Figures and data in Enhanced ER-associated degradation of HMG CoA reductase causes embryonic lethality associated with Ubiad1 deficiency

Figures
Tables
Additional files

5 figures, 2 tables and 1 additional file

Figures

Figure 1

Download asset Open asset

Vitamin K and the mevalonate pathway.

(A) Structures of the main forms of vitamin K. (B) The mevalonate pathway in animal cells.

Figure 2

Download asset Open asset

CRISPR/Cas9-mediated disruption of the mouse *Ubiad1* gene.

(A) Amino acid sequence and predicted topology of mouse UBIAD1 protein. (B) Genomic structure of mouse *Ubiad1* and predicted proteins encoded by CRISPR/Cas9-disrupted *Ubiad1* alleles (Disrupted Alleles A and B).

Figure 3 with 1 supplement

Download asset Open asset

Hepatic immunoblot analysis and body weights of *Ubiad1*-deficient mice on *Hmgcr^WT/WT* and *Hmgcr^Ki/Ki* backgrounds.

(**A and B**) Male and female WT and *Ubiad1^+/-* (A) or *Ubiad1^+/+: :Hmgcr^Ki/Ki*, *Ubiad1^+/-: :Hmgcr^Ki/Ki*, and *Ubiad1^-/-: :Hmgcr^Ki/Ki* (B) littermates (8 weeks of age, five mice/group) were fed an ad libitum chow diet prior to weighing and sacrifice. Livers were harvested and subjected to subcellular fractionation as described in ‘Materials and methods.’ Aliquots of resulting membrane (Memb.) and nuclear extract (N.E.) fractions (80–160 µg protein/lane) for each group were pooled and subjected to SDS-PAGE, followed by immunoblot analysis using antibodies against endogenous HMGCR, UBIAD1, SREBP-1, SREBP-2, calnexin, and LSD-1. Although shown in separate panels, LSD-1 is a loading control for nuclear SREBP immunoblots. (C) Male and female *Ubiad1^+/+: :Hmgcr^Ki/Ki*, *Ubiad1^+/-: :Hmgcr^Ki/Ki*, and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates (eight mice/group) were weaned at 4 weeks of age, fed chow diet ad libitum, and weighed for seven consecutive weeks, after which they were sacrificed. *Error bars*, S.E. *, p<0.05 and ****, p<0.0001.

Figure 3—source data 1 Body weights of Ubiad1^-/-: : Hmgcr^Ki/Ki mice.: https://cdn.elifesciences.org/articles/54841/elife-54841-fig3-data1-v2.xlsx
Download elife-54841-fig3-data1-v2.xlsx

Figure 3—figure supplement 1

Download asset Open asset

Characterization of *Ubiad1*-deficient mice.

(A) Male and female *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates (Disrupted Allele B) (8 weeks of age, eight mice/group) were fed an ad libitum chow diet prior to weighing and sacrifice. Livers of the mice were harvested and subjected to subcellular fractionation and immunoblot analysis as described in the legend to Figure 3A and B). (**B and C**) *Ubiad1^+/+: :Hmgcr^Ki/Ki*, *Ubiad1^+/-: :Hmgcr^Ki/Ki*, and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates (Disrupted Allele A) were fed an ad libitum chow diet prior to weighing and sacrifice. Livers of the mice were harvested for measurement of cholesterol and triglyceride levels (B) and quantitative real-time PCR analysis using primers against the indicated mRNA and apoB mRNA as an invariant control (C). Each value represents the amount of mRNA relative to that in *Ubiad1^+/+: :Hmgcr^Ki/Ki* mice, which was arbitrarily set as 1. Each *bar* represents the mean ± S.E. of data from eight mice. **, p<0.01; ***, p<0.001.

Figure 3—figure supplement 1—source data 1 Body weights and hepatic lipid levels of Ubiad1^-/-: : Hmgcr^Ki/Ki mice.: https://cdn.elifesciences.org/articles/54841/elife-54841-fig3-figsupp1-data1-v2.xlsx
Download elife-54841-fig3-figsupp1-data1-v2.xlsx

Figure 4 with 1 supplement

Download asset Open asset

Levels of HMGCR, UBIAD1, and MK-4 in various tissues and blood chemistry analysis of *Ubiad1*-deficient mice.

Male *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates (12 weeks of age, 4–11 mice/group) were fed an ad libitum chow diet prior to sacrifice. (**A and B**) Indicated tissues were harvested for subcellular fractionation, after which aliquots of membrane fractions were subjected to immunoblot analysis using antibodies against HMGCR, UBIAD1, and calnexin (A). Some of the tissues were subjected to homogenization (B) for subsequent determination of MK-4 levels by reverse-phase high performance liquid chromatography or liquid chromatography-mass spectrometry as described in ‘Materials and methods.’ (**C and D**) Blood drawn from mice following sacrifice was subjected to chemical analysis by the Metabolic Phenotyping Core Facility in the Touchstone Diabetes Center (UT Southwestern Medical Center). *Bars*, mean ± S.E. of data from 4 to 11 mice. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

Figure 4—source data 1 Blood chemistry analysis of male Ubiad1^-/-: : Hmgcr^Ki/Ki mice.: https://cdn.elifesciences.org/articles/54841/elife-54841-fig4-data1-v2.xlsx
Download elife-54841-fig4-data1-v2.xlsx

Figure 4—figure supplement 1

Download asset Open asset

Blood chemistry analysis of female *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* mice.

Female *Ubiad1^+/+::Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates (12 weeks of age, 4–12 mice/group) were fed an ad libitum chow diet prior to sacrifice. Blood drawn from the mice following sacrifice was subjected to chemical analysis by the Metabolic Phenotyping Core Facility in the Touchstone Diabetes Center (University of Texas Southwestern Medical Center). *Bars*, mean ± S.E. (error bars) of data from 4 to 12 mice. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

Figure 4—figure supplement 1—source data 1 Blood chemistry analysis of female Ubiad1^-/-: : Hmgcr^Ki/Ki mice.: https://cdn.elifesciences.org/articles/54841/elife-54841-fig4-figsupp1-data1-v2.xlsx
Download elife-54841-fig4-figsupp1-data1-v2.xlsx

Figure 5 with 2 supplements

Download asset Open asset

Histological analysis of skeletal muscle and femoral growth plates from *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* mice.

Histological analysis of gastrocnemius and quadriceps muscles (A) and femoral growth plates (B) from male *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates using H and E and Safranin O staining. Myofibers harboring centrally-localized nuclei are indicated by white arrows, and degenerating myofibers with macrophage infiltration are indicted by black arrowheads in (A). Asterisks in (B) indicate boney trabeculae, and red hue in Safranin O-stained sections highlight cartilage. gp, growth plate. Scale bars, 100 µm.

Figure 5—figure supplement 1

Download asset Open asset

Histological analysis of gastrocnemius and quadriceps muscles from female *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates using H and E staining.

Myofibers harboring centrally-localized nuclei are indicated by white arrows and infiltrating macrophages are indicted by black arrowheads. Scale bars = 100 µm.

Figure 5—figure supplement 2

Download asset Open asset

Histological analysis of femoral growth plates from female *Ubiad1^+/+: :Hmgcr^Ki/Ki* and *Ubiad1^-/-: :Hmgcr^Ki/Ki* littermates using H and E and Safranin O staining.

Asterisks denote boney trabeculae, and the red hue in the Safranin O-stained sections highlight cartilage. gp, growth plate. Scale bars = 100 µm.

Tables

Table 1

Segregation of Disrupted Ubiad1 Alleles in Mice.

Genotype of breeding pairs	Ubiad1 genotype of offspring
Genotype of breeding pairs	+/+	+/-	-/-
Disrupted Allele A Ubiad1^+/-X Ubiad1^+/-	83	201	0
Ubiad1^+/-: :HmgcrKi^Ki/Ki X Ubiad1^+/-: :HmgcrKi^Ki/Ki	137	280	114
Disrupted allele B Ubiad1^+/-X Ubiad1^+/-	77	183	0
Ubiad1^+/-: :HmgcrKi^Ki/Ki X Ubiad1^+/-: :HmgcrKi^Ki/Ki	23	36	20

Genotype was determined by PCR analysis of genomic DNA prepared from tails of mice.

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Genetic reagent (M. musculus)	Mouse/Wild Type:C57BL/6J	The Jackson Laboratory	Stock#000664
Genetic reagent (M. musculus)	Mouse/Hmgcr^Ki/Ki (HMGCR K89R/K248R):C57BL/6	PMID: 27129778	N/A	Knockin mice harboring mutations in the Hmgcr gene that prevent ubiquitination of HMGCR protein
Genetic reagent (M. musculus)	Mouse/Ubiad1^+/∆172:C57BL/6J	This paper	N/A	Mice heterozygous for 172 bp deletion in exon 1 of the Ubiad1 gene
Genetic reagent (M. musculus)	Mouse/Ubiad1^{∆172/∆172}: : Hmgcr^Ki/Ki (HMGCR K89R/K248R):C57BL/6J	This paper	N/A	Hmgcr^Ki/Ki mice homozygous for 172 bp deletion in exon 1 of the Ubiad1 gene
Genetic reagent (M. musculus)	Mouse/Ubiad1^∆29/∆29: : Hmgcr^Ki/Ki (HMGCR K89R/K248R):C57BL/6J	This paper	N/A	Hmgcr^Ki/Ki mice homozygous for 29 bp deletion in exon 1 of the Ubiad1 gene
Antibody	Rabbit monoclonal anti-SREBP-1	PMID: 28244871	IgG-20B12	used at 1–5 µg/ml for immunoblots
Antibody	Rabbit monoclonal anti-SREBP-2	PMID: 25896350	IgG-22D5	used at 1–5 µg/ml for immunoblots
Antibody	Rabbit polyclonal anti-UBIAD1	PMID: 30785396	IgG-205	used at 1–5 µg/ml for immunoblots
Antibody	Rabbit polyclonal anti- HMGCR	PMID: 27129778	IgG-839c	used at 1–5 µg/ml for immunoblots
Antibody	Rabbit polyclonal anti-Calnexin	Novus Biologicals	Cat#NB100-1965; RRID: AB_10002123	used at 1–5 µg/ml for immunoblots
Antibody	Rabbit polyclonal anti-LSD-1	Cell Signaling Technology	Cat#2139; RRID: AB_2070135	used at 1–5 µg/ml for immunoblots
Sequence-based reagent	Ubiad1 genotyping primers	Genotyping of mice is described in Materials and methods.	N/A	Forward: TCCCCTTGAGTGGCTCACTTTTA; Reverse: AAATCGAACAACATCCTGGGGCT
Sequence-based reagent	Hmgcr^Ki/Ki genotyping primers	PMID: 27129778	N/A	K89R Forward: GTCCATGAACATGTTCACCG; Reverse: CAGCACGTCCTATTGGCAGA K248R Forward: TCGGTGATGTTCCAGTCTTC; Reverse, GGTGGCAAACACCTTGTATC
Sequence-based reagent	Guide RNAs (gRNAs) used to target mouse Ubiad1	Targeting of mouse Ubiad1 gene is described in Materials and methods	N/A	gRNA-A: GGCTTCCCGAACGATCCTGG gRNA-B: CAAGTGCGCCTCCTACGTGT gRNA-C: TGTACACGGGGCCGGCAATT
Sequence-based reagent	qRT-PCR Primers for UBIAD1	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for SREBP1a	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for SREBP-1c	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for SREBP-2	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for HMGCR	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for Insig-1	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for Insig-2a	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for Insig-2b	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for SCAP	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for HMGCS	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for FPPS	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for LDLR	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for PCSK9	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for ACS	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for ACC1	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for FAS	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for SCD1	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for GPAT	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for LXRα	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for ABCG5	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for ABCG8	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for GGPS	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Sequence-based reagent	qRT-PCR Primers for Cyclophilin	PMID: 30785396	N/A	The sequence of these primers can be found in indicated reference
Commercial assay or kit	TaqMan Reverse Transcription	Applied Biosystems	Cat#N8080234
Commercial assay or kit	Power SYBR Green PCR Master Mix	Applied Biosystems	Cat#4367659
Commercial assay or kit	DNeasy Blood and Tissue Kit	Qiagen	Cat#69506
Commercial assay or kit	MEGAshortscript Kit	Ambion	Cat#AM1354
Commercial assay or kit	Surveyor Mutation Detection Kit	Integrated DNA Technologies	Cat#706020
Commercial assay or kit	FuGENE6 Transfection Reagent	Promega	Cat#1815075
Chemical compound, drug	Menaquinone-4	Sigma-Aldrich	Cat#809896
Chemical compound, drug	Phylloquinone (Vitamin K1)	Cerilliant	Cat#V-030

Additional files

Transparent reporting form: https://cdn.elifesciences.org/articles/54841/elife-54841-transrepform-v2.pdf
Download elife-54841-transrepform-v2.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Youngah Jo
Steven S Kim
Kristina Garland
Iris Fuentes
Lisa M DiCarlo
Jessie L Ellis
Xueyan Fu
Sarah L Booth
Bret M Evers
Russell A DeBose-Boyd

(2020)

Enhanced ER-associated degradation of HMG CoA reductase causes embryonic lethality associated with Ubiad1 deficiency

eLife 9:e54841.

https://doi.org/10.7554/eLife.54841

Figures

Vitamin K and the mevalonate pathway.

CRISPR/Cas9-mediated disruption of the mouse Ubiad1 gene.

Hepatic immunoblot analysis and body weights of Ubiad1-deficient mice on Hmgcr^WT/WT and Hmgcr^Ki/Ki backgrounds.

Figure 3—source data 1

Characterization of Ubiad1-deficient mice.

Figure 3—figure supplement 1—source data 1

Levels of HMGCR, UBIAD1, and MK-4 in various tissues and blood chemistry analysis of Ubiad1-deficient mice.

Figure 4—source data 1

Blood chemistry analysis of female Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki mice.

Figure 4—figure supplement 1—source data 1

Histological analysis of skeletal muscle and femoral growth plates from Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki mice.

Histological analysis of gastrocnemius and quadriceps muscles from female Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki littermates using H and E staining.

Histological analysis of femoral growth plates from female Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki littermates using H and E and Safranin O staining.

Tables

Segregation of Disrupted Ubiad1 Alleles in Mice.

Additional files

Transparent reporting form

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

Vitamin K and the mevalonate pathway.

CRISPR/Cas9-mediated disruption of the mouse Ubiad1 gene.

Hepatic immunoblot analysis and body weights of Ubiad1-deficient mice on HmgcrWT/WT and HmgcrKi/Ki backgrounds.

Figure 3—source data 1

Characterization of Ubiad1-deficient mice.

Figure 3—figure supplement 1—source data 1

Levels of HMGCR, UBIAD1, and MK-4 in various tissues and blood chemistry analysis of Ubiad1-deficient mice.

Figure 4—source data 1

Blood chemistry analysis of female Ubiad1+/+: :HmgcrKi/Ki and Ubiad1-/-: :HmgcrKi/Ki mice.

Figure 4—figure supplement 1—source data 1

Histological analysis of skeletal muscle and femoral growth plates from Ubiad1+/+: :HmgcrKi/Ki and Ubiad1-/-: :HmgcrKi/Ki mice.

Histological analysis of gastrocnemius and quadriceps muscles from female Ubiad1+/+: :HmgcrKi/Ki and Ubiad1-/-: :HmgcrKi/Ki littermates using H and E staining.

Histological analysis of femoral growth plates from female Ubiad1+/+: :HmgcrKi/Ki and Ubiad1-/-: :HmgcrKi/Ki littermates using H and E and Safranin O staining.

Segregation of Disrupted Ubiad1 Alleles in Mice.

Transparent reporting form

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Hepatic immunoblot analysis and body weights of Ubiad1-deficient mice on Hmgcr^WT/WT and Hmgcr^Ki/Ki backgrounds.

Blood chemistry analysis of female Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki mice.

Histological analysis of skeletal muscle and femoral growth plates from Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki mice.

Histological analysis of gastrocnemius and quadriceps muscles from female Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki littermates using H and E staining.

Histological analysis of femoral growth plates from female Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki littermates using H and E and Safranin O staining.