1. Chromosomes and Gene Expression
Download icon

A non-canonical role for the EDC4 decapping factor in regulating MARF1-mediated mRNA decay

  1. William R Brothers
  2. Steven Hebert
  3. Claudia L Kleinman
  4. Marc R Fabian  Is a corresponding author
  1. Lady Davis Institute for Medical Research, Jewish General Hospital, Canada
  2. Department of Human Genetics, McGill University, Canada
  3. Department of Biochemistry, McGill University, Canada
  4. Department of Oncology, McGill University, Canada
Research Article
Cite this article as: eLife 2020;9:e54995 doi: 10.7554/eLife.54995
7 figures, 1 table, 1 data set and 3 additional files

Figures

Figure 1 with 1 supplement
Identification of human MARF1 target mRNAs.

(A) Schematic diagram of full-length MARF1. (B) Distribution of crosslinked sequence reads. (C) Venn diagram illustrating the relationship of MARF1 target mRNAs identified by iCLIP in HEK293 cells with transcripts that were upregulated in Marf1-/- and Marf1D272A/D272A and germinal vesicle-stage mouse oocytes as compared to wild-type. (D) A partial list of mRNAs identified by iCLIP that were upregulated in both Marf1-/- and Marf1D272A/D272A and germinal vesicle-stage mouse oocytes as compared to wild-type.

Figure 1—figure supplement 1
Representative FLAG-MARF1ΔNYN iCLIP coverage at the loci of ATXN7L3, IGFP2BP1, MAML1, FAF2 and PGAM2 loci shows specificity for the 3′UTR.

The negative control iCLIP from HEK293 cells not expressing FLAG-MARF1ΔNYN shows negligible background.

MARF1 represses target mRNAs via their 3’UTRs.

(A) Schematic diagram of the basic Renilla luciferase (RL)-encoding mRNA reporter, containing five 19-nt BoxB hairpins, interacting with λN-HA-MARF1, as well as a RL reporter with a 3’UTR from endogenous mRNAs. (B) Schematic diagram of full-length MARF1 and MARF1 fragments used in tethering assays. (C) Western blot analysis of HEK293 cells expressing indicated proteins. (D) RL activity detected in extracts from HEK293 cells expressing the indicated proteins. Cells were cotransfected with constructs expressing the RL-5BoxB reporter, FL, and indicated fusion proteins. Histograms represented normalized mean values of RL activity from a minimum of three experiments. RL activity values seen in the presence of λNHA-LacZ were set as 100. (E) RL-MAML1 (left panel) and RL-NOTCH2 (right panel) mRNA levels detected in extracts from HEK293 cells expressing the indicated proteins. Histograms represented mean values of RL-MAML1 or RL-NOTCH2 mRNAs normalized to FL mRNA from a minimum of three experiments. mRNA levels values seen in the presence of λNHA-LacZ were set as 100. (F) The stability of RL-MAML1 was assessed by using actinomycin D (5 μg/ml) for the indicated amount of time. Total RNA was isolated, reverse transcribed and RL-MAML1 RNA was quantified by qPCR. RL-MAML1 mRNA decay rates were normalized to FL mRNA levels with the zero time point set at 100. (G) Endogenous MAML1 and NOTCH2 mRNA levels detected in extracts from HEK293 cells expressing the indicated proteins. mRNA levels were normalized to GAPDH mRNA levels for a minimum of three experiments. mRNA levels in the presence of λNHA-LacZ were set as 100. Error bars represent the SEM of multiple independent experiments.

Figure 3 with 1 supplement
Central MARF1 LOTUS domains are required to silence mRNAs containing 3’UTRs of MARF1 target mRNAs.

(A) Schematic diagram of wild-type MARF1 protein, as well C-terminal deletion mutants. Core LOTUS domains required for MARF1-mediated repression are bordered in red. (B–D) RL activity detected in extracts from HEK293 cells expressing the indicated proteins. Cells were cotransfected with constructs expressing the RL-MAML1 reporter or RL-5BoxB reporter, along with FL, and indicated fusion proteins. Histograms represented normalized mean values of RL activity from a minimum of three experiments. RL activity values seen in the presence of λNHA-MARF1ΔNYN were set as 100.

Figure 3—source data 1

Comparative sequence analysis of MARF1 LOTUS domains.

(A) Sequence alignment of conserved amino acids within the MARF1 LOTUS domains 1 through 6 of human (Hs), Drosophila melanogaster (Dm), Xenopus tropicalis (Xt) and Danio rerio (Dr). LOTUS domain amino acids are in bold font. (B) Sequence alignment of human LOTUS domains 3 and 5. Identical amino acids are denoted with an asterisk and conservative amino acids substitutions are denoted with a colon.

https://cdn.elifesciences.org/articles/54995/elife-54995-fig3-data1-v1.pdf
Figure 3—figure supplement 1
Western blot analysis of HEK293 cells expressing λNHA-MARF1 mutants lacking the indicated LOTUS domains.
Figure 4 with 1 supplement
MARF1 RRM1 is required to silence target mRNAs.

(A) Schematic diagram of wild-type MARF1 protein, as well as RRM mutants. (B and E) Western blot analysis HEK293 cells transfected with plasmids expressing full-length (B) or N-terminal fragments (E). (C, D and F) RL activity detected in extracts from HEK293 cells expressing the indicated proteins. Cells were cotransfected with constructs expressing the RL-MAML1 reporter (C) or the RL-5BoxB reporter (D and F), FL, and indicated fusion proteins. Histograms represented normalized mean values of RL activity from a minimum of three experiments. RL activity values seen in the presence of λNHA-MARF1ΔNYN were set as 100. (E).

Figure 4—figure supplement 1
MARF1 RRM1 is required to silence mRNAs containing 3’UTRs of MARF1 target mRNAs.

(A) RL activity detected in extracts from HEK293 cells expressing the indicated proteins. Cells were cotransfected with constructs expressing the RL reporter mRNAs containing the 3’UTRs of MARF1 target mRNAs along with FL, and indicated fusion proteins. Histograms represented normalized mean values of RL activity from a minimum of three experiments. RL activity values seen in the presence of λNHA-MARF1ΔNYN were set as 100. (B) Structural model of MARF1 RRM1. The model was generated using the Phyre2 structure prediction server (Kelley et al., 2015) and is shown in ribbon format. Conserved surface residues on the putative RNA binding surface are shown in stick format. These residues were substituted with alanines in the RRM1mut protein.

Figure 5 with 1 supplement
EDC4 impairs MARF1 silencing of endogenous target mRNAs.

(A) Western blot analysis HEK293 cells transfected with different amounts [low (0.1 μg), medium (1.0 μg) and high (3.0 μg)] of wild-type λNHA-MARF1 and λNHA-MARF1ΔC-term plasmids. HA Western blot signals are quantified relative to actin and marked below each lane, with ‘medium’ HA signal set to 100%. (B and C) RL activity detected in extracts from HEK293 cells. Cells were cotransfected with constructs expressing the RL-MAML1 reporter (B) or RL-5BoxB reporter (C), along with FL and different amounts (low, medium and high) of wild-type λNHA-MARF1 and λNHA-MARF1ΔC-term plasmids. (D) Western blot analysis HEK293 cells depleted of EDC4 or DCP2 by siRNA-mediated knockdown. siGFP represents a negative control. (E) siRNA-treated cells were subsequently cotransfected with constructs expressing the RL-MAML1 reporter, FL, and low levels of λNHA-MARF1 or λNHA-MARF1ΔC-term plasmids, and RL activity detected in extracts. (F through J) RL activity and mRNA levels detected in extracts from HEK293 cells normalized to FL activity and mRNA levels. Cells were cotransfected with constructs expressing the RL-MAML1 reporter (F and I), RL-NOTCH2 reporter (G and J) or RL-5BoxB reporter (H), along with FL, V5-tagged EDC4 and high amounts of wild-type λNHA-MARF1 and λNHA-MARF1ΔC-term plasmids. All Histograms represented normalized mean values of RL activity (F through H) or mRNA levels (G and I) from a minimum of three experiments. RL activity values seen in the presence of λNHA-MARF1ΔNYN and mRNA levels seen in the presence of λNHA-LacZ were set as 100.

Figure 5—figure supplement 1
MARF1 C-terminus is sufficient to localize with EDC4 in P-bodies.

Western blot analysis of endogenous EDC4 expression versus ectopic overexpression of V5-tagged EDC4.

Figure 6 with 1 supplement
EDC4-MARF1 interaction localizes MARF1 to P-bodies and impairs MARF1 silencing.

(A) Schematic model of MARF1 C-terminus competition assay. MARF1 contains a C-terminal motif (red) that interacts with the mRNA decapping machinery, including EDC4, DCP1, DCP2 and XRN1. Co-transfecting a plasmid encoding the MARF1 C-terminal motif may compete with full-length MARF1 in binding to the decapping machinery. (B) Confocal fluorescence micrographs of fixed HeLa cells expressing wild-type λNHA-MARF1 (with or without FLAG-tagged MARF1C-term) and λNHA-MARF1ΔC-term, along with EDC4. Cells were stained with anti‐HA (red) and anti‐EDC4 (green) antibodies. The merged images show the HA signal in red and the EDC4 signal in green. (C) RL activity detected in extracts from HEK293 cells expressing the indicated proteins. Cells were co-transfected with constructs expressing the RL-MAML1 reporter, FL, low amounts of indicated λNHA-MARF1 constructs, along with/without a plasmid coding for MARF1 C-terminal motif. Histograms represented normalized mean values of RL activity from a minimum of three experiments. RL activity values seen in the presence of λNHA-MARF1ΔNYN were set as 100. (D) RNA immunoprecipitation of RL-MAML1 reporter by FLAG-tagged MARF1ΔNYN in HEK293 cells plus/minus EDC4 overexpression.

Figure 6—figure supplement 1
MARF1 C-terminus interfaces with the mRNA decapping machinery and localizes to P-bodies.

(A) MARF1 C-terminus interfaces with the mRNA decapping machinery and localizes to P-bodies. Schematic diagram of FLAG-tagged MARF1Cterminteracting with the mRNA decapping machinery, including EDC4, DCP1, DCP2 and XRN1 . (B) Confocal fluorescence micrographs of fixed HeLa cells expressing FLAG-tagged MARF1C-term and EDC4. Cells were stained with anti‐FLAG (red) and anti‐EDC4 (green) antibodies. The merged image shows the FLAG signal in red and the EDC4 signal in green.

Model for MARF1-mediated mRNA decay.

MARF1 recognizes target mRNAs via LOTUS domains 3 through 5. Subsequently, RRM1 enhances NYN-mediated cleavage of target mRNAs, potentially by assisting in positioning the NYN domain on target. EDC4 regulates MARF1-mediated repression by interacting with the MARF1 C-terminus, segregating MARF1 to P-bodies and preventing MARF1 from binding target mRNAs, potentially by interfering with LOTUS domain-RNA interactions.

Tables

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Gene (Homo sapiens)MARF1HGNC:HGNC:29562
Gene (Homo sapiens)EDC4HGNC:HGNC:17157
Cell line (Homo sapiens)293TATCCCRL-3216Cell line maintained in DMEM + 10% FBS,50 U/mL penicillin, and50 ug/mL streptomycin
Cell line (Homo sapiens)HeLaATCCCCL-2Cell line maintained in DMEM + 10% FBS,50 U/mL penicillin, and50 ug/mL streptomycin
Cell line (Homo sapiens)Flp-In T-REx 293Thermo FisherR78007Cell line maintained in DMEM + 10% FBS,50 U/mL penicillin, and50 ug/mL streptomycin
AntibodyAnti-HA mouse monoclonalCovance901533WB(1:1000); IF(1:200)
AntibodyAnti-FLAG M2 mouse monoclonalSigma-AldrichF1804WB(1:1000); IF(1:500)
AntibodyAnti-V5 Rabbit monoclonalCell Signaling13202WB(1:1000); IF(1:500)
AntibodyAnti-human/mouse EDC4 Rabbit monoclonalBethylA300-745AWB(1:1000); IF(1:500)
AntibodyAnti-human/mouse DCP2 Rabbit monoclonalBethylA302-597AWB(1:1000)
AntibodyAnti-human Actin Mouse monoclonalCell Signaling3700WB(1:30000)
AntibodyAlexa Fluor 488 anti-rabbitInvitrogenA32731IF(1:500)
AntibodyAlexa Fluor 594 anti-mouseInvitrogenA32742IF(1:500)
Recombinant DNA reagentPLKO.1-Puro (plasmid)Sigma-AldrichRRID
:Addgene10878
shRNA backbone used for selecting transfected cells with puromycin
Recombinant DNA reagentpCI-neoPromegaE1731For all constructs labelled ‘LNHA’ and ‘RL’
Recombinant DNA reagentpBABE-3xFLAG-MARF1CtermNishimura et al., 2018Construct expressing a fragment of MARF1 previously validated by our group to be sufficient to physically interact with the mRNA decapping machinery.
Recombinant DNA reagentpcDNA-DEST40Thermo Fisher12274015
For expression of gateway cloned V5-tagged EDC4
Sequence-based reagentMAML1 3’UTR cloning primersThis paperPCR PrimerFWD: CGGCGCCGCTCTAGAGGTGTTGGGACAGCAGGATA
REV: CGGCGCCGCGCGGCCGCCATAGCTCCCCCAAAACACAC
Sequence-based reagentNOTCH2 3’UTR cloning primersThis paperPCR PrimerFWD: CGGCGCCGCGTCAGCGAGAGTCCACCTCCAGTGTAGAG
REV: CGGCGCCGCGCGGCCGCCATGTTCAAATATCTCACTGAC
Sequence-based reagentZFP36L2 3'UTR cloning primersThis paperPCR PrimerFWD: GCAGTAATTCTAGAGGCAAGAGGGCGCCAGTGAGGAGGA
REV: GCAGTAATGCGGCCGCCCCAAAAATTTTATTGGGGGAAAAC
Sequence-based reagentATXN7L3 3'UTR cloning primersThis paperPCR PrimerFWD: GCAGTAATTCTAGACTTGGGTGCAAGGGATAGCCTTTGG
REV: GCAGTAATGCGGCCGCCCAACGGGAGATGCAGTTTATTTAC
Sequence-based reagentFAF2 3'UTR cloning primersThis paperPCR PrimerFWD: GCAGTAATGCTAGCCCTCCTACCCCAGTCCCTAAAAGAA
REV: GCAGTAATGCGGCCGCCTGAAACTCTTTGCTTGGCCTTGGC
Sequence-based reagentCPSF7 3'UTR cloning primersThis paperPCR PrimerFWD: GCAGTAATTCTAGAGGAGTCTGGTTGGAAGCAAATGTTT
REV: GCAGTAATGCGGCCGCTCACCGACAACAGGGGGACGGGACC
Sequence-based reagentIGF2BP1 3'UTR cloning primersThis paperPCR PrimerFWD: GCAGTAATGCTAGCGGAGAACAGGCCTGGTGGGAAAGGC
REV: GCAGTAATGCGGCCGCGTAGTTACTAGCACTGCTGGTTCCC
Sequence-based reagentPGAM1 3’UTR cloning primersThis paperPCR PrimerFWD: GGCGCCGCGGCTAGCCCCACCTGCACATGTCACACTGACCAC
REV: GGCGCCGCGCGGCCGCATACTGATATGGAAAAAGGATTTAGTACAG
Sequence-based reagentMARF1ΔNYNcloning primersThis paperPCR PrimerFWD: GTGCTAGAAAACTTACCCTTCATTTCCGACTTGCCCCCCAGGTTACCAC
REV: GGCAAGTCGGAAATGAAGGGTAAGTTTTCTAGCACCTGTCCAGCTACTGC
Sequence-based reagentMARF1ΔRRM1cloning primersThis paperPCR PrimerFWD: AAAAATGCCACAGACTCCAAAAAATAGAGAACTCTGTG
REV: TTCTCTATTTTTTGGAGTCTGTGGCATTTTTAGTGGTAACCTG
Sequence-based reagentMARF1ΔRRM2cloning primersThis paperPCR PrimerFWD: TGCCCAGACCCACTCTCTTTACTGAGTGCAGAAACAATG
REV: CACTCAGTAAAGAGAGTGGGTCTGGGCAGTCGGCTTCGCTG
Sequence-based reagentMARF1Y513A/Y515Acloning primersThis paperPCR PrimerFWD: GCTCGCTGTTGCTAACCTACCAGCAAATAAGGATGGC
REV: GTAGGTTAGCAACAGCGAGCAGAGTGTGGCACTGTGGC
Sequence-based reagentMARF1I552A cloning primersThis paperPCR PrimerFWD: CTGCAGTGCAGCTCTCCGCTTCATAAACCAAGATAGTG
REV: GAAGCGGAGAGCTGCACTGCAGCCTGTGATACTCAGCAC
Sequence-based reagentMARF1F582A cloning primersThis paperPCR PrimerFWD: TTGTGTCAGCTACTCCAAAAAATAGAGAACTCTGTGAAAC
REV: TTTGGAGTAGCTGACACAATGATCCTATTACCAAAGACATC
Sequence-based reagentMARF1ΔLOTUS1cloning primersThis paperPCR PrimerFWD: TGGTCTCACTTGCCACCGGGGCTGCCAGCAAATCACTACCCAGCAGTCAGGCCCGCCAGA
REV: GGGGCTCTGGCGGGCCTGACTGCTGGGTAGTGATTTGCTGGCAGCCCCGGTGGCA
Sequence-based reagentMARF1ΔLOTUS2cloning primersThis paperPCR PrimerFWD: TCTTACAAGATTCCTTTTGTGATTCTTTCTATTCACAACAAGCCCCCGCC
REV: AGTGTTGGGAGGCGGGGGCTTGTTGTGAATAGAAAGAATCACAAAAGGAA
Sequence-based reagentMARF1ΔLOTUS3
cloning primers
This paperPCR PrimerFWD: CGTTCGAAGAGTCCTGTAGGTAACCCCCAGCACAGGGCCCAGGTGAAGCGCTTTA
REV: CTGAGTAAAGCGCTTCACCTGGGCCCTGTGCTGGGGGTTACCTACAGGACTCTTC
Sequence-based reagentMARF1ΔLOTUS4
cloning primers
This paperPCR PrimerFWD: CGTCTGCTGACCCTTACCCACAGGGCCCAGCCCAAAAGAGAACGCACTCAGGATG
REV: TATTTCATCCTGAGTGCGTTCTCTTTTGGGCTGGGCCCTGTGGGTAAGGGTCAGC
Sequence-based reagentMARF1ΔLOTUS5
cloning primers
This paperPCR PrimerFWD: AGAGAACGCACTCAGGATGAAATAGAAAGGCTTTTCTTCGAGCGGTTCAAAGCTC
REV: AGCTAGAGCTTTGAACCGCTCGAAGAAAAGCCTTTCTATTTCATCCTGAGTGCGT
Sequence-based reagentMARF1ΔLOTUS6
cloning primers
This paperPCR PrimerFWD: TGTCAGAGTAAGGATCTTTTCTTCGAGCGGATCAACCGAAAGTCTCTGCGATCTC
REV: AGTGAGAGATCGCAGAGACTTTCGGTTGATCCGCTCGAAGAAAAGATCCTTACTC
Sequence-based reagentMARF1ΔLOTUS7
cloning primers
This paperPCR PrimerFWD: AGACAGATTCAGCTGATCAACCGAAAGTCTACAAGTCTGTATTTGTTTGC
REV: CACATTCTTTGCAAACAAATACAGACTTGTAGACTTTCGGTTGATCAGCT
Sequence-based reagentFull length MARF1 cloning primersThis paperPCR PrimerFWD: GGACGATCTGCAATTGGAAGGAAACGGAACTGAGAACTCCTGC
REV: GCGCCGCGCGGCCGCTTAAAGCTTGGTTATAGGTGCTAAGGAAAAG
Sequence-based reagentMARF1ΔCtermcloning primersThis paperPCR PrimerFWD: GGACGATCTGCAATTGGAAGGAAACGGAACTGAGAACTCCTGC
REV: GCGCCGCGCGGCCGCTTAGAGACTGAGTGAACTCAAACGAC
Sequence-based reagentMARF1N-termcloning primersThis paperPCR PrimerFWD: GGACGATCTGCAATTGGAAGGAAACGGAACTGAGAACTCCTGC
REV: GCGCCGCGCGGCCGCTTACCCGGTGGCAAGTGAGACCAGG
Sequence-based reagentEDC4 Gateway cloning primersThis paperPCR PrimerFWD: GGGGACAAGTTTGTACAAAAAAGCAGGCTACCATGGCCTCCTGCGCGAGCATCGACATCG
REV: GGGGACCACTTTGTACAAGAAAGCTGGGTCAGGGAGGCTGGGGGTCACGA
Sequence-based reagentFL qPCR primersThis paperFWD: CCTTCGATAGGGACAAGACAA
REV: AATCTCACGCAGGCAGTTCT
Sequence-based reagentRL qPCR primersThis paperFWD: GAGTTCGCTGCCTACCTGGAGCCAT
REV: GGATCTCGCGAGGCCAGGAGAG
S1equence-based reagentGAPDH qPCR primersThis paperFWD: GTGGAGATTGTTGCCATCAACGA
REV: CCCATTCTCGGCCTTGACTGT
Sequence-based reagentMAML1 qPCR primersThis paperFWD: GACTCTCTCAACAAAAAGCGTCT
REV: AGGAAATGACTCACTGGGGTTA
Sequence-based reagentNOTCH2 qPCR primersThis paperFWD: CTCCAGGAGAGGTGTGCTTG
REV: TGATGTCTCCCTCACAACGC
Sequence-based reagentGFP siRNADharmaconD-001940-01-05Accell eGFP control siRNA
Sequence-based reagentEDC4 siRNADharmaconL-016635-00-0005SMARTpool
Sequence-based reagentDCP2 siRNADharmaconL-008425-01-0005SMARTpool
Peptide, recombinant proteinActinomycin DSigma-AldrichA1410
Commercial assay or kitGoTaq qPCR Master MixPromegaA6001Reagent for all qPCR assays
Commercial assay or kitDual-Luciferase AssayPromegaE1910Reagent for all luciferase assays
OtherDAPI stainInvitrogenD1306(1 µg/mL)

Data availability

Sequencing data have been deposited in GEO under accession code GSE149820.

The following data sets were generated
  1. 1
    NCBI Gene Expression Omnibus
    1. M Fabian
    2. WR Brothers
    3. S Hebert
    4. C Kleinman
    (2020)
    ID GSE149820. Data from: A non-canonical role for the EDC4 decapping factor in regulating MARF1-mediated mRNA decay.

Additional files

Supplementary file 1

CLIP mapping and cluster statistics.

https://cdn.elifesciences.org/articles/54995/elife-54995-supp1-v1.xlsx
Supplementary file 2

List of MARF1 target RNAs identified by iCLIP that overlap with upregulated gene expression in Marf1GT/GT and Marf1D272A/D272A germinal vesicles (Yao et al., 2018).

https://cdn.elifesciences.org/articles/54995/elife-54995-supp2-v1.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/54995/elife-54995-transrepform-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)