Loss of Doc2b does not influence transmission at Purkinje cell to deep nuclei synapses under physiological conditions
- Department of Neurobiology, Harvard Medical School, United States
Figures
Figure 1 with 4 supplements
Loss of Doc2b does not affect mIPSC frequency at the PC to DCN synapse.
(A) Sagittal cerebellum slice from a WT mouse at postnatal day 60 (P60) labeled using FISH for DAPI (blue), Doc2b (green), and Doc2a (red). Abbreviations, Purkinje Cell Layer (PCL), Molecular Layer …
-
Figure 1—source data 1
PC to DCN mini frequencies and amplitudes.
- https://cdn.elifesciences.org/articles/55165/elife-55165-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Doc2a expression is normal in Doc2b KO.
(A) Sagittal hippocampus slice from a WT mouse at P60 labeled with RNAscope probe for DAPI (blue). Scale bar, 200 μm. (Aa). Inset from (A) with expanded view of dentate gyrus, labeled with RNAscope …
Figure 1—figure supplement 2
Doc2b immunohistochemistry in wildtype and Doc2b KO animals.
(A) Sagittal cerebellum slice from a WT mouse at postnatal day 60 (P60) immunostained for parvalbumin (left, cyan) and Doc2b (right, magenta). Scale bar, 300 μm. (B) Same as in (A) but for Doc2b KO. …
Figure 1—figure supplement 3
Doc2b KO reduces mIPSC frequency at PC to PC collateral synapses.
(A) mIPSCs were recorded at PC to PC synapses in P7-8 mice in the presence of TTX, NBQX, CPP, and strychnine. Representative traces from individual cells for WT (black) and Doc2b KO (red) …
Figure 1—figure supplement 4
Postsynaptic loss of Doc2b does not alter mEPSC frequency onto PCs.
(A) mEPSCs were recorded at PC to PC synapses in P11-12 mice in the presence of TTX and gabazine. Representative traces from individual cells for WT (black) and Doc2b KO (red) littermates. (B) …
Figure 2 with 2 supplements
Doc2b does not contribute to the strength or kinetics of evoked release.
(A) Top: Example minimal stimulation of a PC input to a DCN neuron, where the stimulus intensity was lowered until failures or single inputs were evoked with similar probability. Bold traces show …
-
Figure 2—source data 1
PC to DCN single fibers and spontaneous events.
- https://cdn.elifesciences.org/articles/55165/elife-55165-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Asynchronous release after single stimuli does not occur at the PC to DCN synapse.
(A) Representative example of single input from WT, showing average failure and average input. (B) Individual trials from the example in (A) showing failures (top) and successfully evoked single …
Figure 2—figure supplement 2
Asynchronous release after stimulus bursts does not occur at the PC to DCN synapse.
(A) Representative example of DCN response to 4 × 100 Hz burst stimulation of PC fibers from WT. (B) Individual trials from the example in (A). Stimulus artifact is blanked for clarity. (C) Same as …
Figure 3
Short-term plasticity at the developing PC to DCN synapse is unaffected by Doc2bKO.
(A) PC axons were stimulated at various frequencies and responses were recorded from large DCN neurons in P13-15 mice. Representative IPSCs for WT are shown with stimulus artifact blanked for …
-
Figure 3—source data 1
PC to DCN train data for young animals.
- https://cdn.elifesciences.org/articles/55165/elife-55165-fig3-data1-v1.xlsx
Figure 4
Doc2b is not necessary for frequency-invariant transmission at the mature PC to DCN synapse.
(A) Example of DCN response to PC axon stimulation at 10 Hz or 100 Hz in WT. Stimulus artifact blanked for clarity. (B) Same as in (A) but for Doc2b KO. Same scale as in (A) unless indicated …
-
Figure 4—source data 1
PC to DCN train data for adult animals.
- https://cdn.elifesciences.org/articles/55165/elife-55165-fig4-data1-v1.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Doc2b (gene) Doc2b (protein) | UniProtKB | P-70169 | |
| Strain, strain background (M. musculus) | Doc2b KO mice | Doi:http://doi.org/10.1126/science.1183765; PMID:20150444 | ||
| Antibody | Rabbit polyclonal anti-Doc2b | Synaptic Systems | Cat #174 103; RRID:AB_2619874 | IHC (1:200) |
| Antibody | Mouse monoclonal anti-Parvalbumin | Sigma-Aldrich | Product#P3088-.2ML; RRID:AB_477329 | IHC (1:500) |
| Antibody | Goat anti-rabbit IgG H and L Alexa Fluor647 | Abcam | Ab150083; RRID:AB_2714032 | IHC (1:1000) |
| Antibody | Goat anti-mouse IgG H and L Alexa Fluor568 | Abcam | Ab175473 | IHC (1:1000) |
| Sequence-based reagent | Fluorophore-conjugated Probe-Mm-Doc2b | ACD Bio | Cat#484798 | |
| Sequence-based reagent | 2.5 VS Probe -Mm-Doc2A probe | ACD Bio | Cat#531549-C2 | |
| Software, algorithm | Matlab | Mathworks (https://www.mathworks.com/ downloads/) | RRID:SCR_001622 | Version R2017a |
| Software, algorithm | IgorPro | Wavemetrics (https://www.wavemetrics.com/order/order_igordownloads6.htm) | RRID:SCR_000325 | Version 6.37 |
| Software, algorithm | ImageJ software | ImageJ (http://imagej.nih.gov/ij/) | RRID:SCR_003070 | |
| Software, algorithm | OlyVIA software | Olympus (https://www.olympus-lifescience.com/en/support/downloads/) | RRID:SCR_016167 | Version 2.9.1 |
| Sequence-based reagent | Doc2b primers | This paper | PCR primers | 5’CATTGCCACTTCATAAGCGTAAGTTTCC 3’ 5’CGAGGATGGAACCCTGTTTACTCTGG 33’ 5’CCTTCTATCGCCTTCTTGACG 3’ |
| Chemical compound, drug | NBQX disodium salt | Abcam | Ab120046 | |
| Chemical compound, drug | (R)-CPP | Abcam | Ab120159 | |
| Chemical compound, drug | Strychnine hydrochloride | Abcam | Ab120416 | |
| Chemical compound, drug | SR95531 (gabazine) | Abcam | Ab120042 | |
| Chemical compound, drug | Tetrodotoxin citrate | Abcam | Ab120055 | |
| Other | DAPI stain | Invitrogen (ThermoFIsher Scientific) | Cat#00-3958-02 | (1 µg/mL) |
