Male-predominant galanin mediates androgen-dependent aggressive chases in medaka

  1. Junpei Yamashita
  2. Akio Takeuchi
  3. Kohei Hosono
  4. Thomas Fleming
  5. Yoshitaka Nagahama
  6. Kataaki Okubo  Is a corresponding author
  1. Department of Aquatic Bioscience, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Japan
  2. Division of Reproductive Biology, National Institute for Basic Biology, Japan
7 figures, 1 table and 4 additional files

Figures

Figure 1 with 1 supplement
Male-biased sexual dimorphism exists in gal expression in the MPOA.

(A) Phylogenetic tree showing the relationship of medaka Gal to other known GAL family proteins. The number at each node indicates bootstrap values for 1000 replicates. Scale bar represents 0.1 …

Figure 1—figure supplement 1
Sequence information for medaka gal.

(A) Nucleotide and deduced amino acid sequences of the medaka gal cDNA. The predicted signal peptide is underlined and the mature Gal polypeptide is boxed. Asterisk indicates stop codon. Nucleotide …

Figure 2 with 1 supplement
Sexually dimorphic gal expression is dependent on adult sex steroids.

(A) Levels of gal expression in the whole brain of sex-reversed adult XX males and XY females versus typical adult XY males and XX females (n = 8 per group). ***p<0.001 (Bonferroni’s post hoc test). …

Figure 2—figure supplement 1
Expression of sex steroid receptors in sexually dimorphic gal neurons in pPMp.

Representative micrographs showing the expression of androgen receptor (AR) and estrogen receptor (ER) genes in pPMp, where sexually dimorphic gal-expressing neurons reside, in males (A) and females …

Figure 3 with 2 supplements
Genetic ablation of gal specifically suppresses male–male chases.

(A, B) Sum of each aggressive behavioral act (chase, fin display, circle, strike, and bite) performed by wild-type (+/+), heterozygous (+/Δ2 and +/Δ10), and homozygous (Δ2/Δ2 and Δ10/Δ10) males from …

Figure 3—figure supplement 1
Generation and verification of gal knockout medaka.

Two different lines of gal knockout medaka (Δ2 and Δ10) were generated by CRISPR/Cas9-mediated genome editing. (A) Gene structure of gal showing the location of the CRISPR target site, which is …

Figure 3—figure supplement 2
Mating behavior of gal knockout medaka.

Various parameters in the mating behavior of males (A, B) and females (C, D) from Δ2 (A, C) and Δ10 (B, D) gal knockout lines. Results were compared among wild-type (+/+), heterozygous (+/Δ2 and …

Genetic ablation of gal attenuates androgen-induced chases in females.

(A, B) Sum of each aggressive behavioral act (chase, fin display, circle, strike, and bite) performed by KT-treated females from Δ2 (A) and Δ10 (B) gal knockout lines. Asterisks indicate significant …

Figure 5 with 1 supplement
Gal peptide produced male-predominantly is transported to various brain regions.

(A, B) Line drawings of lateral (A) and ventral (B) views (anterior to the left) of the medaka brain showing the approximate levels of sections in panels C and D, respectively. (C) Representative …

Figure 5—figure supplement 1
Generation and fluorescence imaging of gal-GFP transgenic medaka.

(A) Structure of the transgene in gal-GFP transgenic medaka. A 7 bp sequence containing the translation initiation site of gal in a medaka BAC clone (clone ID: ola1-108J05) was replaced by a 2136 bp …

Figure 6 with 1 supplement
Gal receptors coupled to different signaling pathways are expressed widely in the brain.

(A) Phylogenetic tree showing the relationship of medaka Galr1 and Galr2 to other known GAL receptors. The number at each node indicates bootstrap values for 1000 replicates. Scale bar represents …

Figure 6—figure supplement 1
Sequence information for medaka galr2.

(A) Nucleotide and deduced amino acid sequences of the medaka galr2 cDNA. Asterisk indicates stop codon. Nucleotide numbers are shown at the right of each sequence line. (B) Sequence comparison of …

Author response image 1

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (Oryzias latipes)galthis paperGenBank:LC532140
Gene (O. latipes)galr2this paperGenBank:LC532141
Gene (O. latipes)actbGenBankGenBank:NM_001104808
Strain, strain background (O. latipes)d-rRNBRP Medakastrain ID:MT837maintained in a closed colony over 10 years in Okubo lab
Genetic reagent (O. latipes)gal knockout Δ2 linethis paperN/Agenerated and maintained in Okubo lab
Genetic reagent (O. latipes)gal knockout Δ10 linethis paperN/Agenerated and maintained in Okubo lab
Genetic reagent (O. latipes)gal-GFP transgenicthis paperN/Agenerated and maintained in Okubo lab
Cell line (Homo sapiens)HEK293TRiken BRC Cell Bankcell number:RCB2202; RRID:CVCL_0063
Cell line (Escherichia coli)DY380DOI:10.1038/35093556; DOI:10.1006/geno.2000.6451N/A
Transfected construct (H. sapiens)pcDNA3.1/V5-His-TOPOThermo Fisher Scientificcat#:K480001
Transfected construct (H. sapiens)pGL4.29Promegacat#:E8471
Transfected construct (H. sapiens)pGL4.33Promegacat#:E1340
Transfected construct (H. sapiens)pGL4.74Promegacat#:E6921
Antibodyalkaline phosphatase-conjugated anti-DIG antibody (sheep polyclonal)Roche Diagnosticscat#:11093274910; RRID:AB_514497(1:500 or 1:2000)
Antibodyhorseradish peroxidase-conjugated anti-fluorescein antibody (sheep polyclonal)PerkinElmercat#:NEF710001EA; RRID:AB_2737388(1:1000)
Antibodyanti-GAL antibody (rabbit polyclonal)Enzo Life Sciencescat#:BML-GA1161-0025; RRID:AB_2051473(1:200 or 1:500)
AntibodyAlexa Fluor 555-conjugated goat anti-rabbit IgG (goat polyclonal)Thermo Fisher Scientificcat#:A-21428; RRID:AB_2535849(1:1000)
AntibodyAlexa Fluor 488-conjugated goat anti-rabbit IgG (goat polyclonal)Thermo Fisher Scientificcat#:A-11070; RRID:AB_2534114(1:1000)
Recombinant DNA reagentfull-length cDNA clone for medaka galthis paperclone ID:56_B03
Recombinant DNA reagentfull-length cDNA clone for medaka galr2this paperclone ID:39_L19
Recombinant DNA reagentpGEM-Teasy vectorPromegacat#:A1360
Recombinant DNA reagentpCS2+hSpCas9 plasmidAddgeneRRID:Addgene_51815
Recombinant DNA reagentmedaka bacterial artificial chromosome (BAC) clone containing the gal locusNBRP Medakaclone ID:108_J05
Recombinant DNA reagentphrGFP II-1 mammalian expression vectorAgilent Technologiescat#:240143
Sequence-based reagentCRISPR RNA (crRNA) for medaka galFasmacN/AGAGCATCGGGCTGGTTATCGCGG
Sequence-based reagenttrans-activating CRISPR RNA (tracrRNA)Fasmaccat#:GE-002
Peptide, recombinant proteinmedaka Gal peptideScrumthis paperGWTLNSAGYLLGPHGIDGHRTLGDKQGLA-NH2
Commercial assay or kitIsogen Poly(A)+Isolation PackFujifilm Wako Pure Chemical Corporationcat#:314–05651
Commercial assay or kitnylon membraneRoche Diagnosticscat#:11209272001
Commercial assay or kitDIG RNA Labeling MixRoche Diagnosticscat#:11277073910
Commercial assay or kitT7 RNA polymeraseRoche Diagnosticscat#:10881775001
Commercial assay or kitDIG Easy HybRoche Diagnosticscat#:11603558001
Commercial assay or kitCDP-StarRoche Diagnosticscat#:12041677001
Commercial assay or kitRNeasy Lipid Tissue Mini KitQiagencat#:74804
Commercial assay or kitRNeasy Plus Universal Mini KitQiagencat#:73404
Commercial assay or kitOmniscript RT KitQiagencat#:205111
Commercial assay or kitSuperScript VILO cDNA Synthesis KitThermo Fisher Scientificcat#:11754050
Commercial assay or kitPower SYBR Green PCR Master MixThermo Fisher Scientificcat#:4367659
Commercial assay or kitLightCycler 480 SYBR Green I MasterRoche Diagnosticscat#:04887352001
Commercial assay or kitTSA Plus Fluorescein SystemPerkinElmercat#:NEL741001KT
Commercial assay or kitmMessage mMachine SP6 KitThermo Fisher Scientificcat#:AM1340
Commercial assay or kitDual-Luciferase Reporter Assay SystemPromegacat#:E1910
Chemical compound, drugmethyltestosteroneFujifilm Wako Pure Chemical Corporationcat#:136–09931
Chemical compound, drugestradiol-17β (E2)Fujifilm Wako Pure Chemical Corporationcat#:058–04043
Chemical compound, drug11-ketotestosterone (KT)Cosmo Biocat#:117 ST
Chemical compound, drugtricaine methane sulfonateSigma-Aldrichcat#:E10521
Chemical compound, drug5-bromo-4-chloro-3-indolyl phosphateRoche Diagnosticscat#:11383221001
Chemical compound, drugnitro blue tetrazoliumRoche Diagnosticscat#:11383213001
Chemical compound, drugagarose, type IX-ASigma-Aldrichcat#:A2576
Chemical compound, drugFast RedRoche Diagnosticscat#:11496549001
Chemical compound, drug4′,6-diamidino-2-phenylindole (DAPI)Thermo Fisher Scientificcat#:D1306
Chemical compound, drugblocking reagentRoche Diagnosticscat#:11096176001
Chemical compound, drugLipofectamine LTXThermo Fisher Scientificcat#:15338100
Software, algorithmInterProhttps://www.ebi.ac.uk/interpro/RRID:SCR_006695
Software, algorithmSignalPhttp://www.cbs.dtu.dk/services/SignalP/RRID:SCR_015644
Software, algorithmClustalWhttp://clustalw.ddbj.nig.ac.jp/index.phpRRID:SCR_017277
Software, algorithmGraphPad PrismGraphPad SoftwareRRID:SCR_002798

Additional files

Download links