MARCH8 inhibits viral infection by two different mechanisms
- Department of Pathology, National Institute of Infectious Diseases, Japan
- Faculty of Life and Environmental Sciences, University of Yamanashi, Japan
- Faculty of Pharmaceutical Sciences, Nagasaki International University, Japan
Figures
Figure 1
MARCH8 targets and ubiquitinates cytoplasmic lysine residues of VSV-G but not of HIV-1 Env.
(A) Schematic structure of the lysine mutants of VSV-G (CT5K/R; upper) and HIV-1 Env (CT2K/R; lower). SP, signal peptide; EC, extracellular domain; TM, transmembrane domain; CT, cytoplasmic tail; …
Figure 2
The tyrosine motif of MARCH8 mediates downregulation of HIV-1 Env but not of VSV-G.
(A) Schematic structure of YxxΦ motif mutants of MARCH8 (222YxxL225 and 232YxxV235). (B) Western blot analysis was performed by using extracts from 293T cells transfected with HA-tagged MARCH8 …
Figure 3
Schematic diagram of two different molecular mechanisms by which MARCH8 inhibits viral infection.
Left, MARCH8 (red) downregulates VSV-G (violet) in a ubiquitin-dependent manner. The RING-CH domain (pink) of MARCH8 recognizes VSV-G’s cytoplasmic lysine residues, which results in ubiquitin …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene(Homo sapiens) | MARCH8 | NCBI | BC025394 | |
| Recombinant DNA reagent | pNL4-3 | Adachi et al., 1986 | ||
| Recombinant DNA reagent | pNL-E(-) | Iwabu et al., 2009 | ||
| Recombinant DNA reagent | pNL-Luc2-E(-) | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-GagPol-RRE | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-NLenv | Tada et al., 2015 | ||
| Recombinant DNA reagent | pCa-Rev | Iwabu et al., 2009 | ||
| Recombinant DNA reagent | pC-VSVg | Tada et al., 2015 | ||
| Recombinant DNA reagent | pVSVg-T7E | Tada et al., 2015 | ||
| Recombinant DNA reagent | pCa-EGFP | Iwabu et al., 2009 | ||
| Recombinant DNA reagent | pMM310 | Tobiume et al., 2003 | ||
| Recombinant DNA reagent | pC-MARCH8 | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-HA-MARCH8 | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-HA-MARCH8-CS | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-NLenv-CT2K/R | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-VSVg-CT5K/R | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-VSVg-CT5K/R-T7E | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-MARCH8-222AxxL225 | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-HA-MARCH8-222AxxL225 | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-MARCH8-232AxxV235 | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-HA-MARCH8-232AxxV235 | This paper | See Materials and methods | |
| Sequence-basedreagent | NL-env-MfeI-S | This paper | gacaattggagaagtgaatt | Sense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | NLenv-CT2KR-A | This paper | ctattcCttagttcctgactccaatactgtaggagattccaccaatatCtgagggc | Overlapping PCR's antisense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | NLenv-CT2/KR-S | This paper | gccctcaGatattggtggaatctcctacagtattggagtcaggaactaaGgaatag | Overlapping PCR's sense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | NL-env-XhoI-A | This paper | ccgCTCGAGttatagcaaaatcctttccaag | Antisense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | VSVg-BsiWI-S | This paper | atCGTACGatgaagtgccttttgtactt | Sense primer for pC-VSVg-CT5K/R-T7E |
| Sequence-basedreagent | VSVg-CT5K/R-XhoI-A | This paper | ATctcgaGcCttccaagtcggttcatctctatgtctgtataaatctgtcttCtcCtggtgtgcCttaatCtaatg | Antisense primer for pC-VSVg-CT5K/R-T7E |
| Sequence-basedreagent | MARCH8-KpnI-S | This paper | ggGGTACCatgagcatgccactgcatcag | Sense primer for pC-MARCH8-222AxxL225 and pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-XhoI-S | This paper | ccgCTCGAGagcatgccactgcatcagat | Sense primer for pC-HA-MARCH8-222AxxL225 and pC-HA-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-222AxxL225-S | This paper | gtgtaaagtgGCtgtgcaGttgtggaagag | Overlapping PCR's sense primer for pC-MARCH8-222AxxL225 and pC-HA-MARCH8-222AxxL225 |
| Sequence-basedreagent | MARCH8-222AxxL225-A | This paper | ctcttccacaaCtgcacaGCcactttacac | Overlapping PCR's antisense primer for pC-MARCH8-222AxxL225 and pC-HA-MARCH8-222AxxL225 |
| Sequence-basedreagent | MARCH8-232AxxV235-S | This paper | gagactcaaggccGCtaatagagtgatc | Overlapping PCR's sense primer for pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-232AxxV235-A | This paper | gatcactctattaGCggccttgagtctc | Overlapping PCR's antiense primer for pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-XhoI-A | This paper | ccgCTCGAGtcagacgtgaatgatttctg | Antisense primer for pC-MARCH8-222AxxL225 and pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-NotI-A | This paper | attGCGGCCGCtcagacgtgaatgatttctg | Antisense primer for pC-HA-MARCH8-222AxxL225 and pC-HA-MARCH8-232AxxV235 |
| Cell line (H. sapiens) | 293T | ATCC | CRL-3216 | |
| Cell line (H. sapiens) | MT4 | JCRB | 1216 RRID:CVCL_2632 | |
| Cell line (H. sapiens) | HeLa | ATCC | CVCL_0030 | |
| Cell line (H. sapiens) | MAGIC5 | Mochizuki et al., 1999 | ||
| Cell line (H. sapiens) | HOS | ATCC | CRL-1543 | |
| Commercial assayor kit | PCR Mycoplasma Detection Set | Takara | TKR-6601 | Mycoplasma detection |
| Chemicalcompound,drug | FuGENE6 | Promega | E2691 | Transfection reagent |
| Commercial assayor kit | HIV-1 p24 ELISA Kit | XpressBio | XBR-1000 | HIV-1 p24 antigen capture ELISA |
| Commercial assayor kit | HIV-1 gp120 ELISA Kit | Advanced BioScience Laboratories | 5429 | HIV-1 gp120 ELISA |
| Commercial assayor kit | One-Glo Luciferase Assay Reagent | Promega | E6110 | Luciferase assay |
| Chemicalcompound,drug | Protein A-Sepharose | GE Healthcare | 17-0780-01 | Immunoprecipitation |
| Chemicalcompound,drug | Complete protease inhibitor cocktail | Roche | 11697498001 | Protease inhibitor |
| Chemicalcompound,drug | n-octyl-β-D-glucoside | Dojindo | O001 | Nonionic surfactant |
| Chemicalcompound,drug | Saponin | Sigma-Aldrich | 47036 | Nonionic surfactant |
| Antibody | Anti-HA | Sigma-Aldrich | H9658 RRID:AB_260092 | WB (1:10,000 )Mouse monoclonal |
| Antibody | Anti-HA | Sigma-Aldrich | H3663 RRID:AB_262051 | IF (1:200)Mouse monoclonal |
| Antibody | Anti-HA | Sigma-Aldrich | H6908 RRID:AB_260070 | IF (1:200)Rabbit polyclonal |
| Antibody | anti-HA | GenScript | A00168-40 | IF (1:200)Goat polyclonal |
| Antibody | Anti-β-actin | Sigma-Aldrich | A5316 RRID:AB_476743 | WB (1:5,000) Mouse monoclonal |
| Antibody | Anti-T7 epitope tag | MBL | PM022 RRID:AB_592788 | IP (4 μg); WB (1:1,000)Rabbit polyclonal |
| Antibody | Anti-T7 epitope tag | Novagen | 69522-4 RRID:AB_11211744 | IF (1:200)Mouse monoclonal |
| Antibody | Anti-ubiquitin | Cayman | 14220 | IP (4 μg); WB (1:500)Mouse monoclonal (Clone FK2) |
| Antibody | Anti-gp120 | Abcam | Ab21179 RRID:AB_732949 | FACS (1:150); IF (1:200)Goat polyclonal |
| Antibody | Anti-gp120 | Matsushita et al., 1988 | IF (1:100)Mouse monoclonal (0.5β)kindly provided by S. Matsushita | |
| Antibody | Anti-TGN46 | Abcam | Ab50595 RRID:AB_2203289 | IF (1:200)Rabbit polyclonal |
| Antibody | Anti-VSV-G | Sigma-Aldrich | V5507 RRID:AB_261877 | FACS (1:150)Mouse monoclonal |
| Antibody | Goat anti-mouse IgG conjugated with R-phycoerythrin | Molecular Probes | P-852 RRID:AB_143191 | FACS (1:500) |
| Antibody | Alexa 488 donkey anti-mouse IgG | Molecular Probes | A-21202 RRID:AB_141607 | IF (1:400) |
| Antibody | Alexa 488 donkey anti-goat IgG | Molecular Probes | A-11055 RRID:AB_2534102 | IF (1:400) |
| Antibody | Alexa 568 donkey anti-rabbit IgG | Molecular Probes | A-10042 RRID:AB_2534017 | IF (1:400) |
| Antibody | Alexa 647 donkey anti-goat IgG | Molecular Probes | A-21447 RRID:AB_141844 | FACS (1:500); IF (1:400) |
| Antibody | Alexa 647 donkey anti-mouse IgG | Molecular Probes | A-31571 RRID:AB_162542 | IF (1:400) |
| Antibody | Alexa 647 donkey anti-rabbit IgG | Molecular Probes | A-31573 RRID:AB_2536183 | IF (1:400) |
| Commercial assayor kit | ECL Western blotting detectionsystem | GE Healthcare | RPN2109 | Chemiluminescence |
| Commercial assayor kit | EzWestLumi plus | ATTO | WSE-7120 | Chemiluminescence |
| Chemicalcompound,drug | HBSS | Thermo Fisher | 14025076 | Wash buffer |
| Chemicalcompound,drug | CCF2-AM dye | Invitrogen | K1023 | Fluorescent substrate for BlaM |
| Chemicalcompound,drug | Pluronic F-127 | Invitrogen | P2443 | Nonionic surfactant for CCF2-AM dye |
| Chemicalcompound,drug | Saponin | Sigma-Aldrich | 47036 | Non-ionic surfactant for immunofluorescence |
| Software,algorithm | BD FACS Diva Software | BD Bioscience | ||
| Software,algorithm | GraphPadPrism 8.04 | GraphPad |
Additional files
-
Source data 1
Source Data File for Figures 1B, C, 2C, D and I.
- https://cdn.elifesciences.org/articles/57763/elife-57763-data1-v1.xlsx
-
Source data 2
Figure 1G source data.
Original uncropped images of IP-western blot (ubiquitination assays) in Figure 1G. The PVDF membranes were incubated with an anti-T7-epitope tag antibody, or with an anti-ubiquitin antibody. Images shown in Figure 1G were cropped from the boxed areas, and the brightness/contrast was adjusted equally across the entire image using Photoshop CS6 Figure 2B source data. Original uncropped images of western blot in Figure 2B. The PVDF membrane was incubated with an anti-HA antibody, then stripped and reprobed with an anti-β-actin antibody for a loading control. Images shown in Figure 2B were cropped from the boxed areas, and the brightness/contrast was adjusted equally across the entire image using Photoshop CS6.
- https://cdn.elifesciences.org/articles/57763/elife-57763-data2-v1.pdf
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/57763/elife-57763-transrepform-v1.docx
