Seizures are a druggable mechanistic link between TBI and subsequent tauopathy
- Centre for Prions & Protein Folding Disease, University of Alberta, Canada
- Department of Medical Genetics, University of Alberta, Canada
- Majmaah University, Saudi Arabia
- Department of Biological Sciences, University of Alberta, Canada
- Department of Biochemistry, University of Alberta, Canada
- Department of Neurology, University of Pittsburgh, United States
- Geriatric Research, Education and Clinical Center, Pittsburgh VA Healthcare System, United States
Figures
Figure 1 with 3 supplements
Validating tauopathy fluorescent biosensor in vitro and in zebrafish.
The biosensor Tau4R-GFP was validated for its ability to detect tauopathy seeds in vitro and in zebrafish. (A) Schematic of Tau4R-GFP ‘Tau biosensor’ that contains the four binding repeats (4R) …
Figure 1—figure supplement 1
Quantification GFP+ inclusions in HEK cells expressing Tau4R-GFP biosensor.
(A) Schematic of genetically encoded fluorescent Tau4R-GFP ‘Tau Biosensor’ which was produced by fusing the C-terminal four binding repeats (4R) region of wild-type human Tau (Tau4R) to GFP via a …
Figure 1—figure supplement 2
Quantification GFP+ inclusions in CNS of zebrafish expressing Tau4R-GFP biosensor, following injection of human Tau into the zebrafish hindbrain ventricle.
(A) Schematic showing the microinjections of mouse brain homogenate into the brain ventricles of zebrafish larvae (age is 2 days post-fertilization). Injected material was brain homogenate from …
Figure 1—figure supplement 3
Movement of some Tau puncta over time following injection of zebrafish larvae with brain homogenate burdened with human tauopathy.
(A) Images of the zebrafish brain area, after injection with Tg hTau+/p301L mouse brain homogenate, for the same zebrafish larvae over 3 consecutive days post-injection (dpi), showing the movement …
Figure 2
Protein-only induction of Tau puncta in vivo detected in biosensor zebrafish.
Injections of synthetic Tau fibrils into Tau4R-GFP zebrafish induced GFP+ puncta in brains and spinal cord. (A,B) Inhibiting the proteosome with MG-132 enhanced the percentage of larvae bearing GFP+ …
Figure 3 with 1 supplement
Zebrafish larvae subjected to traumatic brain injury (TBI) exhibited various biomarkers of TBI.
(A) A novel TBI model for larval zebrafish: to induce blast injury, zebrafish larvae were loaded into a syringe with a stopper. A defined weight was dropped on the syringe plunger from a defined …
Figure 3—figure supplement 1
Traumatic brain injury (TBI)-induced cell death.
Some data copied from Figure 3F here for ease of reference. Increased cell death in the brain of 4 dpf larvae subjected to TBI as indicated by immunostaining of activated Caspase-3 (magenta). Larvae …
Figure 4
Neural activity increases during traumatic brain injury (TBI) as measured in CaMPARI zebrafish larva.
(A) Schematic of TBI using CaMPARI (Calcium Modulated Photoactivatable Ratiometric Integrator) to optogenetically quantify neuronal excitability. Three dpf CaMPARI larvae were freely swimming while …
Figure 5 with 5 supplements
Traumatic brain injury (TBI) induces tauopathy in larval zebrafish.
(A) GFP+ Tau puncta are detected in the brain of Tau4R-GFP biosensor zebrafish at 5 days post-traumatic brain injury (dpti). A 300 g weight was used to induce TBI throughout this figure. (B) Tau …
Figure 5—figure supplement 1
Traumatic brain injury (TBI) did not induce GFP+ puncta in transgenic zebrafish larvae expressing SOD1-GFP.
(A, B) TBI did not induce GFP+ puncta in larvae expressing SOD1-GFP, and appeared similar to control larvae that did not experience TBI. (C) Quantification of GFP+ puncta in the spinal cord of …
Figure 5—figure supplement 2
Longitudinal analysis of individual fish after traumatic brain injury (TBI) shows various patterns of TAu inclusion formation and clearance in their brains.
(A) In the control group (no TBI) the majority of Tau4R-GFP biosensor larvae did not develop GFP+ aggregates in the brain, although a few either developed aggregates at later time point (3dpi), or …
Figure 5—figure supplement 3
Longitudinal analysis of individual fish after traumatic brain injury (TBI) shows various patterns of Tau inclusion formation and clearance in their spinal cords.
(A) Exemplar data from the control group (no TBI) wherein many of the Tau4R-GFP biosensor larvae did not develop aggregates in the spinal cord, while a few either developed aggregates at later …
Figure 5—figure supplement 4
Increasing intensity of traumatic brain injury (TBI) significantly increased Tau4R-GFP puncta abundance, but only modest insignificant increases in Tau puncta were observed with an increasing number of successive brain injuries.
(A) Following TBI of Tau4R-GFP larvae, the GFP+ aggregates in the brain tended to be fused. (B,C) Tau4R-GFP larvae were subjected to TBI via either one single hit or five consecutive hits. The …
Figure 5—figure supplement 5
Intensifying seizures following traumatic brain injury (TBI) increased abundance of GFP+ Tau puncta in a dose-dependent manner.
Tau4R-GFP larvae were subjected to TBI and post-traumatic seizures were intensified by addition of the convulsant kainate. Although kainate treatment alone (without TBI) did not appreciably increase …
Figure 6 with 1 supplement
Tauopathy induced by traumatic brain injury (TBI) was attenuated by 4-aminopyridine (4-AP) via mechanisms independent of seizures.
(A) Tau4R-GFP biosensor zebrafish larvae subjected to TBI and treated with the convulsant 4-AP show no brain puncta. Scale bar = 200 μm. (B) 4-AP significantly reduced (apparently eliminated) the …
Figure 6—figure supplement 1
4-Aminopuridine (4-AP) abrogates TBI-induced Tau aggregates when applied at various doses or for various times.
(A) Tau4R-GFP biosensor zebrafish larvae subjected to TBI and treated with the convulsant 4-AP show no brain puncta. 4-AP was added to the TBI larvae 1 day post-traumatic brain injury (dpti) and …
Figure 7
Graphical summary: anticonvulsants reverse the tauopathy and cell death exhibited by zebrafish larvae following traumatic brain injury (TBI).
Tauopathy was reported via aggregation of a genetically encoded chimeric protein, Tau4R-GFP, that was expressed throughout the central nervous system. TBI led to seizures, and subsequently to Tau …
Videos
Video 1
TBI-induced blood flow abnormalties.
Video 2
TBI-induced seizures and blood flow abnormalities.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain (zebrafish) | Tg(eno2:hsa.MAPT-ires-egfp)Pt406 | Burton’s Lab (Bai et al., 2007) | ZFIN ID: ZDB-ALT-080122–6 | Zebrafish that express human four repeat TAU |
| Strain (zebrafish) | Tg(eno2:SOD1-GFP) ua3181 | This paper | N/A | zebrafish biosensor engineered to detect human SOD1 aggregation |
| Strain (zebrafish) | Tg[elavl3:CaMPARI (W391F+V398L)]ua1344 | In house allele (Kanyo et al., 2020b) established using vector provided by Eric Schreiter’s lab | zebrafish expressing the calcium sensor CaMPARI | |
| Strain (Zebrafish) | Tg(eno2:Hsa.MAPT_Q244-E372−EGFP)ua3171 | This paper | N/A | Zebrafish biosensor engineered to detect human Tau aggregation |
| Genetic reagents (zebrafish) | Multisite Gateway technology (BP Clonase II Enzyme mix and LR Clonase II Plus enzyme) | Thermo Fisher | Cat# 11789020 Cat# 12538120 ZFIN ID: ZDB-PUB-170809–10 | Guo and Lee, 2011; Kwan et al., 2007 |
| Cell line (Homo-sapiens) | HEK293T | ATCC Provided by Dr. David Westaway’s laboratory | Cat# CRL-3216, RRID:CVCL_0063 | |
| Sequence-based reagent | GFP_R | This paper | PCR primer | TCTCGTTGGGGTCTTTGCTC |
| Biological sample (mouse) | Whole brains | Tissues were provided by Dr. David Westaway (Eskandari-Sedighi et al., 2017; Murakami et al., 2006) | Isolated from wild -type mice with 129/SvEvTac genetic background, and TgTauP301L mice | |
| Antibody | Anti GFP (rabbit monoclonal) | Abcam | Cat# ab183734, RRID:AB_2732027 | WB(1:3000) |
| Antibody | Anti-β-actin (rabbit polyclonal) | Sigma-Aldrich | Cat# A2066, RRID:AB_476693 | WB (1:10000) |
| Antibody | Anti-Active-Caspase-3 (rabbit polycolonal) | BD Pharmingen | Cat# 559565, RRID:AB_397274 | IHC (1:500) |
| Antibody | Alexa Fluor 647 (chicken anti-rat IgG) | Invitrogen | Cat# A-21472, RRID:AB_2535875 | WB (1:500) |
| Peptide, recombinant protein | Human MAPT (2N4R) | rPeptide | Cat# T-1001–2 | Resuspended to 2 mg/ml before use |
| Chemical compound, drug | Kanic acid monohydrate | Sigma Aldrich | K0250 | |
| Chemical compound, drug | Retigabine | Toronto research chemicals | R189050 | |
| Chemical compound, drug | 4-Aminopyridine (4AP) K+ channel blocker | Sigma | Cat# 275875–1G | |
| Chemical compound, drug | Pyrimidyn-7 (P7) Dynamin inhibitor | Abcam | Cat# ab144501 | 50 mM concentration supplied in DMSO |
| Chemical compound, drug | Dyngo 4a | Abcam | Cat# ab120689 | |
| Software, algorithm | Lab Chart 7 (software) | AD Instruments | ||
| Software, algorithm | Geneious Prime (bioinformatics software) | geneious.com | Version 8 | |
| Other | Human MAPT (Gene block) | Ordered from IDT | This is aa 244–372 of the full-length TAU 2N4R with seven-amino acid C-terminal linker (RSIAGPA) | |
| Other | Power lab Data acquisition device (equipment) | AD Instruments | 2/26 | |
| Other | Piezoresistive pressure transducer (equipment) | AD Instruments | Cat# MLT844 | |
| Other | Lipofectamine. 2000 (transfection reagents) | Invitrogen | Cat# 11668–019 | |
| Other | DAPI stain | Thermo Fisher | D1306 | (1 µg/mL) |
Additional files
-
Source data 1
Source data and statistics.
- https://cdn.elifesciences.org/articles/58744/elife-58744-data1-v1.zip
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/58744/elife-58744-transrepform-v1.pdf
