3 (green) which labels the chromosome axis, and …
-
Figure 2—source data 1
Immuno-FISH analysis of ZCWPW1 foci localisation at the synaptonemal complex ends in WT testis (mid-Pachytene to Late Diplotene cells).
Only chromosomes clearly identifiable were included in the analysis. X and Y were excluded as they are covered in ZCWPW1 signal (which strong labels the XY body). Stages: P, Pachytene; D, Diplotene. Tel: Telomeric probe. Cen: Centromeric probe.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
ZCWPW1 antibody generation and validation.
(A) Expression and purification of full-length recombinant mouse ZCWPW1 (mZCWPW1) in E. Coli. Left panel: SDS-PAGE analysis and Coomassie blue staining of bacterial lysates before (pre-IPTG) and …
Figure 2—figure supplement 2
ZCWPW1 localises to both subtelomeric and subcentromeric regions of chromosomes in pachytene cells.
(A) Testis chromosome spreads from 10-week-old WT mice were immunostained for SYCP3 and ZCWPW1, and hybridised by FISH with distal telomeric (Tel) and proximal centromeric (Cen) probes. To aid the …
Figure 3 with 2 supplements
Zcwpw1−/ male mice show reduced testis size and asynapsis, similar to the Prdm9−/− mutant.
(A) Schematic of the Zcwpw1 knockout (KO) mouse line. E: Exon. gRNA: guideRNA. Sanger sequencing DNA chromatograms of wild-type (WT) and KO mice encompassing the deletion are shown. The intron-exon …
-
Figure 3—source data 1
Fertility measures in WT (+/+), Zcwpw1-/- and Prdm9-/- males.
Fertility was assessed in mice ranging from 8 to 12 weeks of age through measurement of paired testes weight and sperm count. Mouse ID is consistent across Figure 3—source data 2 and Figure 4—source data 1.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Breeding performance of Zcwpw1-/- females.
All females were crossed with a WT male. N/A, not applicable; TLL, total litter loss; *assigned a value of 0 as the number of pups born in the total counts.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig3-data2-v2.xlsx
Figure 3—figure supplement 1
Loss of ZCWPW1 expression in Zcwpw1−/− mouse testis.
(A) Testis protein extracts from adult (10–12 weeks old) B6 wild-type (WT), Zcwpw1−/− and Prdm9−/− were immunoprecipitated with an anti-ZCWPW1 antibody (2.7mg/IP), followed by western blot detection …
Figure 3—figure supplement 2
Asynapsis, and lack of XY body formation and crossover sites in Zcwpw1−/− mouse testis.
Testis chromosome spreads from 9- to 12-week-old WT, Zcwpw1−/− and Prdm9−/− mice were immunostained with antibodies against SYCP3 (A–B), γ-H2AX (phosphorylated form) and HORMAD2 (A), or MLH1 and …
-
Figure 3—figure supplement 2—source data 1
Impaired synapsis in Zcwpw1-/- males.
The number of normal pachytene cells showing full synapsis of all autosomes and sex chromosomes (expressed as ‘% synapsis’ of all cells analysed) was determined by immunostaining of testis chromosome spreads against SYCP3, HORMAD2 and γ-H2AX (see images in Figure 3—figure supplement 2). The nature of the defects observed in cells with asynapsis was recorded as either ‘tangled’ (when chromosomes pair with the wrong partner, forming branched tangled structures); ‘multibodies’ strongly positive for HORMAD2 (when asynapsed chromosomes form multiple XY-like bodies which end up merging with each other, and with the XY body); or ‘split XY’ (when the X and Y sex chromosomes are found away from each other in different areas of the cell nucleus). Mouse ID is consistent across Figure 3—source data 1 and 2 and Figure 4—source data 1.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig3-figsupp2-data1-v2.xlsx
Figure 4 with 3 supplements
Similar DMC1 count elevation in Zcwpw1−/− and Prdm9−/− mice, compared to wild-type.
(A) Testis chromosome spreads from 9- to 10-week-old Zcwpw1+/+ and Zcwpw1−/− mice were immunostained for DMC1 and SYCP3. Late (pseudo)-Pachytene cells are shown. These images are representative of …
-
Figure 4—source data 1
Raw data for DMC1, RAD51 and RPA2 foci counts.
Stages: L, Leptotene; Z, Zygotene; P, Pachytene. WT: wild-type. Mouse ID is consistent across Figure 3—source data 1 and 2 and Figure 4—source data 1.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Similar RAD51 count elevation in Zcwpw1−/− and Prdm9−/− mice, compared to wild-type.
(A) Testis chromosome spreads from 9- to 10-week-old Zcwpw1+/+ and Zcwpw1−/− mice were immunostained with antibodies against the synaptonemal complex protein SYCP3 and the recombinase RAD51, and …
Figure 4—figure supplement 2
RPA2 count elevation in the Zcwpw1−/− mouse.
(A) Testis chromosome spreads from 9- to 10-week-old Zcwpw1+/+ and Zcwpw1−/− mice were immunostained with antibodies against SYCP3 and RPA2, and counterstained with DAPI to visualise nuclei. …
Figure 4—figure supplement 3
DSB repair is delayed with accumulation of DMC1 on asynapsed chromosomes in the Zcwpw1−/− mouse.
Testis chromosome spreads from 9- to 10-week-old Zcwpw1+/+ and Zcwpw1−/− mice were immunostained for DMC1, HORMAD2, and SYCP3. Representative images of two mutant pseudo-pachytene cells show …
Figure 5 with 6 supplements
Enrichment and binding profiles of ZCWPW1 and other factors.
(A) Enrichment of ZCWPW1 (with vs without PRDM9) at PRDM9-binding sites when co-transfected with PRDM9 with either Human or Chimp Zinc Finger (Materials and methods section ‘Enrichment Profiles’). Q …
-
Figure 5—source data 1
RT-PCR analysis of PRDM9, ZCWPW1 and ZCWPW2 transcript expression in HEK293T cells.
Cells were transfected with the indicated constructs (one biological replicate per sample). Each PCR reaction was carried out in triplicate (three technical replicates per sample), and the mean Ct value was used to calculate the relative expression of each gene relative to the basal expression in untransfected cells, normalised to endogenous GAPDH levels (ΔΔCt method). Formula: 2^(Ct gene in untransfected cells - Ct gene in transfected cells)/2^(Ct GAPDH in untransfected cells - Ct GAPDH in transfected cells). Expression of ZCWPW2 was only detected in cells transfected with a construct encoding hZCWPW2-HA. Stdev, standard deviation. *For calculation purposes, Cts were assigned the maximum value of 40 cycles of amplification in all samples not transfected with hZCWPW2-HA (no detectable amplification). **Gene expression was normalised to GAPDH and expressed relative to the expression in untransfected cells.
- https://cdn.elifesciences.org/articles/53392/elife-53392-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Correlation between PRDM9 enrichment and ZCWPW1 enrichment at sites of PRDM9 binding.
ZCWPW1 binding with vs without PRDM9 was force called at sites with PRDM9 peaks (Materials and methods). Peaks were excluded if PRDM9 input coverage was ≤10 or ZCWPW1 input coverage was ≤3. …
Figure 5—figure supplement 2
Proportion of ZCWPW1 peaks, ordered by enrichment of ZCWPW1 binding over input, overlapping various other marks.
For example dark green peaks are those which overlap with ZCWPW1 peaks when transfected alone, but not overlapping Human PRDM9 peaks, and not overlapping pre-existing H3K4me3 peaks but do overlap …
Figure 5—figure supplement 3
Enrichment of ZCWPW1 when co-transfected with human or chimp PRDM9 is dependent on the ability of ZCWPW1 to bind, more weakly, in the absence of PRDM9 (there are no peaks with high co-transfected enrichment [y-axis] when the untransfected enrichment [x-axis] is close to 0) and co-transfecting with PRDM9 increases the enrichment.
Enrichment was force called in 100bp windows across all autosomes. Data is conditioned on having input coverage of >5 and enrichment >0.01 for both axes. Hexagons are coloured if at least three data …
Figure 5—figure supplement 4
Co-expression of ZCWPW1 and PRDM9 in HEK293T cells.
Cells were co-transfected with human (h) or chimp (c) PRDM9-YFP-V5 (hPRDM9-YFP-V5 or cPRDM9-YFP-V5, respectively) and ZCWPW1-HA, or mock transfected (untransfected). (A) Direct microscopic …
Figure 5—figure supplement 5
Profiles and heatmaps of reads at locations of either chimp PRDM9 binding or ZCWPW1 binding when co-transfected with human PRDM9.
(A) Profiles and heatmaps of reads at locations of chimp PRDM9 (cPRDM9) binding. Heatmaps show log fold change of sample (as indicated in the title of each column, Materials and methods) vs input, …
Figure 5—figure supplement 6
Among human PRDM9 binding sites, we identified those at which male recombination hotspots occur, defined by the presence/absence of an overlapping human DMC1 peak, and fitted a linear model to predict this hotspot status based on PRDM9 binding strength (PRDM9 Only), ZCWPW1 enrichment (with human PRDM9 vs without, referring to enrichment of ZCWPW1 co-transfected with PRDM9 relative to ZCWPW1 transfected alone), or both (see Materials and methods ‘DMC1 prediction’). We fitted a logistic regression model, and present the results in the form of standard Receiver Operating Characteristic curves (A) and Precision Recall Curves (B).
Lines with greater area under the curve (those higher up) represent greater predictive ability (models better able to classify/separate PRDM9 sites into those with DMC1 binding and those without). …
Figure 6 with 2 supplements
PRDM9-bound regions (H3K4me3 and H3K36me3) are a stronger recruiter of ZCWPW1 than promoters (H3K4me3 only).
For any given level of H3K4me3 (x-axis), ZCWPW1 enrichment (y-axis) is higher at PRDM9-bound regions (red) than regions with pre-existing H3K4me3 (promoters, blue). H3K4me3 and ZCWPW1 were force …
Figure 6—figure supplement 1
ZCWPW1 binding is positively associated with levels of both H3K4me3 and H3K36me3 marks.
Fraction of ZCWPW1 peaks (co-transfected with PRDM9 with input coverage of at least 5) that overlap either (A) H3K4me3 or (B) H3K36me3 peaks, for different bins of ZCWPW1 enrichment (100 equal …
Figure 6—figure supplement 2
Enrichment from 100-bp non-overlapping windows, genome-wide, is binned into 100 equal sample size bins by either.
(A) H3K4me3 or (B) H3K36me3 levels, and mean enrichment of ZCWPW1 co-transfected with PRDM9 is plotted for each bin (error bars show ±2 s.e. of the mean). This is in some sense opposite (but …
Figure 7 with 4 supplements
DMC1 levels in the Zcwpw1−/− mouse compared to DMC1 and SPO11 levels in WT.
(A) DSBs occur at normal hotspot locations in the Zcwpw1−/− male mouse. Average coverage of reads from DMC1 SSDS ChIP-seq in a 10-week-old mouse at previously mapped regions (Materials and methods) …
Figure 7—figure supplement 1
Fraction of wild-type (WT) hotspot locations seen in Zcwpw1−/− DMC1 ChIP-seq at different p-values.
Black bars along the top of the plot show the heat of individual hotspots relative to the hottest, according to the DMC1 data, in the WT male mouse. Y-axis values at x = 0 show the fraction of all …
Figure 7—figure supplement 2
DSBs in Zcwpw1−/− are positioned at WT locations within hotspots.
Hotspots relative to PRDM9 binding motif: upstream (red), downstream (black), central (green). For DMC1 hotspots with an identified PRDM9-binding motif (Materials and methods), we measured positions …
Figure 7—figure supplement 3
Relationship between WT SPO11-oligos (measuring the number of DSBs) vs DMC1 (a measure of the number and persistence of DSBs) at each B6 hotspot for Hop2−/− male mice (A) Zcwpw1−/− (B) and WT (C) as in Figure 7C are replotted, for comparison.
Similarly to Figure 7C, the DMC1 enrichment was force called at the positions of B6 WT hotspots, in the Hop2−/− data from GSM851661 (Khil et al., 2012). SPO11 and DMC1 enrichment have been scaled by …
Figure 7—figure supplement 4
Regression of the ratio of DMC1 signal in the Zcwpw1−/− (KO) vs wild-type (WT) male mice against H3K4me3 [a proxy of PRDM9 binding] (A), SPO11 (B), and DMC1 (C) in WT.
The DMC1 signal in the KO relative to the WT increases as H3K4me3 (~PRDM9) increases. We calculated the ratio of KO to WT DMC1 force-called enrichment at each autosomal B6 mouse hotspot not …
Figure 8 with 1 supplement
ZCWPW1 binds CpG-rich sequences such as Alu repeats.
(A) Fraction of overlap of ZCWPW1 binding peaks, , with Alusin HEK293T cells transfected with ZCWPW1 alone, ordered by enrichment in ZCWPW1 binding. ZCWPW1 peaks are binned into 25 bins with equal …
Figure 8—figure supplement 1
CpG count around ZCWPW1 peaks (+/− 150bp, for those peaks with input coverage >5) is positively associated with ZCWPW1 enrichment score (measuring the level of ZCWPW1 recruitment) in both peaks overlapping Alus and peaks not overlapping Alus, but not at L1M1-3, L1MA or L1P repeats.
Error bars show ±2 s.e. of the mean.
Author response image 1
Author response image 2
Black: Profile of peaks.
Blue: profile of locations 15 to 10kb downstream. Red: profile of globally (whole genome) random locations.
Author response image 3
Author response image 4
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (167 species) | ZCWPW1 | This paper using BlastP and tBLASTn (www.blast.ncbi.nlm.nih.gov), NCBI (www.ncbi.nlm.nih.gov) and Ensembl (www.ens.embl.org) | Details in Materials and methods | Also see Figure 1—source data 1 |
| Gene (225 species) | PRDM9 | Baker et al., 2017 (doi: 10.7554/eLife.24133) | Also see Figure 1—source data 2 | |
| Genetic reagent (Mus musculus) | Zcwpw1-/- | Toronto Centre for Phenogeno-mics (Canada) | RRID:IMSR_CMMR:ADVN; Strain name C57BL/6N-Zcwpw1em1(IMPC)Tcp | Constitutive knock out for Zcwpw1 carrying a 1485bp CRISPR/Cas9-induced deletion (chr5:137799545–13780101029) |
| Genetic reagent (Mus musculus) | Prdm9-/- | RIKEN BioResource Research Center (Japan) | RRID:MGI:3624989; Strain name B6.129P2-Prdm9 < tm1Ymat>, strain number RBRC05145 | Originating article Hayashi et al., 2005. |
| Cell line (Homo sapiens) | Embryonic Epithelial Kidney | ATCC | Cat. CRL-3216 | |
| Transfected construct (Homo sapiens) | hPRDM9-V5-YFP | Altemose et al., 2017 (doi: 10.7554/eLife.28383) | Human PRDM9 B allele cloned into pLENTI CMV/TO Puro DEST vector (Addgene plasmid #17293; Campeau et al., 2009) in frame with a Twin-strep tag, a V5 tag, and a self-cleaving YFP tag due to the presence of an upstream P2A sequence | |
| Transfected construct (Homo sapiens/Pan troglodyte hybrid) | cPRDM9-V5-YFP | Altemose et al., 2017 (doi: 10.7554/eLife.28383) | hPRDM9-V5-YFP construct where Exon 10 encoding the human zinc finger array was replaced with the equivalent sequence from the chimpPRDM9 w11a allele | |
| Transfected construct (Homo sapiens) | hZCWPW1-HA | GenScript | Clone ID OHu16813 | ZCWPW1, transcript variant 1, mRNA (NM_017984.5) cloned into pCDNA3.1+/C-HA |
| Transfected construct (Homo sapiens) | hZCWPW2-HA | GenScript | Clone ID OHu31001C | ZCWPW2, transcript variant 1, mRNA (NM_001040132.3) cloned into pCDNA3.1+/C-HA |
| Transfected construct (M. musculus) | mZCWPW1-FLAG | OriGene | Clone ID MR209594 | Zcwpw1, Transcript variant 2 mRNA (NM_001005426) cloned with a C-terminal Myc-DDK(FLAG) tag |
| Transfected construct (M. musculus) | mZCWPW2-FLAG | This paper | pCMV6-Entry (OriGene, Cat. PS100001) | Generated by cloning custom-synthesised mZCWPW2 into pCMV6-Entry |
| Transfected construct (M. musculus) | mZCWPW1-His | This paper | pET22b(+) Novagen (Sigma-Aldrich, Cat. 69744) | Generated by sub-cloning mZCWPW1 from clone ID MR209594 (OriGene) into pET22b(+) in frame with a C-terminal 6-histidines tag |
| Recombinant DNA reagent | mZCWPW2 | Origene | Mouse Zcwpw2-206; Transcript ID ENSMUST00000238919.1 | Custom synthesis of full-length cDNA sequence |
| Strain, strain background (Escherichia coli) | BL21(DE3) | Thermo Fisher Scientific | Cat. C600003 | Chemically competent cells |
| Peptide, recombinant protein | mZCWPW1-His | This paper | Used to produce a rabbit polyclonal antibody against mouse ZCWPW1 by immunisation (Eurogentec) | |
| Antibody | Anti-mouse ZCWPW1 antiserum, and pre-immune serum (rabbit polyclonal) | This paper | Custom generation (Eurogentec) | IF (1:100), WB (1:1000), IP (5 μl on transfected cells, 10 μl on mouse testis) |
| Antibody | Anti-Human ZCWPW1 (mouse monoclonal) | Sigma-Aldrich | Cat. SAB1409478 | WB (1:2000) |
| Antibody | Anti-SYCP3 (mouse monoclonal) | Santa Cruz Biotechnology | Cat. sc-74569, RRID:AB_2197353 | IF (1:100) |
| Antibody | Anti-SYCP3 (biotinylated, rabbit polyclonal) | Novus | Cat. NB300-232, RRID:AB_2087193 | IF (1:100) |
| Antibody | Anti-DMC1 (rabbit polyclonal) | Santa Cruz Biotechnology | Cat. sc-22768, RRID:AB_2277191, Discontinued | IF (1:100) |
| Antibody | Anti-DMC1 2H12/4 (mouse monoclonal) | Novus | Cat. NB100-2617, RRID:AB_2245859 | ChIP (5 μg) |
| Antibody | Anti-HORMAD2 (rabbit polyclonal) | Santa Cruz Biotechnology | Cat. sc-282192, RRID:AB_2121124 | IF (1:300) |
| Antibody | Anti-RAD51 (mouse monoclonal) | Abcam | Cat. ab88572, RRID:AB_2042762 | IF (1:50) |
| Antibody | Anti-RPA2 (rabbit polyclonal) | Abcam | Cat. ab10359, RRID:AB_297095 | IF (1:1000) |
| Antibody | Anti-phospho-H2AX (mouse monoclonal) | Sigma-Aldrich | Cat 05–636, RRID:AB_309864 | IF (1:250) |
| Antibody | Anti-phospho γ-H2AX (chicken polyclonal) | Biorbyt | Cat. orb195374 Discontinued | IF (1:1000) |
| Antibody | Anti-rabbit IgG Alexa Fluor 488 secondary (goat polyclonal) | Thermo Fisher Scientific | Cat. A-11008, RRID:AB_143165 | IF (1:250) |
| Antibody | Anti-mouse IgG Alexa Fluor 488 secondary (goat polyclonal) | Thermo Fisher Scientific | Cat. A-11001, RRID:AB_2534069 | IF (1:250) |
| Antibody | Anti-rabbit IgG Alexa Fluor 594 secondary (goat polyclonal) | Thermo Fisher Scientific | Cat. A-11012, RRID:AB_141359 | IF (1:250) |
| Antibody | Anti-mouse IgG Alexa Fluor 594 secondary (goat polyclonal) | Thermo Fisher Scientific | Cat. A-11005, RRID:AB_141372 | IF (1:250) |
| Antibody | Anti-mouse IgG Alexa Fluor 647 secondary (goat polyclonal) | Thermo Fisher Scientific | Cat. A-21235, RRID:AB_2535804 | IF (1:250) |
| Antibody | Anti-chicken IgY Alexa Fluor 647 secondary (goat polyclonal) | Thermo Fisher Scientific | Cat. A-21449, RRID:AB_2535866 | IF (1:250) |
| Antibody | Streptavidin, Alexa Fluor 647 | Thermo Fisher Scientific | Cat. S32357 | IF (1:50) |
| Antibody | Anti-poly-His (mouse monoclonal) | Sigma-Aldrich | Cat. H1029, RRID:AB_260015 | WB (1:2000) |
| Antibody | Anti-HA (rabbit polyclonal) | Abcam | Cat. ab9110, RRID:AB_307019 | IF (1:100), WB (1:1000), IP (2 μg), ChIP (5 μg) |
| Antibody | Anti-HA (mouse monoclonal) | Sigma-Aldrich | Cat. H3663, RRID:AB_262051 | IF (1:500) |
| Antibody | Anti-V5 (rabbit polyclonal) | Abcam | Cat. ab9116, RRID:AB_307024 | IF (1:500) |
| Antibody | Anti-FLAG M2 (mouse monoclonal) | Sigma-Aldrich | Cat. F3165, RRID:AB_259529 | IF (1:500), WB (1:2000), IP (3 μg) |
| Antibody | Anti-β-Actin (mouse monoclonal) | Sigma-Aldrich | Cat. A1978, RRID:AB_476692 | WB (1:2000) |
| Antibody | ECL Rabbit IgG, HRP-linked whole Ab (donkey polyclonal) | GE Healthcare | Cat. NA934, RRID:AB_772206 | WB (1:10000) |
| Antibody | ECL Mouse IgG, HRP-linked whole Ab (sheep polyclonal) | GE Healthcare | Cat. NA931, RRID:AB_772210 | WB (1:10000) |
| Sequence-based reagent | pIRESMinor | Chan et al., 2017 | biotin labelled minor satellite probe | |
| Sequence-based reagent | GAPDH_F (Human) | OriGene | PCR primers, transcript detection, NM_002046 | GCTCCTCTGACTTCAACAGCGGCT |
| Sequence-based reagent | GAPDH_R (Human) | OriGene | PCR primers, transcript detection, NM_002046 | ACCACCCTGTTGCTGTAGCCAA |
| Sequence-based reagent | PRDM9_F (Human) | OriGene | PCR primers, transcript detection, NM_020227 | ACGAAGAGGCAGCCAACAATGG |
| Sequence-based reagent | PRDM9_R (Human) | OriGene | PCR primers, transcript detection, NM_020227 | GCCACCAGGTTCTGCTCTTCAT |
| Sequence-based reagent | ZCWPW1_F (Human) | OriGene | PCR primers, transcript detection, NM_017984 | GATGGCTCAAGAGGCAGAACAG |
| Sequence-based reagent | ZCWPW1_R (Human) | OriGene | PCR primers, transcript detection, NM_017984 | TGGGCTGTTCAAACCAGAGAGC |
| Sequence-based reagent | ZCWPW2_F (Human) | OriGene | PCR primers, transcript detection, NM_001040432 | AAGAGCTGGAGCAAATGCTGCAG |
| Sequence-based reagent | ZCWPW2_R (Human) | OriGene | PCR primers, transcript detection, NM_001040432 | CAGGAGCTTCTGGGCTGCATTT |
| Commercial assay or kit | Telomere PNA FISH Kit/Cy3 | Agilent | Cat. K5326 | |
| Commercial assay or kit | Pierce BCA protein assay kit | Thermo Fisher Scientific | Cat. 23227 | |
| Commercial assay or kit | ECL Prime Western Blotting Detection Reagent | GE Healthcare | Cat. 10308449 | |
| Commercial assay or kit | Minelute Reaction Cleanup Kit | QIAGEN | Cat. 28204 | |
| Commercial assay or kit | Qubit dsDNA HS Assay kit | Thermo Fisher Scientific | Cat. Q32851 | |
| Chemical compound, drug | IPTG | Sigma-Aldrich | Cat. I5502 | 0.5 mM final |
| Other | Fast SYBR Green Master Mix | Applied Biosystems | Cat. 4385610 | RNA extraction and RT-qPCR |
| Other | Dynabeads M-280 Sheep anti-Rabbit IgG | Thermo Fisher Scientific | Cat. 11203D, RRID:AB_2783009 | IP and ChIP experiments; IP (25–75 ul), ChIP (65 ul) |
| Other | Dynabeads M-280 Sheep anti-Mouse IgG | Thermo Fisher Scientific | Cat. 11202D, RRID:AB_2783640 | IP and ChIP experiments; IP (25 ul), ChIP (65 ul) |
| Other | TALON Metal Affinity Resin | Takara | Cat. 635502 | Expression and purification of ZCWPW1 recombinant protein; 2 ml per L of IPTG-induced bacterial culture |
| Other | TRI Reagent | Sigma-Aldrich | Cat. T9424 | RNA extraction and RT-qPCR |
| Other | Protease Inhibitor Cocktail | Sigma-Aldrich | Cat. P8340 | IP and WB detection; 1:100 dilution |
| Other | Complete Mini Protease Inhibitor Cocktail | Sigma-Aldrich | Cat. 11697498001 | ChIP; 1 tablet in 10 ml volume |
| Other | Novex WedgeWell 4%to 20%, Tris-Glycine, Protein Gel | Thermo Fisher Scientific | Cat. XP04200BOX | IP and WB detection |
| Other | Novex WedgeWell 8%, Tris-Glycine, Protein Gel | Thermo Fisher Scientific | Cat. XP00080BOX | IP and WB detection |
| Software, Algorithm | MAPeakCaller | Altemose et al., 2017 (doi: 10.7554/eLife.28383) | https://github.com/MyersGroup/PeakCaller/ (archived at https://doi.org/10.5281/zenodo.3783600) | |
| Software, Algorithm | BWA MEM | Li, 2013 (arXiv:1303.3997) | bwa mem (version 0.7.17-r1188) | |
| Software, Algorithm | bwtool | Pohl and Beato, 2014 (doi:10.1093/bioinformatics/btu056) | RRID:SCR_003035; v1.0 | https://github.com/CRG-Barcelona/bwtool |
| Software, Algorithm | Picard | ‘Picard Toolkit.’ 2019. Broad Institute, GitHub Repository. http://broadinstitute.github.io/picard/; Broad Institute | RRID:SCR_006525; version 2.20.4-SNAPSHOT | |
| Software, Algorithm | SAMtools | PMID:19505943 | RRID:SCR_002105; v1.9 | https://www.htslib.org/download/ |
| Software, Algorithm | BEDtools | Quinlan and Hall, 2010 (doi:10.1093/bioinformatics/btq033) | RRID:SCR_006646; v2.28.0 | bedtools.readthedocs.io |
| Software, Algorithm | SEQkit | Shen et al., 2016 (doi:10.1371/journal.pone.0163962) | ||
| Software, Algorithm | IGV | Thorvaldsdóttir et al., 2013 (doi: 10.1093/bib/bbs017) |
