Evolutionarily distant I domains can functionally replace the essential ligand-binding domain of Plasmodium TRAP
- Integrative Parasitology, Center for Infectious Diseases, Heidelberg University Medical School, Germany
- Université de Strasbourg, CNRS UPR9022, INSERM U963, Institut de Biologie Moléculaire et Cellulaire, France
- Department of Molecular Virology, Heidelberg University Medical School, Germany
- Experimental Parasitology, Faculty of Veterinary Medicine, Ludwig-Maximilians-Universität München, Germany
- Program in Cellular and Molecular Medicine, Children's Hospital Boston, and Departments of Biological Chemistry and Molecular Pharmacology and of Medicine, Harvard Medical School, United States
Figures
Figure 1
Structural features of TRAP, MIC2, and integrin αI domains.
(A–E) Cartoon ribbon diagrams. (A), open TRAP (Protein Databank ID (PDB)) 4HQL; (B), closed TRAP, PDB 4HQF; (C), closed MIC2, PDB 4OKR chain B; (D), open αX αI domain, PDB 4NEH; (E), closed αX αI …
Figure 2 with 3 supplements
The I domain of TRAP is essential for salivary gland invasion and gliding motility of sporozoites.
(A) Domain architecture of full-length TRAP and the mutant TRAP∆I lacking the I domain denoting signal peptide (SP), I domain (I, green), thrombospondin type-I repeat (TSR, blue), repeats, …
Figure 2—figure supplement 1
Generation of trap∆I and trap(-) parasites.
(A) Strategy to generate parasites that lack the I domain of TRAP (trap∆I) (top) and a trap(-) (bottom) line without resistance marker by double crossover homologous recombination. For the …
Figure 2—figure supplement 2
Movement patterns exhibited by sporozoites.
Sporozoites placed on solid substrates can exhibit different types of movement. Gliding, sporozoites migrate continuously in circles. Patch gliding sporozoites move back and forth over a single …
Figure 2—figure supplement 3
trap∆I sporozoites are not infective to mice.
Mice were either exposed to 10 infected mosquitoes (A) or injected intravenously with 10,000 hemolymph sporozoites (B) of trap∆I or wild type (wt). Parasite growth and survival of infected mice was …
Figure 3 with 4 supplements
Sporozoites expressing TRAP with I domains from T. gondii or humans invade salivary glands at different levels.
(A) Domain architecture of full-length TRAP (see Figure 2A legend) indicating the exchanged I domain. (B) Immunofluorescence assay (IFA) using antibodies against TRAP and CSP on non-fluorescent …
Figure 3—figure supplement 1
Generation of P. berghei strains expressing TRAP with different I domains.
(A) Cartoon illustrating the generation of transgenic parasites expressing trap genes with exchanged I domains in fluo and trap(-) parasites. Transgenic parasites were generated by double crossover …
Figure 3—figure supplement 2
Transmission efficacy of salivary gland sporozoites expressing TRAP with different I domains transmitted either by mosquito bite or by intravenous injection.
Mice were either exposed to 10 infected mosquitoes (A) or injected intravenously (i.v.) with 10,000 salivary gland sporozoites (B). Shown is the parasitemia of four infected mice per parasite line …
Figure 3—figure supplement 3
Transmission efficacy of intravenously injected hemolymph sporozoites expressing TRAP with different I domains.
Mice were either injected intravenously (i.v.) with 10,000 (A) or 25,000 (B) hemolymph sporozoites. Injections with 25,000 hemolymph sporozoites were only performed with αX-I fluo and αL-I fluo …
Figure 3—figure supplement 4
Sporozoites expressing the integrin I domains αX or αL are infective to mice.
(A) Primers were designed to bind specific to sequences encoding for the different I domains TRAP-I, MIC2-I, αX-I and αL-I. (B) Cartoon to illustrate the genotype analysis of parasites isolated from …
Figure 4
Impaired in vitro gliding of I domain mutant sporozoites.
(A, B) Ratio of productively and unproductively moving/non motile hemolymph (A) and salivary gland (B) sporozoites of the indicated parasite lines. Sporozoites were classified as productively moving …
Figure 5 with 1 supplement
MIC2-I sporozoites are impaired in hepatocyte invasion but not in liver stage development.
(A) Invasion assay. Confluent HepG2 monolayers exposed to sporozoites for 1.5 hr were fixed and stained with CSP antibodies before and after permeabilization with methanol; anti-IgG secondary …
Figure 5—figure supplement 1
MIC2-I sporozoites show no altered tissue tropism compared to TRAP-I.
Parasite load in lung, spleen, small intestine and liver of mice infected with 20,000 MIC2-I or TRAP-I salivary gland sporozoites. Organs were harvested 42 hr post infection to isolate RNA. Per …
Figure 6 with 2 supplements
Sporozoites expressing an I domain with a negatively charged MIDAS perimeter invade salivary glands normally but show decreased motility and infectivity to mice.
(A–E) Electrostatic surfaces around the MIDAS metal ion of I domains in the open conformation. Structures are of (A), P. berghei TRAP modeled on P. vivax, PDB 4HQL; (B), MIC2, modeled on closed MIC2 …
Figure 6—figure supplement 1
Alignment of TRAP I domain homologues of different Plasmodium species in comparison to the I domain of the PbRevCharge mutant.
The I domain of the RevCharge mutant was aligned with the I domains of TRAP homologues found in the five human infecting Plasmodium species P. falciparum (Pf), P. malariae (Pm), P. ovale (Po), P. …
Figure 6—figure supplement 2
RevCharge sporozoites show impaired hepatocyte invasion but normal liver stage development.
(A) Invasion assay of RevCharge and control (TRAP-I) sporozoites showing sporozoites that entered (black) or not (white) hepatocytes. Cells were fixed and stained with CSP antibodies as well as two …
Author response image 1
In vitro gliding motility of TRAP-I, MIC2-I, αX-I and αL-I sporozoites on different substrates.
Sporozoites were allowed to glide in wells coated with heparin, laminin, fibronection, collagen and two different concentrations of ICAM-I (10 µg/mL and 20 µg/mL); see Author response table 1. In …
Videos
Video 1
Z-projection through salivary gland infected with aX-I fluo sporozoites.
Shown is an image series in Z-direction of a salivary gland infected with aX-I fluo sporozoites. Images were taken on an Axiovert 200M (Zeiss) with a 63x (N.A. 1.3) objective.
Video 2
TRAP-I and αX-I hemolymph sporozoites gliding in vitro.
Movie showing hemolymph sporozoites expressing mCherry of TRAP-I (shown on the left with a white background) and αX-I (shown on the right with a black background) productively gliding in vitro. …
Tables
Table 1
Absolute sporozoite numbers in midgut (MG), hemolymph (HL) and salivary glands (SG) of all analyzed parasite strains.
Sporozoites in the midgut, hemolymph and the salivary glands of infected mosquitoes were counted between day 14 and day 24 post infection of each feeding experiment. Shown is the mean ± SD of all …
| Parasite line | No. of MG sporozoites | No. of HL sporozoites | No. of SG sporozoites | SGS pos./total counts | SGS/MGS |
|---|---|---|---|---|---|
| trap(-) | 26,000 (±24.000) | 6000 (±7,000) | 20 | 1/8 | 0.0009 |
| wt | 10,000 (±3,000) | n.d. | 8000 (±7,000) | 4/4 | 0.8 |
| fluo | 108,000 (±70,000) | n.d. | 21,000 (±4,000) | 6/6 | 0.2 |
| TRAP-I | 26,000 (±7,000) | 8,000* | 16,000 (±4,000) | 2/2 | 0.6 |
| MIC2-I | 38,000 (±16,000) | 6,000* | 18,000 (±3,000) | 2/2 | 0.5 |
| αX-I | 35,000 (±13,000) | 4,000* | 210 | 2/2 | 0.006 |
| αL-I | 42,000 (±16,000) | 7,000* | 30 | 1/2 | 0.0006 |
| RevCharge | 70,700 (±12,000) | n.d. | 13,000 (±6,000) | 7/7 | 0.2 |
| trapΔI | 24,000 (±20,000) | 4000 (±5.000) | 60† | 3/14 | 0.003 |
| TRAP-I fluo | 22,000 (±13,000) | 2000 (±2.000) | 17,000 (±6,000) | 8/8 | 0.8 |
| MIC2-I fluo | 21,000 (±17,000) | 1000 (±700) | 7000 (±4,000) | 7/7 | 0.3 |
| αX-I fluo | 37,000 (±7,000) | 6000 (±2,000) | 120 | 6/6 | 0.003 |
| αL-I fluo | 34,000 (±9,000) | 5000 (±3,000) | 90 | 3/6 | 0.003 |
-
*hemolymph sporozoites of the non-fluorescent lines TRAP-I, MIC2-I, αX-I and αL-I were only counted once.
†in one infection 800 SG sporozoites could be counted. Intravenous injection of 5000 salivary gland sporozoites into each of four mice did not lead to infection.
Table 2
Determination of transmission efficacy in vivo.
Transmission efficacy of trap(-), trapΔI, TRAP-I, MIC2-I, αX-I, αL-I and RevCharge as well as the wild type (wt) reference line. Prepatency is the time between sporozoite infection and the first …
| Parasite line | Route of inoculation | Infected Mice‡ | Prepatency (days) |
|---|---|---|---|
| wild type ANKA | by mosquito bite§ | 4/4 | 3.0 |
| wild type ANKA | 10,000 HLS | 4/4 | 3.0 |
| TRAP-I fluo | by mosquito bite§ | 4/4 | 3.0 |
| TRAP-I fluo | 500,000 MGS | 1/1† | 8.0 |
| TRAP-I fluo | 10,000 HLS (i.v.) | 4/4 | 4.0 |
| TRAP-I fluo | 10,000 SGS (i.v.) | 4/4 | 3.0 |
| MIC2-I fluo | by mosquito bite§ | 4/4 | 3.0 |
| MIC2-I fluo | 10,000 HLS (i.v.) | 4/4 | 3.8 |
| MIC2-I fluo | 10,000 SGS (i.v.) | 8/8 | 3.1 |
| αX-I fluo | by mosquito bite§ | 0/4 | /* |
| αX-I fluo | 500,000 MGS (i.v.) | 2/4 | 8.0 |
| αX-I fluo | 10,000 HLS (i.v.) | 1/4 | 6.0 |
| αX-I fluo | 25,000 HLS (i.v.) | 5/8 | 5.5 |
| αL-I fluo | by mosquito bite§ | 0/4 | /* |
| αL-I fluo | 500,000 MGS (i.v.) | 0/2 | /* |
| αL-I fluo | 10,000 HLS (i.v.) | 0/4 | /* |
| αL-I fluo | 25,000 HLS (i.v.) | 1/6 | 5.0 |
| trap(-) | 500,000 MGS (i.v.) | 0/4 | /* |
| trap(-) | 25,000 HLS (i.v.) | 0/6 | /* |
| trap∆I | by mosquito bite¶ | 0/4 | /* |
| trap∆I | 500,000 MGS (i.v.) | 0/6 | /* |
| trap∆I | 10,000 HLS (i.v.) | 0/4 | /* |
| trap∆I | 25,000 HLS (i.v.) | 0/4 | /* |
| trap∆I | 5,000 SGS (i.v.) | 0/4 | /* |
| TRAP-I | 10,000 HLS (i.v.) | 4/4 | 3.0 |
| MIC2-I | 10,000 HLS (i.v.) | 4/4 | 4.0 |
| αX-I | 10,000 HLS (i.v.) | 3/4 | 5.3 |
| αL-I | 10,000 HLS (i.v.) | 0/4 | /* |
| RevCharge | by mosquito bite¶ | 2/8 | 5.5 |
| RevCharge | 10,000 SGS (i.v.) | 9/9 | 3.9 |
-
*mice did not become positive within ≥10 days post infection.
† three mice had to be sacrificed due to tail infections that occurred after injection.
-
‡ Infected mice/inoculated (exposed) mice.
§ mosquitoes were pre-selected for parasites.
-
¶ mosquitoes were not pre-selected for parasites.
Table 3
Clustered summary of in vivo infections.
Comparison of the sporozoite infectivity to mice of the different lines by adding the data from Table 2 where the respective controls were 100% infective. Data for wild type controls, MIC2-I domain …
| Parasite lines | Infected mice* |
|---|---|
| wild type controls | 24/24 |
| MIC2-I domain RevCharge | 20/20 11/17 |
| αX-I domain | 9/16 |
| αL-I domain trap∆I trap(-) | 1/14 0/8† 0/6 |
-
* Infected mice/inoculated (exposed) mice.
† Four additional mice injected with 5000 salivary gland sporozoites also remained uninfected.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | anti-CSP (mouse monoclonal) | Yoshida et al., 1980 | MR4: MRA-100 | mAb 3D11 |
| Antibody | anti-TRAP (rabbit ployclonal) | This paper | / | / |
| Antibody | anti-rabbit (Goat) | ThermoFisher Scientific | Cat#A-11034 | coupled to AlexaFluor 488 |
| Antibody | anti-rabbit (Goat) | ThermoFisher Scientific | Cat#A10523 | coupled to Cy5 |
| Antibody | anti-mouse (Goat) | ThermoFisher Scientific | Cat#A-11001 | coupled to AlexaFluor 488 |
| Antibody | anti-mouse (Goat) | ThermoFisher Scientific | Cat#A10524 | coupled to Cy5 |
| Antibody | anti-rabbit (Goat) | Bio-Rad | Cat#1705046 | Immun Star (GAR)-HRP |
| Antibody | anti-mouse (sheep) | GE-Healthcare | NXA931-1ML | IgG, HRP linked whole Ab |
| Bacteria (Escherichia coli) | XL1-blue cells | Agilent technologies | Cat#200236 | Chemically competent cells |
| Other | Hoechst 33342 | ThermoFisher Scientific | Cat#H3570 | / |
| Commercial assay or kit | SYBR Green PCR Master Mix | ThermoFisher Scientific | Cat#4309155 | / |
| Cell line (Homo sapiens) | HepG2 | ATCC | HB-8065 | / |
| Strain (Mus musculus) | NMRI | Janvier Labs/Charles River Laboratories | / | / |
| Strain (Mus musculus) | C57BL/6JRj | Janvier Labs/Charles River Laboratories | / | / |
| Strain (Plasmodium berghei) | ANKA | Vincke and Bafort, 1968 | MR4: MRA-671 | / |
| Strain (Plasmodium berghei) | trap(-)rec | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | trapΔI | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | TRAP-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | MIC2-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αX-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αL-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | TRAP-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | MIC2-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αX-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αL-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | RevCharge non-fluo | this paper | / | ANKA background |
| Sequenced-based reagent | gapdh forward | this paper | PCR primers | TGAGGCCGGTGCTGAGTATGTCG |
| Sequenced-based reagent | gapdh reverse | this paper | PCR primers | CCACAGTCTTCTGGGTGGCAGTG |
| Sequenced-based reagent | 18 s RNA forward | this paper | PCR primers | AAGCATTAAATAAAGCGAATACATCCTTAC |
| Sequenced-based reagent | 18 s RNA reverse | this paper | PCR primers | GGAGATTGGTTTTGACGTTTATGTG |
| Recombinant DNA reagent | TRAP gene sequence: TRAP-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: MIC2-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: αX-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: αL-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: RevCharge | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | pMK-RV | ThermoFisher Scientific | / | KanR |
| Recombinant DNA reagent | Pb238 | Deligianni et al., 2011 Singer et al., 2015 | / | AmpR |
| Recombinant DNA reagent | PbGEM-107890 | Schwach et al., 2015 PlasmoGEM | / | https://plasmogem.sanger.ac.uk/designs/search_result?id=PbGEM-107890 |
| Software, algorithm | Prism 5.0 | GraphPad, San Diego | / | https://www.graphpad.com/scientific-software/prism/ |
| Software, algorithm | PyMOL | The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC | / | https://pymol.org/2/ |
| Software, algorithm | AxioVision | Carl Zeiss Microscopy | / | https://www.zeiss.com/microscopy/int/home.html |
| Software, algorithm | Volocity | PerkinElmer | / | http://www.perkinelmer.de/corporate |
| Software, algorithm | ApE | ApE – A plasmid Editor by M. Wayne Davis | / | http://jorgensen.biology.utah.edu/wayned/ape/ |
| Software, algorithm | ImageJ | Schindelin et al., 2012 | / | https://imagej.nih.gov/ij/ |
| Software, algorithm | Clustal Omega | Sievers et al., 2011 | / | https://www.ebi.ac.uk/Tools/msa/clustalo/ |
| Software, algorithm | Optimizer | Puigbò et al., 2007 | / | http://genomes.urv.es/OPTIMIZER/ |
| Software, algorithm | PlasmoDB (version 26–34) | Aurrecoechea et al., 2009 | / | http://plasmodb.org/plasmo/ |
Author response table 1
Coating protocols used to test gliding motility of sporozoites on different substrates.
Gliding assays were performed in 96-well plates and wells were coated with heparin, ICAM-I, laminin, fibronectin and collagen according to the following protocols (Bilsland, Diamond and Springer, …
| Coating agent | Concentration | Protocol |
|---|---|---|
| Heparin | 100 U/µL | Heparin (stock: 25000 U/µL) was diluted in Laminin buffer (150 mM NaCl, 50 mM TRIS, pH 7.4) to 100 U/µL. Coating procedure: Per well 150 µL heparin solution was added and incubated overnight at 4°C. Before the gliding assay was started wells were washed once with PBS. |
| ICAM-I | 10 µg/mL | ICAM-I (stock: 2 mg/mL) was diluted in PBS to 10 or 20 µg/mL. Coating procedure: Per well 150 µL of the final solution was added and incubated at 4°C overnight. Before the gliding assays were started wells were washed once with PBS. |
| ICAM-I | 20 µg/mL | |
| Laminin | 25 µg/mL | Laminin (stock: 1 mg/mL) was diluted in Laminin buffer to 25 µg/mL. Coating procedure: Wells were washed with 70 % EtOH to increase hydrophilicity. Subsequently wells were washed three times with H2O to remove remnants of EtOH. Per well 200 µL laminin solution was added and incubated at room temperature for one hour. Before the gliding assay was started wells were washed once with PBS. |
| Fibronectin | 50 µg/mL | Fibronectin (stock: 1 mg/mL) was diluted in Laminin buffer to 50 µg/mL. Coating procedure: As above. |
| Collagen | 2.5 µg/mL | Collagen (stock: 1 mg/mL) was diluted in 0.2 M acetic acid to 2.5 µg/mL. Coating procedure: As above. |
Additional files
-
Supplementary file 1
Primer sequences.
Primers used for the generation and genotyping of the parasite lines presented in this study.
- https://cdn.elifesciences.org/articles/57572/elife-57572-supp1-v1.docx
-
Supplementary file 2
Amino acid sequences of the TRAP variants expressed by the parasite lines TRAP-I, MIC2-I, αX-I, αL-I, and RevCharge.
Shown are the sequences of each TRAP replacement. Residues that are part of the extendable ß-ribbon are written in green, residues that form the remainder of the I domain are written in red, residues of the thrombospondin domain are written in orange, and the remaining native residues of PbTRAP are written in black. Residues written in blue were introduced into wild type PbTRAP to generate a more negative charge on the portion of the I domain surface surrounding the MIDAS in the RevCharge mutant. Residues written in white on a black background were mutated to create a better fitting of the exchanged portion of the I domain with the N- and C-terminal segments of the PbTRAP I domain/extendable ß-ribbon. The calculated pI of the I domain region is shown in parentheses.
- https://cdn.elifesciences.org/articles/57572/elife-57572-supp2-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/57572/elife-57572-transrepform-v1.pdf
