A gradient of Wnt activity positions the neurosensory domains of the inner ear
- UCL Ear Institute, University College London, United Kingdom
Figures
Figure 1
Spatial pattern of Wnt activity in the E3 chicken otocyst.
In all panels, dorsal (D) is up and anterior (A) is right. (a) E2 chicken embryos were co-electroporated either with Wnt reporter and a control plasmid T2-EGFP or Wnt reporter together with a Notch …
-
Figure 1—source data 1
Wnt reporter activity in the E3 chicken otocyst.
- https://cdn.elifesciences.org/articles/59540/elife-59540-fig1-data1-v3.xlsx
Figure 2 with 1 supplement
Wnt signalling antagonises Notch activity.
(a–d’) Schematic representation of the Piggybac, Tol2, and RCAS constructs used for β-catenin gain- (GOF) and loss-of-function (LOF) experiments. The PB-βcat-GOF and T2-βcat-GOF contain the …
Figure 2—figure supplement 1
Manipulating Notch activity does not affect Wnt signalling.
(a–c’) Whole mounts of E3 chicken otocysts co-electroporated with Wnt reporter 5TCF::H2B-RFP and a control plasmid T2-EGFP or constructs activating (pNICD1-EGFP) and blocking (pDN-MAML1-EGFP) Notch …
Figure 3 with 3 supplements
Wnt signalling antagonises prosensory specification.
Whole-mount views of E4 chicken otocysts electroporated at E2 and immunostained for Jag1 and Sox2 expression. (a–a”) Control sample electroporated with T2-mCherry. Jag1 and Sox2 are expressed in a …
Figure 3—figure supplement 1
Analyses of Sox2 (magenta) and βcat-GOF (EGFP, green) fluorescence intensity levels in transfected prosensory regions.
In figures (a) and (c) the white line indicates the line selected for the profile plots shown in (b) and (d). The line profile plots (b and d) show that transfected cells with high levels of EGFP …
Figure 3—figure supplement 2
Effects of simultaneous loss of Wnt and Notch activity on prosensory specification.
Whole mount of an E4 otocyst co-electroporated with T2-βcat-LOF and a dominant-negative form of Maml1 (pDN-MAML1-EGFP) and immunostained for Sox2. (a–a’’) Sox2-expressing cells occupy the ventral …
Figure 3—figure supplement 3
Blocking Wnt signalling triggers ectopic neurogenesis.
(a–a’) Whole-mount views of an E4 otocyst electroporated at E2 with a control T2-mCherry vector and immunostained for the otic neuronal marker Islet1. The cochleo-vestibular ganglion (star) is on …
Figure 4
Manipulating Wnt activity alters inner ear sensory organ formation.
(a–a”) Whole-mount (tiled maximum projection) views of an E7 chicken inner ear electroporated at E2 with a control vector (T2-mEGFP) and immunostained for Sox2 (a’) and two hair cell markers, Myo7a …
Figure 5
Spatial pattern of Wnt activity in the developing chicken inner ear.
Samples co-electroporated at the early otic placode stage with a Wnt reporter (5TCF::H2B-RFP or T2-5TCF::nd2Scarlet for long-term integration) and a control plasmid (T2-mEGFP in a–d) were collected …
Figure 6 with 1 supplement
Pharmacological modulation of Wnt activity in explanted E3 otocysts.
(a–c') Whole-mount views of otic cups co-electroporated with the Wnt reporter and a control EGFP vector and incubated for 24 hr in control medium (DMSO) (a–a’), or media supplemented with either the …
Figure 6—figure supplement 1
Effects of the Wnt agonist LiCl on Sox2 expression.
(a–e) Whole mounts of E3 chicken otocysts incubated for 24 hr in control medium or media enriched with increasing doses of LiCl. (a) In control condition, Sox2 marks a medial band of …
Figure 7
A schematic model of the effects of canonical Wnt activity on the patterning of inner ear neurosensory-competent domains.
(a) The hindbrain produces Wnt1 and Wnt3a ligands activating Wnt signalling in the dorsal aspect of the otic placode. Over time, a dorso-ventral gradient of Wnt activity forms in the otic cup and …
Appendix 1—figure 1
Quantification of the Wnt gradient profile.
Videos
Video 1
E3 chicken otocyst electroporated with Wnt reporter 5TCF::H2B-RFP and control plasmid T2-EGFP.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | B-catenin (Ctnnb1) | GenBank | ||
| Software, algorithm | R (RRID:SCR_001905) | https://www.r-project.org/ | Used for quantification and visualisation | |
| Software, algorithm | Volocity (RRID:SCR_002668) | https://quorumtechnologies.com/index.php/component/content/category/31-volocity-software | Used for quantification | |
| Software, algorithm | ImageJ (RRID:SCR_003070) | https://www.imagej.net | Used for quantification and visualisation | |
| Software, algorithm | OriginPro 2020 | OriginLab Corporation | Used for statistical analysis and visualisation | |
| Recombinant DNA reagent | 5TCF::H2B-RFP (plasmid) | PMID:24942669 | Wnt reporter | |
| Recombinant DNA reagent | T2-5TCF::nd2Scarlet (plasmid) | This paper and PMID:27869816 | Wnt reporter cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | T2-Hes5::nd2EGFP (plasmid) | PMID:22991441 | Notch reporter | |
| Recombinant DNA reagent | Hes5::d2FP635 (plasmid) | PMID:22991441 | Notch reporter | |
| Recombinant DNA reagent | RCAS-βcat-LOF (plasmid) | PMID:12941626 PMID:7876319 | β-catenin LOF | |
| Recombinant DNA reagent | T2-βcat-LOF (plasmid) | This study | β-catenin LOF cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | PB-βcat-GOF (plasmid) | PMID:24942669 | β-catenin GOF | |
| Recombinant DNA reagent | T2-βcat-GOF (plasmid) | This study | β-catenin GOF cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | pNICD1-EGFP (plasmid) | PMID:15634704 | Notch GOF | |
| Recombinant DNA reagent | pDN-MAML1-EGFP (plasmid) | PMID:27218451 | Notch LOF | |
| Recombinant DNA reagent | T2-EGFP (plasmid) | PMID:17362912 | Control plasmid | |
| Recombinant DNA reagent | T2-mEGFP (plasmid) | This study | Control plasmid, mEGFP cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | T2-mRFP (plasmid) | This study | Control plasmid, mRFP cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | pTurquoise (plasmid) (RRID:Addgene_98817) | Addgene | Addgene No: 98817 | Control plasmid |
| Recombinant DNA reagent | mPB (plasmid) | PMID:19755504 | PiggyBac transposase | |
| Recombinant DNA reagent | pCAGGS-T2-TP (plasmid) | PMID:17362912 | Tol2 Transposase | |
| Commercial assay or kit | In-Fusion HD Cloning | Takarabio | No: 638916 | |
| Commercial assay or kit | RNAqueous-Micro Total RNA Isolation Kit | Life Technologies | No: AM1931 | |
| Antibody | Rabbit polyclonal anti-Jagged 1 (RRID:AB_649685) | Santa-Cruz Biotechnology | No: sc-8303 | IF (1:200) |
| Antibody | Rabbit polyclonal anti-Sox2 (RRID:AB_2341193) | Abcam | No: 97959 | IF (1:500) |
| Antibody | Mouse IgG1 monoclonal anti-Sox2 (RRID:AB_10694256) | BD Biosciences | No: 561469 | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-Islet1 (RRID:AB_1157901) | Developmental Studies Hybridoma Bank | Clone 39.3F7 | IF (1:250) |
| Antibody | Mouse monoclonal IgG1 anti-HA-tag (RRID:AB_291262) | Babco Inc | No: MMS-101R | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-Myo7a (RRID:AB_2282417) | Developmental Studies Hybridoma Bank | Clone 138–1 | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-HCA (RRID:AB_2314626) | Guy Richardson | IF (1:1000) | |
| Chemical compound, drug | LiCl | Sigma-Aldrich | No: L7026 | Concentrations: 5 µM, 15 µM, 25 µM, 35 µM |
| Chemical compound, drug | IWR-1 | Sigma-Aldrich | No: I0161 | Concentration 300 µM |
| Chemical compound, drug | Leibovitz’s | Gibco | No: 21083–027 | |
| Chemical compound, drug | Matrigel | Corning | No: 354230 | |
| Chemical compound, drug | DMEM/F12 | Gibco | No: 21041–025 | |
| Chemical compound, drug | HEPES | Sigma-Aldrich | No: SRE 0065 | Concentration 1% |
| Chemical compound, drug | Ciprofloxacin | Fluka | No: 17850–5 G-F | Concentration 0.1% |
| Sequence-based reagent | 5xTCF-BS_F | This paper | PCR primers | ATGGGCCCTCGTCGAACGACGTTGTAAAACGACGG |
| Sequence-based reagent | 5xTCF-BS_R | This paper | PCR primers | TGGTGGCgAGATCTGCGGCACGCTG |
| Sequence-based reagent | Bcat_GOF_F | This paper | PCR primers | TTTTGGCAAAGAATTGCCACCATGGCTACTCAAGC |
| Sequence-based reagent | Bcat_GOF_R | This paper | PCR primers | TAGACTCGAGGAATTtcacctattatcacggccgcc |
| Sequence-based reagent | Bcat_LOF_F | This paper | PCR primers | gattacgctgctcgagcaatccccgagc |
| Sequence-based reagent | Bcat_LOF_R | This paper | PCR primers | ctagagtgaagcagctcagtaagag |
