1. Microbiology and Infectious Disease
Download icon

Metabolic profiling during malaria reveals the role of the aryl hydrocarbon receptor in regulating kidney injury

  1. Michelle M Lissner
  2. Katherine Cumnock
  3. Nicole M Davis
  4. José G Vilches-Moure
  5. Priyanka Basak
  6. Daniel J Navarrete
  7. Jessica A Allen
  8. David Schneider  Is a corresponding author
  1. Department of Microbiology and Immunology, Stanford University, United States
  2. Department of Comparative Medicine, Stanford University, United States
  3. Division of Health, Mathematics and Science, Columbia College, United States
Research Article
Cite this article as: eLife 2020;9:e60165 doi: 10.7554/eLife.60165
6 figures, 2 tables and 2 additional files

Figures

Figure 1 with 2 supplements
Dynamic multi-omic profiling of Pc-infected mice reveals broad immune and metabolic changes.

(A) Parasitemia, (B) liver damage and anemia, and (C) selected peripheral blood immune cells and cytokines during 25 days of malaria. (D) 370 metabolites with altered scaled intensity in plasma during malaria, arranged by super pathway. Fold change of scaled intensity of (E) stachydrine, BHBA, (F) arachidonate, and α-tocopherol in plasma during malaria, relative to day 0. (G) Schematic of metabolites and genes of heme metabolism. (H) Fold change of scaled intensity of heme-related metabolites in plasma during malaria, relative to day 0. (I) Fold change of metabolites (n = 77) that were significantly altered in the plasma of both Pc-infected mice and pediatric cerebral malaria patients, plotted by fold change relative to day 0 samples for mice and relative to convalescent values for patients. Data are fitted with a linear model. (J) Scaled intensity of heme-related metabolites during human malaria (n = 11 patients per condition). In A-C, E, F, and H, data are presented as mean + SEM and p-values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. In J, p-values were determined using a Wilcox test. **p<0.01. These experiments were performed once.

Figure 1—figure supplement 1
Gating strategy used to define blood cell populations.
Figure 1—figure supplement 2
Production of heme metabolites during malaria.

(A) Expression of heme metabolism genes in livers of Pc-infected mice. p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. (B) Scaled intensity of arachidonate, BHBA, stachydrine, and heme in pediatric cerebral malaria patients (n = 11 per condition). p-Values were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. These experiments were performed once.

Figure 2 with 1 supplement
Malaria modulates AHR ligands in the plasma of mice and patients.

(A) Schematic of metabolites and genes of the kynurenine pathway. (B) Fold change of scaled intensity of kynurenine pathway compounds during Pc infection, relative to day 0 (mean + SEM). p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction (n = 5 mice on 0 DPI, five infected mice each day, and two uninfected mice each day). *p<0.05. (C) Scaled intensity of kynurenine pathway compounds in pediatric cerebral malaria patients (n = 11 patients per condition). (D) Quantification of bilirubin (n = 12–13 mice per condition) and (E) kynurenine pathway metabolites (n = 5–6 mice per condition) at 9 days post Pc infection. p-Values were determined in C-E using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. These experiments were performed once.

Figure 2—figure supplement 1
Production of AHR ligands during malaria.

(A) Expression of kynurenine pathway genes in livers of Pc-infected mice (n = 2–5 mice per condition). (B) Scaled intensity of indoleacetate during Pc infection. p-Values were determined by comparing each infected time point to all uninfected values using two-way ANOVA with FDR correction n = 5 mice on 0 DPI, five infected mice each day, and (two uninfected mice each day). *p<0.05. Values are presented as mean + SEM. These experiments were performed once.

Figure 3 with 2 supplements
Ahr-/- mice are susceptible to malaria.

(A) Parasitemia, (B) parasite density, (C) RBCs/μl blood, change in (D) body weight and (E) temperature relative to day 0, and (F) survival of Pc-infected Ahr+/+, Ahr+/- and Ahr-/- mice (n = 10, 8, and 11, respectively). p-Values in A-E were determined using two-way ANOVA with FDR correction comparing Ahr+/- and Ahr-/- mice; values are mean ± SEM. p-Values in F were determined using a log-rank test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data were combined from three independent experiments.

Figure 3—figure supplement 1
MaleAhr-/-mice are susceptible to malaria.

(A) Parasitemia, (B) parasite density, and (C) survival of male Pc-infected Ahr+/+, Ahr+/-, and Ahr-/- mice (n = 7, 23, and 9, respectively). p-Values in A, and B were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in C were determined using a log-rank test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data were combined from three independent experiments.

Figure 3—figure supplement 2
Ido1-/-mice are not susceptible to malaria.

(A) Quantification of kynurenine pathway metabolites in Pc- or mock-infected Ido1+/+ and Ido1-/- mice on 9 DPI (n = 5 per condition). (B) Parasitemia, (C) parasite density, and (D) survival of Pc-infected Ido1+/+ and Ido1-/- mice (n = 12–13 per condition). p-Values in A, B, and C were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in D were determined using a log-rank test. *p<0.05. Data are representative of two independent experiments.

Figure 4 with 3 supplements
Acute kidney injury and inappropriate heme regulation in Ahr-/- mice during malaria.

(A) ALT and (B) BUN in plasma of Ahr+/- and Ahr-/- mice during infection (n = 3–9 per group). (C) Gene expression in kidneys from Ahr+/- and Ahr-/- mice on 8 DPI (normalized to Arbp0 using the ddCT method, n = 5 per condition). (D) Representative images of H and E-stained kidney tissue from Ahr+/- and Ahr-/- mice (magnification: 40x, scale bar: 20 μm). Black asterisks indicate dilated renal tubules with eosinophilic proteinaceous fluid. (E) Total heme in plasma of Pc-infected Ahr+/- and Ahr-/- mice (n = 3–9 per group). (F) Correlation of heme and BUN from individual mice (also plotted in B and E) and fit with a linear model. (G) Total heme in urine of Pc-infected Ahr+/- and Ahr-/- mice (n = 3–8 per group). p-Values in A, B, E, and G were determined using two-way ANOVA with FDR correction; values are mean ± SEM. p-Values in C were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Each timepoint was collected in one to two independent experiments.

Figure 4—figure supplement 1
Representative images of H and E-stained tissue showing (A) liver, (B) spleen, and (C) lung, and (D) kidney arcuate vein from Ahr+/- and Ahr-/- mice (magnification: 40x).

Black chevrons in A indicate margination of leukocytes along the endothelial lining. The black dotted line in A delineates an area of parenchymal necrosis. Data are representative of two independent experiments.

Figure 4—figure supplement 2
Heme metabolism appears largely normal inAhr-/-mice during malaria.

(A) Msp1 expression in perfused kidneys from Ahr+/- and Ahr-/- mice on 8 DPI (normalized to Hmbs using the ddCT method, n = 6 per group). (B) Representative images of Perls Prussian blue-stained kidney cortex from Pc-infected Ahr+/- and Ahr-/- mice on 8 DPI. The blue signal (arrows) indicates accumulation of iron. (C) Western blot showing levels of heme metabolism genes in liver and kidney tissue from Pc-infected Ahr+/- and Ahr-/- mice on 8 DPI. (D) qRT-PCR analysis of heme metabolism genes in liver tissue from Pc-infected Ahr+/- and Ahr-/- mice on 8 DPI (n = 3–5 per condition). p-Values in A and D were determined using a Wilcox test. *p<0.05. These experiments were performed once.

Figure 4—figure supplement 3
Control andAhr-/-mice are equally susceptible to phenylhydrazine-induced heme overload.

(A) Survival, (B) RBCs/μl blood, (C) plasma heme, and (D) BUN in phenylhydrazine-treated Ahr+/- and Ahr-/- mice (n = 9 per genotype). p-Value in A was calculated using a log-rank test. p-Values in B-D were determined using two-way ANOVA with FDR correction; values are mean ± SEM. *p<0.05. Data are representative of two independent experiments.

Figure 5 with 3 supplements
AHR is required during Pc infection in radioresistant cells.

(A) Survival, (B) parasitemia, and (C) total heme (8 DPI), and (D) BUN (8 DPI) in Pc-infected bone marrow chimeric mice (n = 6–12 per condition). p-Values in A were determined using a log-rank test. p-Values in B-D were determined using a Wilcox test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data are representative of two independent experiments.

Figure 5—figure supplement 1
Neutrophilia inAhr-/-mice during malaria does not cause increased susceptibility.

(A) CD11bhiLy6CintLy6G+ neutrophils/μl blood in Pc- infected Ahr+/+ and Ahr-/- mice (n = 6 per genotype). (B) Representative FACS plots of mice at 7 DPI with indicated treatment. (C) Neutrophils/μl blood on 7 DPI in Ahr+/+ and Ahr-/- mice after treatment with either Ly6G depleting antibody or isotype control (n = 4–5 per genotype). (D) Survival of Pc-infected Ahr+/+ and Ahr-/- mice after treatment with either anti-Ly6G depleting antibody or isotype control (n = 4–5 per genotype). These experiments were performed once.

Figure 5—figure supplement 2
Increased TNF production inAhr-/-mice during malaria does not cause increased susceptibility.

(A) TNF concentration in plasma of Pc-infected Ahr+/+ (n = 5) and Ahr-/- (n = 3) mice at 8 DPI. (B) Survival and (C) BUN levels in Pc-infected Ahr+/+ and Ahr-/- mice (n = 4–5 per condition) after treatment with either anti-TNF neutralizing antibody or isotype control. These experiments were performed once.

Figure 5—figure supplement 3
Efficiency of bone marrow transplantation measured by flow cytometry on peripheral blood 2 months after transplantation (n = 6–12 per condition).

Data are representative of two independent experiments.

AHR is required during Pc infection in Tek-expressing cells.

(A) Survival, (B) parasitemia, (C) plasma heme, and (D) BUN in Pc-infected Ahrfl/fl and Ahrfl/fl::Tekcre/+ mice (n = 9 per genotype). p-Values in A were determined using a log-rank test. p-Values in B-D were determined using a two-way ANOVA with FDR correction. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data are representative of two independent experiments.

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
AntibodyTruStain FcX AntibodyBiolegendBioLegend Cat# 101319, RRID:AB_1574973
AntibodyMouse monoclonal CD71 PerCP/Cy5.5 (clone RI7217)BiolegendBioLegend Cat# 113815, RRID:AB_2565481
AntibodyMouse monoclonal TER-119 PE/Cy7 (clone TER-119)BiolegendBioLegend Cat# 116221, RRID:AB_2137789
AntibodyMouse monoclonal TCR γ/δ PE (clone UC7-13D5)BiolegendBioLegend Cat# 107507, RRID:AB_345265
AntibodyMouse monoclonal CD19 BV 785 (clone 6D5)BiolegendBioLegend Cat# 115543, RRID:AB_11218994
AntibodyMouse monoclonal CD3 BV 650 (clone 17A2)BiolegendBioLegend Cat# 100229, RRID:AB_11204249
AntibodyMouse monoclonal CD8a BV510 (clone 53–6.7)BiolegendBioLegend Cat# 100751, RRID:AB_2561389
AntibodyMouse monoclonal Ly-6G BV 421 (clone 1A8)BiolegendBioLegend Cat# 127628, RRID:AB_2562567
AntibodyMouse monoclonal CD4 Alexa Fluor 700 (clone RM4-5)BiolegendBioLegend Cat# 100536, RRID:AB_493701
AntibodyMouse monoclonal Ly-6C Alexa Fluor 647 (clone HK1.4)BiolegendBioLegend Cat# 128010, RRID:AB_1236550
AntibodyMouse monoclonal CD335 FITC (clone 29A1.4)BiolegendBioLegend Cat# 137606, RRID:AB_2298210
AntibodyMouse monoclonal CD11b APC-eFluor 780 (clone M1/70)Thermo Fisher ScientificThermo Fisher Scientific Cat# 47-0112-82, RRID:AB_1603193
AntibodyMouse monoclonal CD41 BUV395 (clone MWReg30)BD BiosciencesBD Biosciences Cat# 565980, RRID:AB_2739432
AntibodyHuman monoclonal Heme Oxygenase 1 (clone EP1391Y)AbcamAbcam Cat# ab52947, RRID:AB_880536(1:2000 dilution)
AntibodyMouse monoclonal Ferritin Heavy Chain (clone EPR18878)AbcamAbcam Cat# ab183781(1:2000 dilution)
AntibodyMouse monoclonal DMT1 antibodyAbcamAbcam Cat# ab55735, RRID:AB_2239227(1:400 dilution)
AntibodyMouse polyclonal HCP1/PCFT antibodyAbcamAbcam Cat# ab25134, RRID:AB_2270597(1:1000 dilution)
AntibodyMouse monoclonal β-Actin (clone AC-15)Sigma AldrichSigma-Aldrich Cat# A1978, RRID:AB_476692(1:2000 dilution)
AntibodyRabbit
polyclonal IgG HRP
GE HealthcareGE Healthcare Cat# GENA934, RRID:AB_2722659(1:10,000 dilution)
AntibodyMouse polyclonal IgG HRPBio-RadBio-Rad Cat# 170–6516, RRID:AB_11125547(1:3000 dilution)
AntibodyMouse polyclonal CD45.2 PerCP-Cy5.5 (clone 104)Thermo Fisher ScientificThermo Fisher Scientific Cat# 45-0454-82, RRID:AB_953590
AntibodyMouse monoclonal NK-1.1 FITC (clone PK136)BiolegendBioLegend Cat# 108705, RRID:AB_313392
AntibodyMouse monoclonal CD11c PE-Cy7 (clone N418)Thermo Fisher ScientificThermo Fisher Scientific Cat# 25-0114-82, RRID:AB_469590
AntibodyMouse monoclonal CD45.1 PE (clone A20)BiolegendBioLegend Cat# 110707, RRID:AB_313496
AntibodyMouse monoclonal Ly6G (clone 1A8)Bio X CellBio X Cell Cat# BE0075-1, RRID:AB_1107721
AntibodyRat monoclonal IgG2a, (clone 2A3)Bio X CellBio X Cell Cat# BE0089, RRID:AB_1107769
AntibodyMouse monoclonal TNFα (clone XT3.11)Bio X CellBio X Cell Cat# BE0058, RRID:AB_1107764
AntibodyRat monoclonal IgG1 (clone HRPN)Bio X CellBio X Cell Cat# BE0088, RRID:AB_1107775
Chemical compound, drugFormic acid, reagent grade,≥95%Sigma AldrichCat. F0507-100ML
Chemical compound, drugHeminSigma AldrichCat. H9039
Chemical compound, drugPhenylhydrazine, 97%Sigma AldrichCat. P26252-100G
Chemical compound, drugL-TryptophanSigma AldrichCat. T0254
Chemical compound, drugTryptophan-d5Medical IsotopesCat. D34384
Chemical compound, drugL-KynurenineSigma AldrichCat. K8625
Chemical compound, drugL-Kynurenine-d4Medical IsotopesCat. D37563
Chemical compound, drug3-Hydroxy-DL-kynurenineSigma AldrichCat. H1771
Chemical compound, drug3-Hydroxy-DL-kynurenine-d3Medical IsotopesCat. D34384
Chemical compound, drugKynurenic acidSigma AldrichCat. 67667
Chemical compound, drugKynurenic acid-3,5,6,7,8-d5Sigma AldrichCat. 793477
Chemical compound, drug2,3-Pyridinedicarboxylic acidSigma AldrichCat. P63204
Chemical compound, drugQuinolinic Acid-d3Medical IsotopesCat. D18880
Commercial assay or kitBilirubin Assay KitSigma AldrichCat. MAK126-1KT
Commercial assay or kitALT Activity AssaySigma AldrichCat. MAK052-1KT
Commercial assay or kitBioassay Systems Urea Assay KitFisher ScientificCat. 50-107-8333
Commercial assay or kitTruSeq RNA Library Prep Kit v2IlluminaCat. RS-122–2001
Commercial assay or kitTNF alpha Mouse ELISA KitThermo Fisher ScientificThermo Fisher Scientific Cat# BMS607/3, RRID:AB_2575663
Genetic reagent (Mus musculus)Ahr-/- miceTaconicCat. 9166, RRID:IMSR_TAC:9166
Genetic reagent (M. musculus)Ahr+/+ miceTaconicCat. B6, RRID:IMSR_TAC:b6
Genetic reagent (M. musculus)Ido1-/- miceJaxCat. 005867, RRID:IMSR_JAX:005867
Genetic reagent (M. musculus)C57BL/6J miceJaxCat. 000664, RRID:IMSR_JAX:000664
Genetic reagent (M. musculus)AhRfl/fl miceJaxCat. 006203, RRID:IMSR_JAX:006203
Genetic reagent (M. musculus)Tekcre/+ miceJaxCat. 004128, RRID:IMSR_JAX:004128
Genetic reagent (M. musculus)CD45.1 miceTaconicCat. 4007, RRID:IMSR_TAC:4007
Genetic reagent (M. musculus)C57BL/6NCrl miceCharles RiverCat. 027, RRID:IMSR_CRL:027
Genetic reagent (Plasmodium chabaudi)Plasmodium chabaudi AJMalaria Research and Reference Reagent Resource CenterCat. MRA-756
Commercial assay or kitBilirubin Assay KitSigma AldrichCat. MAK126-1KT
Commercial assay or kitRNeasy Mini kitQiagenCat. 74104
Commercial assay or kitRnase-Free DnaseQiagenCat. 79256
Commercial assay or kitSuperScript III First-Strand synthesis systemFisher ScientificCat. 18-080-051
Commercial assay or kitFastStart Universal SYBR Green Master (Rox)Sigma AldrichCat. 04913850001
Software, algorithmFlowJo 10.0.8r1Tree Starhttps://www.flowjo.com/solutions/flowjo
Software, algorithmR v3.4.0Rhttps://www.r-project.org/
Software, algorithmggplot2 v3.1.0ggplot2https://github.com/tidyverse/ggplot2
Table 1
qRT-PCR primers used in this study.
GeneForward primerReverse primerSource
HpGCTATGTGGAGCACTTGGTTCCACCCATTGCTTCTCGTCGTTPrimerBank 8850219a1
HpxAGCAGTGGCGCTAAATATCCTCCATTTTCAACTTCGGCAACTCPrimerBank 23956086a1
Hrg1GACGGTGGTCTACCGACAACTCCTCCAGTAATCCTGCATGTAPrimerBank 13385856a1
HmbsAAAGTTCCCCAACCTGGAATCCAGGACAATGGCACTGAAT
Hmox1AAGGAGGTACACATCCAAGCCGAGGATATGGTACAAGGAAGCCATCACCAGRamos et al., 2019
FthCCATCAACCGCCAGATCAACGCCACATCATCTCGGTCAAARamos et al., 2019
Mfsd7bTCTTCAGCCTTTACTCGCTGGGAAGTCCTCGAACACGTTGCTPrimerBank 124486924 c1
Mfsd7cGGAGAAAGCGATTAGAGAAGGCCTGATGGCTGCATTTCACAGTPrimerBank 26340226a1
Slc40a1TGCCTTAGTTGTCCTTTGGGGTGGAGAGAGAGTGGCCAAGRamos et al., 2019
TfrcGTTTCTGCCAGCCCCTTATTATGCAAGGAAAGGATATGCAGCAPrimerBank 11596855a1
Msp1ACTGAAGCAACAACACCAGCGTTGTTGATGCACTTGCGGGTTCCheesman et al., 2006
Havcr1TGGTTGCCTTCCGTGTCTCTTCAGCTCGGGAATGCACAAKulkarni et al., 2014
Lcn2TGGCCCTGAGTGTCATGTGCTCTTGTAGCTCATAGATGGTGCPrimerBank 1019908a1
Arbp0CTTTGGGCATCACCACGAAGCTGGCTCCCACCTTGTCTRamos et al., 2019

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)