Figures and data in The kinase PDK1 is critical for promoting T follicular helper cell differentiation

Figures
Tables
Additional files

9 figures, 1 table and 1 additional file

Figures

Figure 1

Download asset Open asset

PDK1 supports Tfh cell differentiation and effector functions.

(A) Flow cytometry analysis of PDK1 expression in naïve CD4⁺ T (CD62L^hiCD44^lo), Th1, and Tfh cells from C57BL/6J mice on 8 dpi. Quantification of PDK1 MFI is shown on the right (n = 8). (B) Quantitative RT-PCR analysis of *Pdk1* abundance in naïve CD4⁺ T cells, from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice (*n =* 3). (**C, D**) Flow cytometry analysis of CD44⁺CXCR5⁺ Tfh cells and CD44⁺CXCR5^- Th1 cells gated on total CD4⁺ T cells (top panel), or PD-1^hiCXCR5⁺ GC Tfh cells (middle panel) and Bcl-6^hiCXCR5⁺ GC Tfh cells (bottom panel) gated on CD44⁺CD62L^-CD4⁺ T cells from spleens of WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on 8 dpi with representative contour plots and cumulative data in (C) and (D), respectively (n ≥ 6). (**E, F**) Expression of PD-1, ICOS, and Bcl-6 on Tfh cells (CD4⁺CD44⁺CXCR5⁺) was analyzed by flow cytometry with representative histograms and quantification data in (E) and (F), respectively (n = 6). (G) Chemotaxis transwell assay for Tfh cells. Splenocytes from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on 8 dpi were added to a transwell plate and migration in the presence of CXCL13 was assessed (n ≥ 5). (**H, I**) Flow cytometry analysis of splenic PNA⁺Fas⁺ GC B cells (top panel) and B220⁻CD138⁺ plasma cells (bottom panel) from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on 8 dpi with representative contour plots and cumulative data in (H) and (I), respectively (n = 4). (J) Confocal microscopy analysis of GC histology in spleen sections from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on 8 dpi. Green: PNA, red: IgD, blue: CD4; scale bar: 10 μm. (K) LCMV-specific IgG concentration of sera from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on day 8 (top panel) and 56 (bottom panel) post-infection was measured by ELISA (n ≥ 7). Data are representative of at least two independent experiments (**A, B, E–G, H–I, K**) or pooled from three independent experiments (**C, D**). Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 1—source data 1 PDK1 supports Tfh cell differentiation and effector functions.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig1-data1-v1.xlsx
Download elife-61406-fig1-data1-v1.xlsx

Figure 2 with 1 supplement

Download asset Open asset

PDK1 is essential for Tfh cell differentiation upon protein immunization.

(**A, B**) Flow cytometry analysis of CD44⁺CXCR5⁺ Tfh cells and CD44⁺CXCR5⁻ Th1 cells gated on splenic CD4⁺ T cells (top panel) or PD-1^hiCXCR5⁺ GC Tfh cells (middle panel) and Bcl-6^hiCXCR5⁺ GC Tfh cells (bottom panel) gated on splenic CD44⁺CD62L^-CD4⁺ T cells from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on day 8 post-KLH immunization with representative contour plots and cumulative data in (A) and (B), respectively (n = 3). (**C, D**) Expression of PD-1, ICOS, and Bcl-6 on Tfh cells (CD4⁺CD44⁺CXCR5⁺) was analyzed by flow cytometry with representative histograms and quantification data in (C) and (D), respectively (n = 3). (**E, F**) Flow cytometry analysis of splenic PNA⁺Fas⁺ GC B cells (top panel) and B220^-CD138⁺ plasma cells (bottom panel) from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on day 8 post-KLH immunization with representative contour plots and cumulative data in (E) and (F), respectively (n = 3). Data are representative of two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 2—source data 1 PDK1 is essential for Tfh cell differentiation and GC responses upon KLH immunization.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig2-data1-v1.xlsx
Download elife-61406-fig2-data1-v1.xlsx

Figure 2—figure supplement 1

Download asset Open asset

Analysis of T helper cells upon KLH immunization.

(A) Splenocytes from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice on day 8 post-KLH immunization were restimulated with PMA and Ionomycin at 37℃ for 5 hr. Then the cells were surface stained, followed by intracellular staining of IFNγ, IL-4, and IL-17a (n = 6). (B) Cumulative data on frequency of IFNγ⁺, IL-4⁺, and IL-17a⁺ cells gated on splenic CD4⁺CD44⁺CD62L⁻ T cells from WT and *Pdk1*^fl/fl::*Cd4*-Cre mice (n = 6). Data are pooled from two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 2—figure supplement 1—source data 1 Analysis of distinct T helper subsets upon KLH immunization.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig2-figsupp1-data1-v1.xlsx
Download elife-61406-fig2-figsupp1-data1-v1.xlsx

Figure 3

Download asset Open asset

PDK1 intrinsically regulates Tfh cell differentiation.

(A) Generation of bone marrow (BM) chimeric mice. BM cells from WT or *Pdk1*^fl/fl::*Cd4*-Cre mice (CD45.2⁺) were mixed with WT (CD45.1⁺CD45.2⁺) competitor cells at a 1:1 ratio, and transferred to lethally irradiated WT recipients (CD45.1⁺CD45.2⁺). After 9 weeks reconstitution, the recipients were infected with LCMV and analyzed 8 days later. (B) Analysis of chimerism by flow cytometry. WT and *Pdk1*^fl/fl::*Cd4*-Cre cells (CD45.2⁺) in CD4⁺ T cells of chimera mice were determined. (**C–E**) Flow cytometry analysis of competitive contributions by CD45.2⁺ cells to the total CD44⁺CXCR5⁺ Tfh (C), PD-1^hiCXCR5⁺ GC Tfh (D), and Bcl-6^hiCXCR5⁺ Tfh (E) cell population from recipients with representative contour plots and cumulative data (n = 4). (**F, G**) Detection of PD-1, ICOS, and Bcl-6 expression on CD44⁺CXCR5⁺ Tfh cells from recipients by flow cytometry with representative histograms and quantification data in (F) and (G), respectively (n = 4). Data are representative of two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 3—source data 1 PDK1 intrinsically programs Tfh cell differentiation.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig3-data1-v1.xlsx
Download elife-61406-fig3-data1-v1.xlsx

Figure 4 with 1 supplement

Download asset Open asset

PDK1 is required for both early differentiation and late maintenance of Tfh cells.

(A) Schematic of the SMARTA cell transfer system used for characterization of early Tfh cell commitment. SMARTA CD4⁺ T cells from *Pdk1*^fl/fl::*Rosa26^CreER*::SMARTA mice were transferred into C57BL/6J (CD45.2⁺) host mice, followed by Tamoxifen treatment for four consecutive days, LCMV infection, and analyzed on 3 dpi. (B) Quantitative RT-PCR analysis of *Pdk1* abundance in donor-derived CXCR5⁺ Tfh cells from recipients on 3 dpi as in (A) (n = 6). (C) Flow cytometry analysis of Bcl-6⁺CXCR5⁺ Tfh cells gated on SMARTA CD4⁺ T cells from recipients on 3 dpi with representative contour plots and cumulative data (n = 3). (D) Contour plots represents BrdU⁺ cells gated on donor-derived activated CD4⁺ T cells (top panel) and CXCR5⁺ Tfh cells (bottom panel) from WT and *Pdk1*^fl/fl::*Rosa26^CreER*::SMARTA mice on 3 dpi. Cumulative data on frequency of BrdU⁺ cells are shown on the right (*n =* 6). (E) Quantitative RT-PCR analysis of selected genes in donor-derived CXCR5⁺ Tfh cells from recipients as in (A) (n = 3). (F) Schematic of the Tamoxifen-induced deletion system used for characterization of late Tfh cell differentiation. WT and *Pdk1*^fl/fl::*Rosa26^CreER* mice were treated with Tamoxifen from day 4 to day 7 post-LCMV infection and analyzed on 8 dpi. (G) Quantitative RT-PCR analysis of *Pdk1* abundance in Tfh cells from WT and *Pdk1*^fl/fl::*Rosa26^CreER* mice on 8 dpi as in (F) (n ≥ 5). (H) Flow cytometry analysis of CD44⁺CXCR5⁺ Tfh cells (top panel) gated on CD4⁺ T cells and Bcl-6⁺CXCR5⁺ GC Tfh cells (bottom panel) gated on CD44⁺CD62L^-CD4⁺ T cells on 8 dpi with representative contour plots and cumulative data (n ≥ 5). (I) Contour plots represents BrdU⁺ cells gated on activated CD4⁺CD44⁺ T cells (top panel) and CD44⁺CXCR5⁺ Tfh cells (bottom panel) from WT and *Pdk1*^fl/fl::*Rosa26^CreER* mice on 8 dpi. Cumulative data on frequency of BrdU⁺ cells are shown on the right (n ≥ 5). Data are representative of at least three independent experiments (**B–C, E, G–H**) or pooled from two independent experiments (D). Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 4—source data 1 PDK1 is essential for Tfh cell differentiation at both early and late stages.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig4-data1-v1.xlsx
Download elife-61406-fig4-data1-v1.xlsx

Figure 4—figure supplement 1

Download asset Open asset

Detection of apoptosis of activated CD4⁺ T cells and Tfh cells.

(A) Contour plots represents Caspase-3⁺ cells gated on donor-derived activated CD4⁺ T cells (top panel) and CXCR5⁺ Tfh cells (bottom panel) from WT and *Pdk1*^fl/fl::*Rosa26^CreER*::SMARTA mice on 3 dpi. Cumulative data on frequency of Caspase-3⁺ cells are shown on the right (n = 6). (B) Contour plots represents Caspase-3⁺ cells gated on activated CD4⁺CD44⁺ T cells (top panel) and CD44⁺CXCR5⁺ Tfh cell (bottom panel) from WT and *Pdk1*^fl/fl::*Rosa26^CreER* mice on 8 dpi. Cumulative data on frequency of Caspase-3⁺ cells are shown on the right (n ≥ 5). Data are pooled from two independent experiments (A) or representative of at least three independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 4—figure supplement 1—source data 1 Analysis of apoptosis of CD4 T and Tfh cells.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig4-figsupp1-data1-v1.xlsx
Download elife-61406-fig4-figsupp1-data1-v1.xlsx

Figure 5

Download asset Open asset

ICOS-dependent PDK1 promotes transcriptional program for Tfh cells.

(A) RNA-seq analysis of *Pdk1*^fl/fl::*Cd4*-Cre or WT Tfh cells sort-purified on 8 dpi. Volcano plot shows genes upregulated (red) or downregulated (blue) in *Pdk1*^fl/fl::*Cd4*-Cre Tfh cells compared with WT cells. (B) KEGG pathway analysis of differentially expressed genes in *Pdk1*^fl/fl::*Cd4*-Cre Tfh cells relative to their expression in WT Tfh cells. (C) GSEA of the Tfh cell gene signature in *Pdk1*^fl/fl::*Cd4*-Cre Tfh cells relative to their expression in WT Tfh cells. (D) Quantitative RT-PCR analysis of selected genes in *Pdk1*^fl/fl::*Cd4*-Cre and WT Tfh cells. Relative expression was normalized to WT cells (n ≥ 4). (E) GSEA of ‘Up-regulated under anti-CD28’, ‘Down-regulated under anti-CD28’, ‘Up-regulated under anti-ICOS-L’, and ‘Down-regulated under anti-ICOS-L’ gene sets in WT and *Pdk1*^fl/fl::*Cd4*-Cre Tfh cells. (**F, G**) Flow cytometry analysis of p-AKT^T308 level on CD4⁺ T cells from WT SMARTA cells, cultured in medium without any stimulus (blank), or stimulated with anti-CD3e + anti-CD28, anti-CD3e + anti-ICOS, anti-CD3e + anti-CD28 + anti-ICOS, anti-ICOS, and anti-CD25. Representative histogram plot and cumulative data are shown in (F) and (G), respectively (n = 3). Data are representative of at least two independent experiments (**D, F, G**). Error bars represent SD. *p<0.05, and ***p<0.001 (Student’s t-test).

Figure 5—source data 1 ICOS-dependent PDK1 activity regulates Tfh cell transcriptional files.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig5-data1-v1.xlsx
Download elife-61406-fig5-data1-v1.xlsx

Figure 6 with 1 supplement

Download asset Open asset

PDK1 deficiency impaired Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.

(A) GSEA of ‘Raptor-activated genes’, ‘Raptor-suppressed genes’, ‘Rictor-activated genes’, and ‘Rictor-suppressed genes’ gene sets in WT and *Pdk1*^fl/fl::*Cd4*-Cre Tfh cells. (B) Flow cytometry analysis of AKT, p-AKT^T308, and p-AKT^S473 levels on *Pdk1*^fl/fl::*Cd4*-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n = 4). (C) Flow cytometry analysis of FoxO1, p-FoxO1/3a, STAT3, p-STAT3^S727, Hif1α, p-S6, GSK3β, p-GSK3β^S9, and TCF1 levels on *Pdk1*^fl/fl::*Cd4*-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n ≥ 4). (**D, E**) Flow cytometry analysis of Tfh populations from recipients adoptively transferred with STAT3-CA, TCF1, Bcl-6, or CXCR5 retrovirus-infected SMARTA cells on 8 dpi by flow cytometry with representative contour plots and cumulative data in (D) and (E), respectively (n ≥ 3). Data are representative of at least two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 6—source data 1 PDK1 regulates Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig6-data1-v1.xlsx
Download elife-61406-fig6-data1-v1.xlsx

Figure 6—figure supplement 1

Download asset Open asset

Analysis of p-PKCζ/λ level in Tfh cells and detection of overexpression level of relative genes in primed CD4⁺ cells via retrovirus transduction.

(A) Flow cytometry analysis of p-PKCζ/λ level on *Pdk1*^fl/fl::*Cd4*-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n = 3). (B) Quantitative RT-PCR analysis of *Tcf7*, *Stat3*, *Bcl6*, or *Cxcr5* in GFP⁺ cells transduced with indicated retrovirus (n = 3). Data are representative of at least two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 6—figure supplement 1—source data 1 Analysis of p-PKCζ/λ level and validation of overexpression efficiency.: https://cdn.elifesciences.org/articles/61406/elife-61406-fig6-figsupp1-data1-v1.xlsx
Download elife-61406-fig6-figsupp1-data1-v1.xlsx

Figure 7

Download asset Open asset

Working model of PDK1 in regulating Tfh cell differentiation.

Left panel: In PDK1-sufficient cells, AKT gets activated by phosphorylation at Thr308 and Ser473. p-AKT activates mTORC1, and mTORC1 further phosphorylates S6 and supports Hif1α expression, promoting protein synthesis, proliferation, and metabolization. mTORC1 also phosphorates STAT3 to induce TCF1 expression. In addition, p-AKT also guards TCF1 activity through the inactivation of GSK3β, an inhibitor of TCF1 and β-catenin. Enhanced TCF1 contributes to Tfh cell differentiation, GC responses, and humoral immunity. Right panel: In PDK1-deficient cells, AKT remains inactivated by loss of phosphorylation at Thr308 and Ser473, which contributes to impaired mTORC1 activity and activities of downstream molecules, inducing p-STAT3-dependent TCF1 expression. In addition, inactivation of p-AKT leads to compromised p-GSK3β, resulting in increased GSK3β activity and subsequently inhibition on TCF1 level. Decreased TCF1 leads to impaired Tfh cell differentiation, GC responses, and humoral immunity.

Author response image 1

Download asset Open asset

Analysis of PD-1, ICOS, and Bcl^-6 expression in naive (A), and Th1 (B) cells.

Author response image 2

Download asset Open asset

Tables

Appendix 1—key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Genetic reagent (M. musculus)	Mouse: C57BL/6J (CD45.2 and CD45.1)	Jackson Laboratory	RRID: IMSR_JAX:000664
Genetic reagent (M. musculus)	Mouse: B6. Cg-Tg(Cd4-cre)1Cwi/BfluJ (Cd4-Cre)	Jackson Laboratory	RRID: IMSR_JAX:022071
Genetic reagent (M. musculus)	Mouse: B6. Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/2J (Rosa26^CreER)	Jackson Laboratory	RRID: IMSR_JAX:008085
Genetic reagent (M. musculus)	Mouse: B6. SMARTA	R. Ahmed	Emory University
Genetic reagent (M. musculus)	Mouse: B6. Pdk1^fl/fl	W. Yuan	Chinese Academy of Medical Sciences and Peking Union Medical College
Cell line (H. sapiens)	HEK293T (human embryonic kidney cells)	ATCC	Cat # CRL-3216, RRID: CVCL_0063
Biological sample (M. musculus)	Primary mouse splenocytes	China Agricultural University		Freshly isolated from mice
Biological sample (M. musculus)	Primary mouse bone marrow cells	China Agricultural University		Freshly isolated from mice
Biological sample (M. musculus)	Primary mouse serum	China Agricultural University		Freshly isolated from mice
Antibody	Rat monoclonal anti-mouse CD19-PE/Cy7	Thermo Fisher Scientific	Cat # 25-0193-82, RRID: AB_657663	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD25-PE	Thermo Fisher Scientific	Cat # 12-0251-83; RRID: AB_465608	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD4-PE/Cy7	Thermo Fisher Scientific	Cat # 25-0041-82; RRID: AB_469576	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD4-APC/eFluor 780	Thermo Fisher Scientific	Cat # 47-0041-82; RRID: AB_11218896	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD4-BV510	BD Biosciences	Cat # 563106; RRID: AB_2687550	IF (1:100)
Antibody	Rat monoclonal anti-mouse/human CD44-FITC	Thermo Fisher Scientific	Cat # 11-0441-82; RRID: AB_465045	FACS (1:100)
Antibody	Rat monoclonal anti-mouse/human CD44-APC	Thermo Fisher Scientific	Cat # 17-0441-83; RRID: AB_469391	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD45.1-APC	Thermo Fisher Scientific	Cat # 17-0453-82; RRID: AB_469398	FACS (1:100)
Antibody	Mouse monoclonal anti-mouse CD45.1- Percp/Cy5.5	Thermo Fisher Scientific	Cat # 45-0453-82; RRID: AB_1107003	FACS (1:100)
Antibody	Mouse monoclonal anti-mouse CD45.2- APC	Thermo Fisher Scientific	Cat # 17-0454-82; RRID: AB_469400	FACS (1:100)
Antibody	Mouse monoclonal anti-mouse CD45.2- eFluor 506	Thermo Fisher Scientific	Cat # 69-0454-82 RRID: AB_2637105	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD62L- BV510	BioLegend	Cat # 104441; RRID: AB_2561537	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD62L- APC	Thermo Fisher Scientific	Cat # 17-0621-83; RRID: AB_469411	FACS (1:100)
Antibody	Rat monoclonal anti-mouse/human CD45R-FITC	Thermo Fisher Scientific	Cat # 11-0452-86; RRID: AB_465056	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD45R- PerCP/Cy5.5	Thermo Fisher Scientific	Cat # 45-0451-82; RRID: AB_1107002	FACS (1:100)
Antibody	Rat monoclonal anti-mouse/human CD45R- Biotin	Thermo Fisher Scientific	Cat # 13-0452-86; RRID: AB_466451	FACS (1:100)
Antibody	Rat monoclonal anti-mouse IgD- APC	Thermo Fisher Scientific	Cat # 17-5993-82; RRID: AB_10598660	IF (1:100)
Antibody	Rat monoclonal anti-mouse/human GL7- eFluor 450	Thermo Fisher Scientific	Cat # 48-5902-82; RRID: AB_10870775	FACS (1:100)
Antibody	Armenian hamster monoclonal anti-mouse PD-1- PE	Thermo Fisher Scientific	Cat # 12-9985-82; RRID: AB_466295	FACS (1:100)
Antibody	Rat monoclonal anti-mouse TCR Vα2-PE	Thermo Fisher Scientific	Cat # 12-5812-82; RRID: AB_465949	FACS (1:100)
Antibody	Rat monoclonal anti-mouse/rat Foxp3-PerCP/Cy5.5	Thermo Fisher Scientific	Cat # 45-5773-82 ; RRID: AB_914351	FACS (1:100)
Antibody	Rat monoclonal anti-mouse/rat Foxp3-APC	Thermo Fisher Scientific	Cat # 17-5773-82 ; RRID: AB_469457	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD138-PE	BD Biosciences	Cat # 553714; RRID: AB_395000	FACS (1:100)
Antibody	Rat monoclonal anti-mouse CD138-BV421	BD Biosciences	Cat # 562610; RRID: AB_11153126	FACS (1:100)
Antibody	Armenian hamster monoclonal anti-mouse Fas-PE	BD Biosciences	Cat # 561985; RRID: AB_10895586	FACS (1:100)
Antibody	Mouse monoclonal anti-mouse/human Bcl6-PE	BD Biosciences	Cat # 561522; RRID: AB_10717126	FACS (1:40)
Antibody	Rat monoclonal anti-mouse SLAM-PE	BioLegend	Cat # 115904; RRID: AB_10895586	FACS (1:100)
Antibody	Rat monoclonal anti-mouse SLAM-APC	BioLegend	Cat # 115910; RRID: AB_493460	FACS (1:100)
Antibody	Rat monoclonal anti-mouse/human ICOS-PE/Cy7	BioLegend	Cat # 313520; RRID: AB_10643411	FACS (1:100)
Antibody	Rat monoclonal anti-mouse IFN-γ-FITC	Thermo Fisher Scientific	Cat # 11-7311-82; RRID: AB_465412	FACS (1:100)
Antibody	Rat monoclonal anti-mouse IL-17a-PE	BD Biosciences	Cat # 559502; RRID: AB_397256	FACS (1:100)
Antibody	Rat monoclonal anti-mouse IL-4-PE/Cy7	Thermo Fisher Scientific	Cat # 25-7041-80; RRID: AB_2573519	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/human TCF1	Cell Signaling Technology	Cat # 2203; RRID: AB_2199302	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human PDK1	Cell Signaling Technology	Cat # 3062; RRID: AB_2236832	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/human Hif1a	Cell Signaling Technology	Cat # 36169; RRID: AB_2799095	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human FoxO1	Cell Signaling Technology	Cat # 2880; RRID: AB_2106495	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human p-AKT^T308	Cell Signaling Technology	Cat # 13038; RRID: AB_2629447	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human p-AKT^S473	Cell Signaling Technology	Cat # 4060; RRID: AB_2315049	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human p-S6^S235/236	Cell Signaling Technology	Cat # 4858; RRID: AB_916156	FACS (1:100)
Antibody	Rabbit polyclone anti-mouse/rat/human p-FoxO1/3a	Cell Signaling Technology	Cat # 9464; RRID: AB_329842	FACS (1:100)
Antibody	Rabbit polyclone anti-mouse/rat/human p-PKCζ/λ	Cell Signaling Technology	Cat # 9378; RRID: AB_2168217	FACS (1:100)
Antibody	Rabbit polyclone anti-mouse/rat/human AKT	Beyotime Biotechnology	Cat # AA326	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/human GSK3β	Beyotime Biotechnology	Cat # AF1543	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human p-GSK3β^S9	Cell Signaling Technology	Cat # 5558 RRID: AB_10013750	FACS (1:100)
Antibody	Rabbit polyclone anti-mouse/rat/human p-STAT3^S727	Cell Signaling Technology	Cat # 9134 RRID: AB_331589	FACS (1:100)
Antibody	Rabbit monoclonal anti-mouse/rat/human STAT3	Cell Signaling Technology	Cat # 4904 RRID: AB_331269	FACS (1:100)
Antibody	Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-FITC	BioLegend	Cat # 406403; RRID: AB_893531	FACS (1:1000)
Antibody	Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-AF647	BioLegend	Cat # 406414; RRID: AB_2563202	FACS (1:1000)
Transfected construct (M. musculus)	MIGR1 (MSCV-IRES-GFP) (plasmid)	This paper	N/A	Retrovirus construct to transfect
Transfected construct (M. musculus)	MIGR1-Tcf7 overexpressing (plasmid)	This paper	N/A	Retrovirus construct to transfect
Transfected construct (M. musculus)	MIGR1-Bcl6 overexpressing (plasmid)	This paper	N/A	Retrovirus construct to transfect
Transfected construct (M. musculus)	MIGR1-STAT3-CA (constitutive-active) (plasmid)	This paper	N/A	Retrovirus construct to transfect
Transfected construct (M. musculus)	MIGR1-Cxcr5 overexpressing (plasmid)	This paper	N/A	Retrovirus construct to transfect
Sequence-based reagent	Tcf7_F	This paper	PCR primers	CCCTTCCTGCGGATATAGAC
Sequence-based reagent	Tcf7_R	This paper	PCR primers	GGTACACCAGATCCCAGCAT
Sequence-based reagent	Cxcr5_F	This paper	PCR primers	CATGGGCTCCATCACATACA
Sequence-based reagent	Cxcr5_R	This paper	PCR primers	GGCATGAATACCGCCTTAAA
Sequence-based reagent	Bcl6_F	This paper	PCR primers	AGACGCACAGTGACAAACCA
Sequence-based reagent	Bcl6_R	This paper	PCR primers	AGTGTGGGTCTTCAGGTTGG
Sequence-based reagent	Icos_F	This paper	PCR primers	TGCCGTGTCTTTGTCTTCTG
Sequence-based reagent	Icos_R	This paper	PCR primers	CTTCCCTTGGTCTTGGTGAG
Sequence-based reagent	Pdcd1_F	This paper	PCR primers	CTGGTCATTCACTTGGGCTG
Sequence-based reagent	Pdcd1_R	This paper	PCR primers	AAACCATTACAGAAGGCGGC
Sequence-based reagent	Maf_F	This paper	PCR primers	AGCAGTTGGTGACCATGTCG
Sequence-based reagent	Maf_R	This paper	PCR primers	TGGAGATCTCCTGCTTGAGG
Sequence-based reagent	Hif1a_F	This paper	PCR primers	CCTTAACCTGTCTGCCACTTTG
Sequence-based reagent	Hif1a_R	This paper	PCR primers	TCAGCTGTGGTAATCCACTCTC
Sequence-based reagent	Gzmb_F	This paper	PCR primers	CAAAGACCAAACGTGCTTCC
Sequence-based reagent	Gzmb_R	This paper	PCR primers	CTCAGCTCTAGGGACGATGG
Sequence-based reagent	Id2_F	This paper	PCR primers	GTCCTTGCAGGCATCTGAAT
Sequence-based reagent	Id2_R	This paper	PCR primers	TTCAACGTGTTCTCCTGGTG
Sequence-based reagent	Prdm1_F	This paper	PCR primers	ACAGAGGCCGAGTTTGAAGAGA
Sequence-based reagent	Prdm1_R	This paper	PCR primers	AAGGATGCCTCGGCTTGAA
Sequence-based reagent	Gata3_F	This paper	PCR primers	CTTATCAAGCCCAAGCGAAG
Sequence-based reagent	Gata3_R	This paper	PCR primers	CATTAGCGTTCCTCCTCCAG
Sequence-based reagent	Stat3_F	This paper	PCR primers	CAATACCATTGACCTGCCGAT
Sequence-based reagent	Stat3_R	This paper	PCR primers	GAGCGACTCAAACTGCCCT
Peptide, recombinant protein	KLH	Sigma–Aldrich	Cat# H7017
Peptide, recombinant protein	GP_61-80 (GLNGPDIYKGVYQFKSVEFD)	Synthesized by ChinaPeptides	N/A
Peptide, recombinant protein	recombinant murine IL-2	R and D	Cat # 212–12
Peptide, recombinant protein	recombinant murine IL-7	R and D	Cat # 217–17
Commercial assay or kit	Phosflow Lyse/Fix buffer, 5X	BD Biosciences	Cat # 558049; RRID: AB_2869117
Commercial assay or kit	Phosflow Perm buffer I	BD Biosciences	Cat # 557885 RRID: AB_2869104
Commercial assay or kit	Caspase-3 Staining Kit	Thermo Fisher Scientific	Cat # 88-7004-42; RRID: AB_2574939
Commercial assay or kit	Fixation/Permeabilization Solution Kit	BD Biosciences	Cat # 554714 RRID: AB_2869008
Commercial assay or kit	Dynabeads M-280 Streptavidin	Thermo Fisher Scientific	Cat # 60210
Commercial assay or kit	Lipofectamine 2000 Reagent	Thermo Fisher Scientific	Cat # 11668019
Commercial assay or kit	RNeasy Mini Kit	Qiagen	Cat # 74106
Commercial assay or kit	FastQuant RT Kit	Tiangen	Cat # KR106-02
Commercial assay or kit	SuperReal PreMix Plus SYBR Green	Tiangen	Cat # FP205-02
Chemical compound, drug	Freund’s Adjuvant, Complete	Sigma–Aldrich	Cat # F5881
Chemical compound, drug	Tamoxifen	Sigma–Aldrich	Cat # T5648
Chemical compound, drug	Corn Oil	Sigma–Aldrich	Cat # C8267
Chemical compound, drug	PMA	Sigma–Aldrich	Cat # P8139
Chemical compound, drug	Ionomycin	Sigma–Aldrich	Cat # I0634
Chemical compound, drug	Polybrene	Sigma–Aldrich	Cat # H9268
Software, algorithm	Flowjo v10.5	Treestar	RRID: SCR_008520
Software, algorithm	Graphpad Prism 8	Graphpad	RRID: SCR_002798
Software, algorithm	Adobe Illustrator	Adobe	RRID: SCR_010279
Software, algorithm	GSEA	http://www.broadinstitute.org/gsea/	RRID: SCR_003199
Other	7-AAD	BD Biosciences	Cat # 559925 RRID: AB_2869266
Other	PNA-FITC	Vector Laboratories	Cat # FL-1071; RRID: AB_2315097	FACS (1:500)
Other	PNA-Biotin	Vector Laboratories	Cat# BA-0074; RRID: AB_2336190	IF (1:50)
Other	Streptavidin-APC/eFluor 780	Thermo Fisher Scientific	Cat # 47-4317-82; RRID: AB_10366688	FACS (1:500)
Other	Streptavidin-eFluor 450	Thermo Fisher Scientific	Cat # 48-4317-82; RRID: AB_10359737	FACS (1:500)