Direct reprogramming of human smooth muscle and vascular endothelial cells reveals defects associated with aging and Hutchinson-Gilford progeria syndrome
- Molecular and Cell Biology Laboratory, The Salk Institute for Biological Studies, United States
- Paul F. Glenn Center for Biology of Aging Research at The Salk Institute, United States
- The Razavi Newman Integrative Genomics and Bioinformatics Core (IGC), The Salk Institute for Biological Studies, United States
Figures
Figure 1 with 2 supplements
Characterization of directly reprogrammed vascular cells.
iSMCs express the identity markers αSMA (A) and calponin (B). iSMCs contribute to the formation of endothelial monolayers (C) and 3D microvascular networks (D). iVECs form 3D vessel-like structures …
-
Figure 1—source code 1
Statistical models used for DE analysis and clustering analysis.
- https://cdn.elifesciences.org/articles/54383/elife-54383-fig1-code1-v1.zip
-
Figure 1—source data 1
DE analysis.
- https://cdn.elifesciences.org/articles/54383/elife-54383-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Clustering analysis.
- https://cdn.elifesciences.org/articles/54383/elife-54383-fig1-data2-v1.xlsx
Figure 1—figure supplement 1
Quantification of the vascular area fraction in 3D matrices embedding a co-culture of VECs and fibroblasts or iSMCs (Student’s t-test with p=0.61).
Figure 1—figure supplement 2
Representative FACS plot showing iVEC sorting based on CD31 expression.
Region P4 refers to CD31 positive cells labeled with AlexaFluor488 secondary antibody.
Figure 2 with 7 supplements
Vascular cells reprogrammed from young vs. old donors show gene expression and functional differences.
Heat-map representing DE genes between reprogrammed vascular cells from young (N = 3) vs. old (N = 3) donors (iSMCs (A), iVECs (B)). Z score = ± 1.5. DE genes with log2FC > 1 and FDR < 0.05. …
Figure 2—figure supplement 1
Heat-maps representing key cell identity genes for both iSM cells and iVECs derived from young and old donors.
Fibroblasts were included as control. Z score = ± 1. All these genes were not DE comparing young and old donors.
Figure 2—figure supplement 2
BMP2 expression by iSMCs reprogrammed from young (19 y.o.) vs. old (67 y.o.) donor.
Representative image showing young (mCherry MYOCD) and old (EGFP MYOCD) iSMCs. Experiments were also performed with the reciprocal tagging. At least N = 25 independent measurements in three …
Figure 2—figure supplement 3
Representative images of GSTM1 expression by endothelial cells within human skin biopsies from young vs.old donors (N = 2 donors per condition, 10 tissue sections per condition; Student’s t-test with p<0.01 (**)).
Scale bars: 100 µm.
Figure 2—figure supplement 4
FPKM values for PALD1and GSTM1 from RNAseq performed on primary mouse endothelial cells from bone marrow, brain and skin of young (3 months) vs. old (18 months) mice.
Biological processes upregulated in old vs. young mouse VECs (pool of bone marrow, brain and skin VECs). It is interesting to observe the upregulation in old mouse VECs of biological processes …
Figure 2—figure supplement 5
Representative images and quantification of Y658 VE-Cadherin (white) in iVECs derived from young and old donors.
The higher amount of Y658 staining in old iVECs (Student’s t-test with p<0.01 (**) from N = 3 biological replicates) suggests that cell-cell junctions might be compromised in reprogrammed cells …
Figure 2—figure supplement 6
Representative images of microfluidic devices seeded with iSMCs reprogrammed from young or old fibroblasts.
VECs stained with VE-cadherin (white) cover the lateral channel and the interface with the 3D matrix embedding iSMCs (red, αSMA). iSMCs from young donors migrate towards the endothelial layer. …
Figure 2—figure supplement 7
Validation of KD of PALD1 and BMP2 in VECs and SMCs, respectively (N = 2 biological replicates).
Note that BMP2 KD was validated using qPCR due to technical problems with any of the tested anti-BMP2 antibodies (Western Blot). The use of these antibodies resulted in multiple aspecific bands.
Figure 3 with 1 supplement
iSMCs reprogrammed from HGPS fibroblasts show signatures of vascular dysfunction.
Heat-map representing DE genes between iSMCs reprogrammed from healthy (N = 3) vs. HGPS (N = 8) donors. Z score = ± 2. DE genes with log2FC > 1 and FDR < 0.05 (A). ELISA measurement of BMP4 in the …
Figure 3—figure supplement 1
Biological processes upregulated in primary, healthy VECs when 3D co-cultured with HGPS vs. healthy fibroblasts for 25 days.
These supplementary data refer to N = 1 biological replicate.
Author response image 1
Quantification of the vascular area fraction in 3D matrices embedding a co-culture of VECs with fibroblasts or iSMCs (Student’s t-test with p=0.61).
Videos
Video 1
Representative movie showing a 3D reconstruction of in vitro co-cultured iVECs (white) and iSMCs (red) in a fibrin matrix.
Video 2
Representative movie showing a 3D reconstruction of human skin biopsy from a young (21 y.o.) donor stained for BMP2.
From the left: panel one is BMP2, panel two is αSMA, panel three is DAPI and panel four is merge.
Video 3
Representative movie showing a 3D reconstruction of human skin biopsy from an old (72 y.o.) donor stained for BMP2.
From the left: panel one is BMP2, panel two is αSMA, panel three is DAPI and panel four is merge.
Video 4
Representative movie showing a 3D reconstruction of human skin biopsy from a young (21 y.o.) donor stained for Paladin 1.
From the left: panel one is Paladin, panel two is CD31, panel three is DAPI and panel four is merge.
Video 5
Representative movie showing a 3D reconstruction of human skin biopsy from an old (72 y.o.) donor stained for Paladin 1.
From the left: panel one is Paladin, panel two is CD31, panel three is DAPI and panel four is merge.
Video 6
Representative movie showing 70 kDa dextran diffusion through the endothelial barrier in presence of iSMCs reprogrammed from HGPS donors.
Video 7
Representative movie showing 70 kDa dextran diffusion through the endothelial barrier in presence of iSMCs reprogrammed from HGPS donors and treated with BMP4 blocking antibody.
Video 8
Representative movie showing 70 kDa dextran diffusion through the endothelial barrier in presence of iSMCs reprogrammed from HGPS donors and treated with Jagged 1 blocking antibody.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo-Sapiens) | Dermal fibroblasts (normal) | Coriell | Details in Supplementary file 1 | https://www.coriell.org/0/Sections/Support/Global/QCcells.aspx?PgId=409 |
| Cell line (Homo-Sapiens) | Dermal fibroblasts (normal and HGPS) | Progeria Research Foundation | Details inSupplementary file 1 | https://www.progeriaresearch.org/wp-content/uploads/2020/04/PRF-AVAILABLE-CELL-LINES.pdf |
| Cell line (Homo-Sapiens) | Microvascular endothelial cells (normal) | Angioproteomie | Details in Supplementary file 1 | https://www.angioproteomie.com/commerce/ccp1073-human-dermal-microvascular-endothelial-cells-cap-0005.htm |
| Cell line (M. musculus) | Microvascular endothelial cells (normal) | Cell Biologics | Details in Supplementary file 1 | https://cellbiologics.com/index.php?route=product/product&path=2_47_89_91&product_id=2240 |
| Transfected construct (human) | pQCXIB EGFP-MYOCD | This paper | Retroviral construct for stable expression | |
| Transfected construct (human) | pQCXIB ETV2 | This paper | Retroviral construct for stable expression | |
| Transfected construct (human) | On Target Plus Human PALD1 siRNA (Smart Pool) | Horizon | L-026434-00-0005 | |
| Transfected construct (human) | On Target Plus Human BMP2 siRNA (Smart Pool) | Horizon | L-011219-00-0005 | |
| Biological sample (Homo-sapiens) | Human skin samples | This paper | Isolated from human donors by the Cooperative Human Tissue Network or by the Clinical and Translational Research Institute of UCSD | |
| Antibody | Anti-human CD31 (Mouse monoclonal) | ThermoFisher | Cat# MA3100 RRID:AB_223516 | IF(1:100) |
| Antibody | Anti-human collagen type I (Mouse monoclonal) | ThermoFisher | Cat# MA126771 RRID:AB_2081889 | IF(1:250) |
| Antibody | Anti-human VE-cadherin (Rabbit monoclonal) | Cell Signaling | Cat#2500S RRID:AB_10839118 | IF(1:100) |
| Antibody | Anti-human Y658 VE-cadherin (Rabbit polyclonal) | ThermoFisher | Cat#441144G RRID:AB_2533583 | IF(1:100) |
| Antibody | Anti-human alpha smooth muscle actin (Mouse monoclonal) | eBioscience | Cat#14-9760-82 RRID:AB_2572996 | IF(1:2,500) |
| Antibody | Anti-human calponin (Mouse monoclonal) | Santa Cruz | Cat#sc-58707 RRID:AB_781770 | IF(1:100) |
| Antibody | Anti-human BMP2 (Rabbit polyclonal) | Novus | Cat#nBP1-19751 RRID:AB_2227877 | IF(1:100) |
| Antibody | Anti-human Paladin (Rabbit polyclonal) | ThermoFisher | Cat#PA5-53591 RRID:AB_2645183 | IF(1:100) |
| Antibody | Anti-human GSTM1 (Mouse Monoclonal) | ThermoFisher | Cat#MA5-17085 RRID:AB_2538556 | IF(1:100) |
| Antibody | Anti-human BMP4 (Mouse Monoclonal) | R and D Systems | Cat#MAB3552 RRID:AB_2065677 | Blocking (2 ug/ml) |
| Antibody | Anti-human Jagged 1 (Goat polyclonal) | R and D Systems | Cat#AF1277 RRID:AB_354713 | Blocking (1 ug/ml) |
| Sequence-based reagent | CD31 forward | This paper | PCR primers | TGGTCAAGAAAAGCAACACAG |
| Sequence-based reagent | CD31 reverse | This paper | PCR primers | GATTCGCAACGGACTTCG |
| Sequence-based reagent | CD31 forward | This paper | PCR primers | ACAACGAGGGCATCATCAAG |
| Sequence-based reagent | CD31 reverse | This paper | PCR primers | GAAGTGGTAGAAAGGCTGCTG |
| Sequence-based reagent | BMP2 forward | This paper | PCR primers | CATGCTAGACCTGTATCGCA |
| Sequence-based reagent | BMP2 reverse | This paper | PCR primers | TGTTTTCCCACTCGTTTCTGG |
| Sequence-based reagent | BMP2 forward | This paper | PCR primers | GCCCTTCGAGCACCACGCA |
| Sequence-based reagent | BMP2 reverse | This paper | PCR primers | TGGCTTGTAGTGCCGCTGCTG |
| Commercial assay or kit | BMP4 ELISA Kit | Sigma-Aldrich | RAB0029 | |
| Software, algorithm | Fiji | https://fiji.sc/ |
Additional files
-
Supplementary file 1
The table collects relevant information on the source of fibroblasts, SMCs and endothelial cells employed in the study.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp1-v1.docx
-
Supplementary file 2
Details on DE genes between young vs old iVECs, young vs old iSMCs, normal vs HGPS iSMCs.
Details on clustering analyses comparing iVECs, primary VECs and fibroblasts as well as iSMCs, primary SMCs and fibroblasts.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp2-v1.docx
-
Supplementary file 3
Details on clustering analyses comparing induced vs primary cells.
This dataset refers to data presented in Figure 1G and I.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp3-v1.docx
-
Supplementary file 4
Code used for data analyses.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp4-v1.docx
-
Supplementary file 5
Cell identity gene analysis in reprogrammed cells.
The table collects relevant information on key cell identity genes expressed by reprogrammed and primary cells.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp5-v1.docx
-
Supplementary file 6
Cell identity gene analysis in young vs old reprogrammed cells.
The table collects relevant information on key cell identity genes expressed by reprogrammed cells derived from young and old donors.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp6-v1.docx
-
Supplementary file 7
The table collects relevant information on the source of human serum employed in the study.
- https://cdn.elifesciences.org/articles/54383/elife-54383-supp7-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/54383/elife-54383-transrepform-v1.docx
