cell line (M. musculus) | C2C12 | ATCC | #CRL-1772, RRID:CVCL_0188 | |
cell line (H. sapiens) | HEK293T | ATCC | #CRL-11268, RRID:CVCL_1926 | |
antibody | Anti-MCAT (mouse monoclonal) | Santa Cruz | #sc-390858, RRID:AB_2827536 | WB: (1:100) |
Antibody | Anti-OXSM (rabbit polyclonal) | Thermo Fisher Scientific | #PA5-32132, RRID:AB_2549605 | WB: (1:1000) |
Antibody | Anti-MECR (rabbit polyclonal) | Proteintech | #51027–2-AP, RRID:AB_615013 | WB: (1:1000) |
Antibody | Anti-Lipoic Acid (rabbit polyclonal) | Abcam | #ab58724, RRID:AB_880635 | WB: (1:1000) |
Antibody | Anti-DLAT (rabbit monoclonal) | Abcam | #ab172617, RRID:AB_2827534 | WB: (1:1000) |
antibody | Anti-NDUFAB1 (rabbit polyclonal) | Abcam | #ab96230, RRID:AB_10686984 | WB: (1:1000) |
Antibody | Anti-Flag (rabbit polyclonal) | Sigma-Aldrich | #F7425, RRID:AB_439687 | WB: (1:1000) |
Antibody | Anti-V5 (rabbit polyclonal) | Abcam | #ab9116, RRID:AB_307024 | WB: (1:2,000) |
Antibody | Anti-GRIM19 (mouse monoclonal) | Abcam | #ab110240, RRID:AB_10863178 | WB: (1:1,000) |
Antibody | Anti-SDHA (mouse monoclonal) | Abcam | #ab14715, RRID:AB_301433 | WB: (1:10,000) |
Antibody | Anti-UQCRFS1 (mouse monoclonal) | Abcam | #ab14746, RRID:AB_301445 | WB: (1:1000) |
Antibody | Anti-MTCO1 (mouse monoclonal) | Abcam | #ab14705, RRID:AB_2084810 | WB: (1:1000) |
Antibody | Anti-ATP5a (mouse monoclonal) | Abcam | #ab14748, RRID:AB_301447 | WB: (1:1000) |
Antibody | Anti-NDUFA9 (mouse monoclonal) | Abcam | #ab14713, RRID:AB_301431 | WB: (1:1000) |
Antibody | Anti-SDHB (mouse monoclonal) | Abcam | #ab14714, RRID:AB_301432 | WB:(1:2,000) |
Antibody | Anti-LYRM4 (rabbit polyclonal) | Thermo-Fisher | #PA5-56448 RRID:AB_2643635 | WB:(0.4 µg/mL) |
Antibody | Anti-VDAC (rabbit polyclonal) | Cell Signaling | #4866, RRID:AB_2272627 | WB: (1:1000) |
Antibody | Anti-CS (rabbit polyclonal) | Abcam | #ab96600, RRID:AB_10678258 | WB: (1:1000) |
Antibody | Anti-Lipoic Acid (rabbit polyclonal) | Millipore | #437695, RRID:AB_212120 | WB: (1:1000) |
Antibody | Anti-LIPT1 (rabbit polyclonal) | Sigma-Aldrich | #AV48784, RRID:AB_185290 | WB: (1:1000) |
Antibody | Anti-DLAT (mouse monoclonal) | Cell Signaling | #12362, RRID:AB_279789 | WB: (1:1000) |
Antibody | Anti-DLST (rabbit polyclonal) | Cell Signaling | #5556, RRID:AB_106951 | WB: (1:1000) |
Antibody | Anti-GAPDH (rabbit monoclonal) | Cell Signaling | #8884 RRID:AB_11129865 | WB: (1:2000) |
Antibody | Anti-MHC (mouse monoclonal) | DSHB | #SC-71, RRID:AB_2147165 | WB: (0.2 µg/ml) |
Antibody | Anti-Myogenin (mouse monoclonal) | DSHB | #F5D, RRID:AB_2146602 | WB: (0.5 µg/ml) |
Antibody | Anti-MyoD (mouse monoclonal) | DSHB | #D7F2, RRID:AB_1157912 | WB: (0.5 µg/ml) |
Antibody | Goat Anti-Mouse IgG (H and L) Antibody Dylight 800 Conjugated | Rockland | #610-145-002-0.5, RRID:AB_10703265 | WB:(1:10,000) |
Antibody | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 680 | Invitrogen | #A10043, RRID:AB_2534018 | WB:(1:10,000) |
Antibody | Goat Anti-Mouse IgG (H+L) Antibody, Alexa Fluor 680 Conjugated | Invitrogen | #A21057, RRID:AB_141436 | WB:(1:10,000) |
Antibody | Donkey Anti-Rabbit IgG (H and L) Antibody Dylight 800 Conjugated | Rockland | #611-145-002-0.5, AB_11183542 | WB:(1:10,000) |
Antibody | Goat anti-Mouse IgG (H+L), Superclonal Recombinant Secondary Antibody, HRP | Thermo Fisher Scientific | #A28177, RRID:AB_2536163 | WB:(1:10,000) |
recombinant DNA reagent | pMcat CRISPR sgRNA guide 1 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | GCGCGTCGCAATGAGCGCTC |
recombinant DNA reagent | pMcat CRISPR sgRNA guide 2 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | CGAGGCCGCGCACCGGGTAC |
recombinant DNA reagent | pOxsm CRISPR sgRNA guide 1 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | CTAGTGACACCACTTGGCGT |
recombinant DNA reagent | pOxsm CRISPR sgRNA guide 2 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | CGTTGGGACTCAACTAGTTT |
recombinant DNA reagent | pMecr CRISPR sgRNA guide 1 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | AGGCTTGGTACCGCCACGGC |
recombinant DNA reagent | pMecr CRISPR sgRNA guide 2 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | CGTGGCGGTACCAAGCCTCG |
recombinant DNA reagent | pLipt1 CRISPR sgRNA guide 1 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | CACCGCTTCTAGATGTATGTGGTCG |
recombinant DNA reagent | Lipt1 CRISPR sgRNA guide 2 (plasmid) | This paper | sgRNA cloned in pLentiCRISPRv2 | CACCGCTCCTTCTGTCGTCATCGGC |
recombinant DNA reagent | pLentiCRISPRv2 (plasmid) | Addgene | #52961 RRID:Addgene_52961 | |
recombinant DNA reagent | pLKO.1 shFASN (plasmid) | The Broad Institute | #shRNA TRCN0000075703 | |
recombinant DNA reagent | pshScramble (plasmid) | Addgene | #1864, RRID:Addgene_1864 | |
recombinant DNA reagent | psPAX2 (plasmid) | Addgene | #12259, RRID:Addgene_12259 | |
recombinant DNA reagent | pDM2.G (plasmid) | Addgene | #12260, RRID:Addgene_12260 | |
recombinant DNA reagent | pQXCIP mtDSRed (plasmid) | This paper | | mtDSRed in pQXCIP backbone |
recombinant DNA reagent | pQXCIP-Δ4,5CMV-mMcat (plasmid) | This paper | | Mouse Mcat with truncated CMV promoter in pQXCIP backbone |
recombinant DNA reagent | pQXCIP-CMV-mMcat (plasmid) | This paper | | Mouse Mcat with full CMV promoter in pQXCIP backbone |
recombinant DNA reagent | pQXCIP-CMV-mOxsm (plasmid) | This paper | | Mouse Oxsm with full CMV promoter in pQXCIP backbone |
recombinant DNA reagent | pQXCIP-Δ4,5CMV-mMecr (plasmid) | This paper | | Mouse Mecr with truncated CMV promoter in pQXCIP backbone |
recombinant DNA reagent | pQXCIP-CMV-mMecr (plasmid) | This paper | | Mouse Mecr with full CMV promoter in pQXCIP backbone |
sequence-based reagent | Mcat CRISPR Ver Fwd | This paper | PCR primers | GACCGACATGCAACTGCAAATAG |
sequence-based reagent | Mcat CRISPR Ver Rev | This paper | PCR primers | GGCCAGTGAAGCCACAAAGA |
sequence-based reagent | Oxsm CRISPR Ver Fwd | This paper | PCR primers | CAACCATGTTGTCAAAATGCTTG |
sequence-based reagent | Oxsm CRISPR Ver Rev | This paper | PCR primers | GGTCTGAAACAGCAAAGCAGTTTC |
sequence-based reagent | Mecr CRISPR Ver Fwd | This paper | PCR primers | GCTGTCGCGGACGAATG |
sequence-based reagent | Mecr CRISPR Ver Rev | This paper | PCR primers | GTCGGAAGCATCCACTGAGAC |
commercial assay or kit | TruSeq Stranded mRNA Library Prep kit | Illumina | #20020595 | |
commercial assay or kit | TruSeq RNA UD Indexes | Illumina | #20022371 | |
commercial assay or kit | NovaSeq S1 reagent Kit | Illumina | #20027465 | |
commercial assay or kit | Kapa Library Quant Kit | Kapa Biosystems | #KK4824 | |
commercial assay or kit | Pierce BCA Assay | Thermo | #23225 | |
commercial assay or kit | D1000 ScreenTape assay | Agilent Technologies | 5067–5583 | |
chemical compound, drug | [U-13C]glutamine | Cambridge Isotopes | #CLM-1822 | |
chemical compound, drug | [U-13C]glucose | Cambridge Isotopes | #CLM-1396 | |
chemical compound, drug | Digitonin | GoldBio | #D-180–2.5 | |
chemical compound, drug | SPLASH Lipidomix | Avanti Polar Lipids | #330707 | |
software, algorithm | Agilent Mass Hunter Qual B.07.00 | Agilent | https://www.agilent.com/en/products/software-informatics/masshunter-suite/masshunter/masshunter-software | |
software, algorithm | Agilent Mass Hunter Quant B.07.00 | Agilent | https://www.agilent.com/en/products/software-informatics/masshunter-suite/masshunter/masshunter-software | |
software, algorithm | Lipid Annotator | Agilent | https://www.agilent.com/en/products/software-informatics/mass-spectrometry-software/data-analysis/mass-profiler-professional-software | |
software, algorithm | MetaboAnalyst 4.0 | Xia and Wishart, 2016 | http://www.metaboanalyst.ca | |
Other | Lipofectamine 2000 transfection reagent | Invitrogen | 11668019 | |