BLOS1 mediates kinesin switch during endosomal recycling of LDL receptor
- State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, China
- Beijing Key Laboratory for Genetics of Birth Defects, Beijing Pediatric Research Institute; MOE Key Laboratory of Major Diseases in Children; Genetics and Birth Defects Control Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, China
- University of Chinese Academy of Sciences, China
Figures
Figure 1 with 1 supplement
Mice with hepatocyte-specific deletion of BLOS1 showed abnormal lipid metabolism.
(a, b) Immunoblot of the destabilized BLOC-1 subunits (Pallidin and Dysbindin) in lysates of liver (a) and purified primary hepatocytes (b) from loxp and cKO mice. The loxp heterozygous mice in (b) …
-
Figure 1—source data 1
Full image of CBB staining showing the comparison of control and cKO mice plasma proteins.
Representative figure of CBB staining result of control and cKO mouse plasma proteins separated by SDS-PAGE. Arrow indicates the protein band which was further verified as apoE.
- https://cdn.elifesciences.org/articles/58069/elife-58069-fig1-data1-v2.pptx
Figure 1—figure supplement 1
Generation of cKO mice and the abnormal plasma lipoprotein level in cKO mice.
(a) Breeding strategy for the generation and maintaining of loxp and cKO mice littermates which were used in subsequent experiments. (b) Genotyping of hepatocytes of loxp and cKO mice. a and b …
Figure 2 with 1 supplement
BLOS1 regulates LDLR membrane trafficking and interacts with LDLR.
(a) Endocytosis of DiI-labeled LDL in primary hepatocytes from loxp and cKO mice after indicated time points. Scale bars, 10 μm. (b) Average intensity of LDL-DiI signal after endocytosis in loxp (n =…
Figure 2—figure supplement 1
Reduced LDLR in cKO mice and LDLR interacting region mapping on BLOS1.
(a) Immunoblots of ApoB proteins in the plasma of loxp and cKO mice. (b) Immunoblots of LDLR (with another LDLR antibody) and PCSK9 in loxp and cKO mice livers. (c) Representative confocal images of …
Figure 3
BLOS1 localizes to microtubules and interacts with kinesin motors.
(a) Representative confocal images of puncta patterns of BLOS1-GFP-C2 and immunofluorescence stained BLOS1-HA in Hep G2 cells. (b–f) BLOS1 partially colocalizes with multivesicular body/lysosome …
Figure 4 with 6 supplements
KIF13A transports recycling endosome-resident LDLR.
(a) Representative confocal images showing different distribution patterns of endogenous LDLR (green) in mouse primary hepatocytes and Hep G2 cells. Microtubules were co-labeled with α-tubulin (red) …
-
Figure 4—source data 1
KIF13A transport LDLR to cell periphery in both control and cKO hepatocytes.
(a) Representative confocal image showing the periphery accumulation of LDLR (red) after KIF13A-GFP (green) expression in control primary hepatocytes. (b) Representative confocal image showing the periphery accumulation of LDLR (red) after KIF13A-GFP (green) expression in cKO primary hepatocytes. Magnified insets of boxed areas are shown on bottom. Bar = 10 µm.
- https://cdn.elifesciences.org/articles/58069/elife-58069-fig4-data1-v2.pptx
Figure 4—figure supplement 1
LDLR locates on multiple endocytic compartments in Hep G2 cells.
(a) Representative confocal image of the well colocalization of LDLR and clathrin-coated vesicles (indicated by Clta-GFP) in primary hepatocytes. Magnified insets of boxed areas are shown on the …
Figure 4—figure supplement 2
KIF13A and its rigor mutant do not affect lysosome distribution.
(a) Representative confocal image showing KIF13A-R distributes along a proportion of microtubules (indicated by α-Tubulin). (b) Representative confocal image showing that overexpressed full-length …
Figure 4—video 1
Live-cell imaging of Hep G2 cells transfected with KIF13A-R-Scarlet and RE marker RAB11A-GFP.
Cells were recorded every 1 s for 120 s. Panels on the right show magnified views of the boxed region. Note those almost static REs on KIF13A-R tubules during the imaging period.
Figure 4—video 2
Live-cell imaging of Hep G2 cells transfected with KIF13A-R-GFP and then incubated with Dextran-TMR (molecular weight = 10,000) to label lysosomes.
Cells were recorded every 1 s. Boxed areas were enlarged and showed on right.
Figure 4—video 3
Live-cell imaging of Hep G2 cells transfected with LDLR-GFP and Rab11a-Scarlet.
Cells were recorded every 0.54 s. Actively moving Rab11a-positive recycling endosomes which were also labeled by LDLR were indicated by arrows.
Figure 4—video 4
Live-cell imaging of Hep G2 cells transfected with KIF13A-GFP and Rab11a-Scarlet.
Cells were recorded every 0.2 s. Note the active transport of recycling endosomes in this cell, which was opposite to what we have observed in KIF13A-R expressing cells.
Figure 5 with 2 supplements
BLOS1 acts as an adaptor protein of KIF3 complex in the regulation of RE anterograde transport.
(a) Immunofluorescence staining of LDLR in KIF3B-FLAG expressing Hep G2 cells. Merged and single labeling images of magnified insets of boxed areas are shown on right. (b) Puncta distribution of …
-
Figure 5—source data 1
KIF3A distributes evenly in primary hepatocytes.
Representative confocal images of non-puncta and even distribution pattern of overexpressed KIF3A-Scarlet (red) in mouse primary hepatocytes. Bar = 10 µm.
- https://cdn.elifesciences.org/articles/58069/elife-58069-fig5-data1-v2.pptx
Figure 5—video 1
Live-cell imaging of Hep G2 cells transfected with (or without) KIF3B-R-Scarlet and RE marker RAB11A-GFP.
Cells were recorded every 1 s for 120 s. Panels on the right show magnified views of REs in boxed region. Note the active movement of REs in cells without KIF3B-R expression (top right) and impaired …
Figure 5—video 2
Live-cell imaging of Hep G2 cells transfected with KIF3B-R-GFP and then incubated with Dextran-TMR (molecular weight = 10,000) to label lysosomes.
Non-transfected cells with Dextran-TMR incubation were used as control. Cells were recorded every 1 s. Boxed areas were enlarged and showed by covering the original pictures.
Figure 6 with 6 supplements
KIF3 is essential for the long-range anterograde transport of REs driven by KIF13A.
(a–c) Confocal live-cell microscopy of RAB11A-GFP labeled recycling endosomes in control (a), KIF3A-KD (b) and BLOC1S1-KD (c) cells (see also Figure 6—videos 1 and 2). Magnified insets (of boxed …
Figure 6—figure supplement 1
KIF3 and KIF13A bind to the same set of microtubule tracks with acetylation tubulin.
(a) Representative confocal image of microtubules (stained by α-Tubulin) in control and KIF3A-KD cells. (b) Quantification of the microtubule growth rate (indicated by the movement of EB1-GFP …
Figure 6—video 1
Live-cell imaging of REs in control and KIF3A-KD cells.
Control (left) and KIF3A-KD (right) cells expressing RAB11A-GFP (grayscale) were recorded every 1 s for 120 s. Representative RE vesicles are outlined by circles with distinct color and trajectories …
Figure 6—video 2
Live-cell imaging of REs in BLOC1S1-KD cells.
Images were acquired and processed as described in Figure 6—video 1.
Figure 6—video 3
Live-cell imaging of KIF13A tubules in control and KIF3A-KD cells.
Control (left) and KIF3A-KD (right) cells expressing KIF13A-GFP were recorded every 1 s for 120 s. Boxed regions in control and KIF3A-KD cells are magnified and showed in the latter part of the …
Figure 6—video 4
Live-cell imaging of Hep G2 cells transfected with KIF13A-GFP and KIF3B-R-Scarlet.
Cells were recorded every 0.5 s. Panels on the right show magnified views of the boxed region. KIF13A tubules with repeated forward and backward movement were indicated by arrow.
Figure 6—video 5
Live-cell imaging of microtubule dynamics in control (left) and KIF3A-KD (right) cells.
The (+) tips of microtubules were labeled with EB1-GFP, and the movement of these EB1-GFP tips were recorded every 1 s for 120 s.
Figure 7 with 4 supplements
KIF3 and BLOS1 function at specific microtubule intersections.
(a) Schematic of tip of one KIF13A-GFP tubule encounters another KIF13A-GFP tubule. (b) Histogram showing the occurrence of extension and retraction action when tips of KIF13A tubule encounter other …
Figure 7—figure supplement 1
BLOS1 also showed puncta pattern in primary hepatocytes and locates near microtubule intersections.
(a) Overexpressed BLOS1-GFP (green) showed both tubular and puncta distribution in primary hepatocytes. (b) A proportion of BLOS1 puncta (green) locate near the intersections of microtubules …
Figure 7—video 1
3D-reconstruction of super-resolution Z-stack images of BLOS1-HA (green) and alpha-tubulin (red).
Z-stacks images were acquired every 170 nm for a total of 50 slices.
Figure 7—video 2
Live-cell imaging of recycling endosomes (indicated by RAB11A-GFP) moving on microtubule tracks (stained by Tubulin Tracker Deep Red probe) showing the passage of recycling endosomes after pausing at specific microtubule intersections.
Arrows indicate intersections where recycling endosomes (marked with magenta circles) pause and then go through. Images were acquired with Zeiss LSM 880 using the Airyscan module with line mode, and …
Figure 7—video 3
Live-cell imaging of recycling endosomes (indicated by RAB11A-GFP) moving on microtubule tracks (stained by Tubulin Tracker Deep Red probe) showing the reversed movement of recycling endosomes at specific microtubule intersections.
Arrows indicate intersections where recycling endosomes (marked with magenta circles) pause and then reversed their moving directions. Images were acquired with Zeiss LSM 880 using the Airyscan …
Figure 8 with 2 supplements
A proposed model of how BLOS1 coordinates kinesin-3 and kinesin-2 at microtubule intersections.
KIF13A drives the generation and extension of tubules at the initial peripheral transport of recycling endosomes (REs) from the endocytic recycling compartment (ERC). When REs (and associated LDLR) …
Figure 8—video 1
Live-cell imaging of BLOS1-GFP puncta showing the frequent z-position change of BLOS1 puncta during recording period.
Two typical BLOS1 puncta are marked by dashed circles, and their intensity profiles are plotted on the right. Arrows indicate the time points at which BLOS1 puncta are in focus and show higher …
Figure 8—video 2
Live-cell imaging of BLOS1-GFP in Hep G2 cells stained with Tubulin-Tracker (Thermo Fisher).
Two Panels (A and B) on the right show magnified views of two representative regions. The time interval between every two frames was 0.14 s.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Kxd1-KO | Prepared in our lab (Yang et al., 2012) | ||
| Genetic reagent (M. musculus) | pa | The Jackson Laboratory | JAX: 000024; RRID:IMSR_JAX:000024 | |
| Genetic reagent (M. musculus) | Alb-Cre | Model animal research center of Nanjing university | RRID:IMSR_JAX:003574 | Derived from The Jackson Laboratory |
| Genetic reagent (M. musculus) | loxp | Prepared in our lab (Zhang et al., 2014) | ||
| Genetic reagent (M. musculus) | Bloc1s1-cKO | This paper | ||
| Strain, strain background (Escherichia coli) | BL21(DE3) | Vazyme | C504 | Chemical competent cells |
| Strain, strain background (Escherichia coli) | DH5α | Vazyme | C502 | Chemical competent cells |
| Cell line (Homo-sapiens) | Hep G2 | Cell bank of Chinese Academy of Sciences (Shanghai, China) | Cat#TCHu72; RRID:CVCL_0027 | Has been authenticate by STR profiling and tested negative for mycoplasma in cell bank |
| Cell line (Homo-sapiens) | HEK293T | Cell bank of Chinese Academy of Sciences (Shanghai, China) | Cat#GNHu17; RRID:CVCL_0063 | Has been authenticate by STR profiling and tested negative for mycoplasma in cell bank |
| Biological sample (M. musculus) | Primary mouse hepatocytes | This paper | Freshly isolated from mouse liver | |
| Antibody | Mouse monoclonal anti-alpha Tubulin (clone DM1A) | Abcam | Cat#ab7291;RRID:AB_2241126 | IF (1:500) |
| Antibody | Rabbit polyclonal anti-alpha Tubulin | Abcam | Cat#ab18251; RRID:AB_2210057 | IF (1:1000) |
| Antibody | Rabbit polyclonal anti-Transferrin Receptor | Abcam | Cat#ab84036; RRID:AB_10673794 | IF (1:200), WB (1:2000) |
| Antibody | Rabbit polyclonal anti-LDL Receptor | Abcam | Cat#ab30532; RRID:AB_881272 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-LDL Receptor (clone EP1553Y) | Abcam | Cat#ab52818; RRID:AB_881213 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-PCSK9 | Abcam | Cat#ab31762; RRID:AB_777140 | WB (1:1000) |
| Antibody | Goat polyclonal anti-HA tag antibody | Abcam | Cat#ab9134; RRID:AB_307035 | IF (1:1000), WB (1:5000) |
| Antibody | Rat monoclonal anti-mouse IgG for IP (HRP) | Abcam | Cat#ab131368; N/A | WB (1:5000) |
| Antibody | Donkey anti-rabbit Alexa Fluor 405 | Abcam | Cat#ab175649; AB_2715515 | IF (1:1000) |
| Antibody | Mouse monoclonal anti-EEA1 (clone 14) | BD | Cat#610457; RRID:AB_397830 | IF (1:500) |
| Antibody | Mouse monoclonal anti-Cytochrome C (clone 6H2.B4) | BD | Cat#556432; RRID:AB_396416 | IF (1:250) |
| Antibody | Mouse monoclonal anti-CD63 (clone H5C6) | BD | Cat#556019; RRID:AB_396297 | IF (1:200) |
| Antibody | Goat polyclonal anti-mouse LDL Receptor | R and D | Cat#AF2255; RRID:AB_355203 | IF (1:100) |
| Antibody | Goat polyclonal anti-human LDL Receptor | R and D | Cat#AF2148; RRID:AB_2135126 | IF (1:100) |
| Antibody | Mouse monoclonal anti-beta Actin (clone AC-15) | Sigma-Aldrich | Cat#A5441; RRID:AB_476744 | WB (1:50000) |
| Antibody | Mouse monoclonal ant-Acetylated Tubulin antibody (clone 6-11B-1) | Sigma-Aldrich | Cat#T7451; RRID:AB_609894 | IF (1:200) |
| antibody | Mouse monoclonal anti-FLAG tag antibody (clone M2) | Sigma-Aldrich | Cat#F3165; RRID:AB_259529 | IF (1:1000), WB (1:5000) |
| Antibody | Rabbit polyclonal anti-FLAG tag antibody | Sigma-Aldrich | Cat#F7425; RRID:AB_439687 | IF (1:1000) |
| Antibody | Rat monoclonal anti-Tyrosinated Tubulin antibody (clone YL1/2) | Millipore | Cat#MAB1864; RRID:AB_2210391 | IF (1:200) |
| Antibody | Rabbit monoclonal anti-KIF3A antibody (clone D7G3) | Cell Signaling Technology | Cat#8507; RRID:AB_11141049 | WB (1:1000) |
| Antibody | Rabbit polyclonal anti-KIF13A antibody | Bethyl Laboratories | Cat#A301-077A; RRID:AB_873053 | WB (1:1000) |
| Antibody | Rabbit polyclonal anti-Myc tag antibody | MBL | Cat#562; RRID:AB_591105 | IF (1:500) |
| Antibody | Mouse monoclonal anit-Myc tag antibody (clone Myc3) | MBL | Cat#M192-3S; RRID:AB_11161202 | IF (1:500), WB (1:2000) |
| Antibody | Mouse monoclonal anti-HA tag antibody (clone F-7) | Santa Cruz | Cat#sc-7392; RRID:AB_627809 | IF (1:100) |
| Antibody | Mouse monoclonal anti-GST antibody (clone B-14) | Santa Cruz | Cat#sc-138; RRID:AB_627677 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-Pallidin antibody | Proteintech | Cat#10891–2-AP; RRID:AB_2164174 | WB (1:2000) |
| Antibody | Rabbit polyclonal anti-Dysbindin antibody | Prepared in our lab Wang et al., 2014 | N/A | WB (1:20000) |
| Antibody | Donkey anti-mouse Alexa Fluor 488 | ThermoFisher | Cat#A-21202; RRID:AB_141607 | IF (1:1000) |
| Antibody | Donkey anti-mouse Alexa Fluor 594 | ThermoFisher | Cat#A-21203; RRID:AB_2535789 | IF (1:1000) |
| Antibody | Donkey anti-Rabbit Alexa Fluor 488 | ThermoFisher | Cat#A-21206; RRID:AB_2535792 | IF (1:1000) |
| Antibody | Donkey anti-Rabbit Alexa Fluor 594 | ThermoFisher | Cat#A-21207; RRID:AB_141637 | IF (1:1000) |
| Antibody | Donkey anti-Goat Alexa Fluor 488 | ThermoFisher | Cat#A-11055; RRID:AB_2534102 | IF (1:1000) |
| Antibody | Donkey anti-Goat Alexa Fluor 594 | ThermoFisher | Cat#A-11058; RRID:AB_2534105 | IF (1:1000) |
| Recombinant DNA reagent | BLOS1-GFP-C2 (plasmid) | This paper | ||
| Recombinant DNA reagent | BLOS1-GFP-N2 | This paper | ||
| Recombinant DNA reagent | BLOS1-FLAG | This paper | ||
| Recombinant DNA reagent | BLOS1-Myc | This paper | ||
| Recombinant DNA reagent | BLOS1-HA | This paper | ||
| Recombinant DNA reagent | GST-BLOS1 | This paper | ||
| Recombinant DNA reagent | RAB11A-GFP-C2 | This paper | ||
| Recombinant DNA reagent | RAB11A-Scarlet-C2 | This paper | ||
| Recombinant DNA reagent | KIF13A-FLAG | This paper | ||
| Recombinant DNA reagent | KIF13A-GFP-N2 | This paper | ||
| Recombinant DNA reagent | KIF13A-ST-GFP-N2 | This paper | ||
| Recombinant DNA reagent | KIF13A-HA | This paper | ||
| Recombinant DNA reagent | KIF13A-R-HA | This paper | ||
| Recombinant DNA reagent | KIF13A-R-Scarlet-N2 | This paper | ||
| Recombinant DNA reagent | KIF3B-Myc | This paper | ||
| Recombinant DNA reagent | KIF3B-R-Myc | This paper | ||
| Recombinant DNA reagent | KIF3B-R-Scarlet-N2 | This paper | ||
| Recombinant DNA reagent | KIF3A-FLAG | This paper | ||
| Recombinant DNA reagent | KIF3A-R-FLAG | This paper | ||
| Recombinant DNA reagent | KIF3C-HA | This paper | ||
| Recombinant DNA reagent | KIF3C-R-HA | This paper | ||
| Recombinant DNA reagent | KAP3-HA | This paper | ||
| Recombinant DNA reagent | KIF5B-R-Myc | This paper | ||
| Recombinant DNA reagent | KIF16B-FLAG | This paper | ||
| Recombinant DNA reagent | KIF3A-FLAG-KIF3B-Myc-BLOS1-HA | This paper | ||
| Sequence-based reagent | LDLR_1F | This paper | RT-PCR primers | GTCTTGGCACTGGAACTCGT |
| Sequence-based reagent | LDLR_1R | This paper | RT-PCR primers | CTGGAAATTGCGCTGGAC |
| Sequence-based reagent | LDLR-2F | This paper | RT-PCR primers | ACGGCGTCTCTTCCTATGACA |
| Sequence-based reagent | LDLR-2R | This paper | RT-PCR primers | CCCTTGGTATCCGCAACAGA |
| Sequence-based reagent | GAPDH-F | This paper | RT-PCR primers | GGAGCGAGATCCCTCCAAAAT |
| Sequence-based reagent | GAPDH-R | This paper | RT-PCR primers | GGCTGTTGTCATACTTCTCATGG |
| Sequence-based reagent | KIF13A-R-F | This paper | Site-directed mutagenesis primers | GAGCCTGGTAGACCTGGCGGCGAGCGAGAGAGTGTCGAAGAC |
| Sequence-based reagent | KIF13A-R-R | This paper | Site-directed mutagenesis primers | GTCTTCGACACTCTCTCGCTCGCCGCCAGGTCTACCAGGCTC |
| Sequence-based reagent | KIF3B-R-F | This paper | Site-directed mutagenesis primers | CTGAATCTTGTAGATCTTGCTGCCAGTGAGCGGCAAGCCAAG |
| Sequence-based reagent | KIF3B-R-R | This paper | Site-directed mutagenesis primers | CTTGGCTTGCCGCTCACTGGCAGCAAGATCTACAAGATTCAG |
| Sequence-based reagent | KIF3C-R-F | This paper | Site-directed mutagenesis primers | GTAGACCTGGCCGCCAGTGAGAGACAG |
| Sequence-based reagent | KIF3C-R-R | This paper | Site-directed mutagenesis primers | CTGTCTCTCACTGGCGGCCAGGTCTAC |
| Sequence-based reagent | KIF5B-R-F | This paper | Site-directed mutagenesis primers | CTGGTTGATTTAGCTGCTAGTGAAAAGGTTAG |
| Sequence-based reagent | KIF5B-R-R | This paper | Site-directed mutagenesis primers | CTAACCTTTTCACTAGCAGCTAAATCAACCAG |
| Sequence-based reagent | MfeI-F | This paper | Site-directed mutagenesis primers for pSilencer 5.1-H1 Retro vector | ATGGAGGACCCCAATGCCAAGG |
| Sequence-based reagent | MfeI-R | This paper | Site-directed mutagenesis primers for pSilencer 5.1-H1 Retro vector | CCGAGTGGCTGTGGCTTCC |
| Sequence-based reagent | BLOS1-1F | This paper | shRNA template primers | gatccgTCGGAATGGTGGAGAACTTgagaAAGTTCTCCACCATTCCGAttttttggaaa |
| Sequence-based reagent | BLOS1-1R | This paper | shRNA template primers | agcttttccaaaaaaTCGGAATGGTGGAGAACTTtctcAAGTTCTCCACCATTCCGAcg |
| Sequence-based reagent | BLOS1-2F | This paper | shRNA template primers | gatccGCACTGGAATATGTCTACAgagaTGTAGACATATTCCAGTGCttttttggaaa |
| Sequence-based reagent | BLOS1-2R | This paper | shRNA template primers | agcttttccaaaaaaGCACTGGAATATGTCTACAtctcTGTAGACATATTCCAGTGCg |
| Sequence-based reagent | BLOS1-3F | This paper | shRNA template primers | gatccgCAGAAGCTTTGGTGGATCAgagaTGATCCACCAAAGCTTCTGttttttggaaa |
| Sequence-based reagent | BLOS1-3R | This paper | shRNA template primers | agcttttccaaaaaaCAGAAGCTTTGGTGGATCAtctcTGATCCACCAAAGCTTCTGcg |
| Sequence-based reagent | KIF13A-1F | This paper | shRNA template primers | cggGGAAACCTCCCAAGGTATTTGgagaCAAATACCTTGGGAGGTTTCCtttttga |
| Sequence-based reagent | KIF13A-1R | This paper | shRNA template primers | agcttCAAAAAGGAAACCTCCCAAGGTATTTGtctcCAAATACCTTGGGAGGTTTCC |
| Sequence-based reagent | KIF13A-2F | This paper | shRNA template primers | ccggTTAACGAACTTCTGGTTTATTgagaAATAAACCAGAAGTTCGTTAAtttttga |
| Sequence-based reagent | KIF13A-2R | This paper | shRNA template primers | agcttCAAAAATTAACGAACTTCTGGTTTATTtctcAATAAACCAGAAGTTCGTTAA |
| Sequence-based reagent | KIF3A-1F | This paper | shRNA template primers | ccggCGTCAGTCTTTGATGAAACTAgagaTAGTTTCATCAAAGACTGACGtttttga |
| Sequence-based reagent | KIF3A-1R | This paper | shRNA template primers | agcttCAAAAACGTCAGTCTTTGATGAAACTAtctcTAGTTTCATCAAAGACTGACG |
| Sequence-based reagent | KIF3A-2F | This paper | shRNA template primers | ccggGCCTGTTTGAACACATTCTAAgagaTTAGAATGTGTTCAAACAGGCtttttga |
| Sequence-based reagent | KIF3A-2R | This paper | shRNA template primers | agcttCAAAAAGCCTGTTTGAACACATTCTAAtctcTTAGAATGTGTTCAAACAGGC |
| Sequence-based reagent | KIF3A-3F | This paper | shRNA template primers | ccggCGGGATTATCAGGAAATGATTgagaAATCATTTCCTGATAATCCCGtttttga |
| Sequence-based reagent | KIF3A-3R | This paper | shRNA template primers | agcttCAAAAACGGGATTATCAGGAAATGATTtctcAATCATTTCCTGATAATCCCG |
| Peptide, recombinant protein | Streptavidin | Thermo Fisher | Cat. #: 434302 | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | BIO-RAD | 1708891 | |
| Commercial assay or kit | RNeasy Mini Kit | QIAGEN | 74104 | |
| Commercial assay or kit | ClonExpress II One Step Cloning Kit | Vazyme | C112 | |
| Chemical compound, drug | Puromycin | InvivoGen | ant-pr-1 | |
| Chemical compound, drug | Leupeptin | Sigma-Aldrich | L5793 | |
| Chemical compound, drug | Oil Red O | Sigma-Aldrich | O9755 | |
| Chemical compound, drug | Sudan Black B | Sigma-Aldrich | 199664 | |
| Chemical compound, drug | 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) | Sigma-Aldrich | 42364 | |
| Software, algorithm | Fiji | http://fiji.sc/; Schindelin et al., 2012 | RRID:SCR_002285 | Version 2.0.0-rc-69/1.52 n |
| Other | Minimal Essential Medium (MEM) | GE Healthcare | SH30024.01 | |
| Other | Glutathione Sepharose 4B resin | GE Healthcare | 17075601 | |
| Other | Collagen, Type I | Sigma-Aldrich | C3867 | |
| Other | Collagenase, TypeIV | Sigma-Aldrich | C5138 | |
| Other | Anti-FLAG M2 affinity gel | Sigma-Aldrich | A2220 | |
| Other | Phalloidin Alexa Fluor 594 | ThermoFisher | A12381 | |
| Other | Prolong Gold Antifade Mountant | ThermoFisher | P36935 | |
| Other | Lipofectamine 3000 | ThermoFisher | L3000015 | |
| Other | Sodium pyruvate | ThermoFisher | 11360070 | |
| Other | MEM Non-Essential Amino Acids | ThermoFisher | 11140050 | |
| Other | Tubulin Tracker Deep Red | ThermoFisher | T34076 | |
| Other | jetPEI-Hepatocyte | Polyplus | 102–05N |
-
Note: The listed references in this table can be referred to the reference list in main text.
