The kinase PDK1 is critical for promoting T follicular helper cell differentiation
- State Key Laboratory of Agrobiotechnology, College of Biological Sciences, China Agricultural University, China
- State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, and Center for Stem Cell Medicine, Chinese Academy of Medical Sciences and Peking Union Medical College, China
Figures
Figure 1
PDK1 supports Tfh cell differentiation and effector functions.
(A) Flow cytometry analysis of PDK1 expression in naïve CD4+ T (CD62LhiCD44lo), Th1, and Tfh cells from C57BL/6J mice on 8 dpi. Quantification of PDK1 MFI is shown on the right (n = 8). (B) …
-
Figure 1—source data 1
PDK1 supports Tfh cell differentiation and effector functions.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig1-data1-v1.xlsx
Figure 2 with 1 supplement
PDK1 is essential for Tfh cell differentiation upon protein immunization.
(A, B) Flow cytometry analysis of CD44+CXCR5+ Tfh cells and CD44+CXCR5− Th1 cells gated on splenic CD4+ T cells (top panel) or PD-1hiCXCR5+ GC Tfh cells (middle panel) and Bcl-6hiCXCR5+ GC Tfh cells …
-
Figure 2—source data 1
PDK1 is essential for Tfh cell differentiation and GC responses upon KLH immunization.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Analysis of T helper cells upon KLH immunization.
(A) Splenocytes from WT and Pdk1fl/fl::Cd4-Cre mice on day 8 post-KLH immunization were restimulated with PMA and Ionomycin at 37℃ for 5 hr. Then the cells were surface stained, followed by …
-
Figure 2—figure supplement 1—source data 1
Analysis of distinct T helper subsets upon KLH immunization.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig2-figsupp1-data1-v1.xlsx
Figure 3
PDK1 intrinsically regulates Tfh cell differentiation.
(A) Generation of bone marrow (BM) chimeric mice. BM cells from WT or Pdk1fl/fl::Cd4-Cre mice (CD45.2+) were mixed with WT (CD45.1+CD45.2+) competitor cells at a 1:1 ratio, and transferred to …
-
Figure 3—source data 1
PDK1 intrinsically programs Tfh cell differentiation.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig3-data1-v1.xlsx
Figure 4 with 1 supplement
PDK1 is required for both early differentiation and late maintenance of Tfh cells.
(A) Schematic of the SMARTA cell transfer system used for characterization of early Tfh cell commitment. SMARTA CD4+ T cells from Pdk1fl/fl::Rosa26CreER::SMARTA mice were transferred into C57BL/6J …
-
Figure 4—source data 1
PDK1 is essential for Tfh cell differentiation at both early and late stages.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Detection of apoptosis of activated CD4+ T cells and Tfh cells.
(A) Contour plots represents Caspase-3+ cells gated on donor-derived activated CD4+ T cells (top panel) and CXCR5+ Tfh cells (bottom panel) from WT and Pdk1fl/fl::Rosa26CreER::SMARTA mice on 3 dpi. …
-
Figure 4—figure supplement 1—source data 1
Analysis of apoptosis of CD4 T and Tfh cells.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig4-figsupp1-data1-v1.xlsx
Figure 5
ICOS-dependent PDK1 promotes transcriptional program for Tfh cells.
(A) RNA-seq analysis of Pdk1fl/fl::Cd4-Cre or WT Tfh cells sort-purified on 8 dpi. Volcano plot shows genes upregulated (red) or downregulated (blue) in Pdk1fl/fl::Cd4-Cre Tfh cells compared with WT …
-
Figure 5—source data 1
ICOS-dependent PDK1 activity regulates Tfh cell transcriptional files.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig5-data1-v1.xlsx
Figure 6 with 1 supplement
PDK1 deficiency impaired Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.
(A) GSEA of ‘Raptor-activated genes’, ‘Raptor-suppressed genes’, ‘Rictor-activated genes’, and ‘Rictor-suppressed genes’ gene sets in WT and Pdk1fl/fl::Cd4-Cre Tfh cells. (B) Flow cytometry analysis …
-
Figure 6—source data 1
PDK1 regulates Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Analysis of p-PKCζ/λ level in Tfh cells and detection of overexpression level of relative genes in primed CD4+ cells via retrovirus transduction.
(A) Flow cytometry analysis of p-PKCζ/λ level on Pdk1fl/fl::Cd4-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n = 3). (B) Quantitative …
-
Figure 6—figure supplement 1—source data 1
Analysis of p-PKCζ/λ level and validation of overexpression efficiency.
- https://cdn.elifesciences.org/articles/61406/elife-61406-fig6-figsupp1-data1-v1.xlsx
Figure 7
Working model of PDK1 in regulating Tfh cell differentiation.
Left panel: In PDK1-sufficient cells, AKT gets activated by phosphorylation at Thr308 and Ser473. p-AKT activates mTORC1, and mTORC1 further phosphorylates S6 and supports Hif1α expression, …
Author response image 1
Analysis of PD-1, ICOS, and Bcl-6 expression in naive (A), and Th1 (B) cells.
Author response image 2
Analysis of transduction efficiency.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Mouse: C57BL/6J (CD45.2 and CD45.1) | Jackson Laboratory | RRID: IMSR_JAX:000664 | |
| Genetic reagent (M. musculus) | Mouse: B6. Cg-Tg(Cd4-cre)1Cwi/BfluJ (Cd4-Cre) | Jackson Laboratory | RRID: IMSR_JAX:022071 | |
| Genetic reagent (M. musculus) | Mouse: B6. Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/2J (Rosa26CreER) | Jackson Laboratory | RRID: IMSR_JAX:008085 | |
| Genetic reagent (M. musculus) | Mouse: B6. SMARTA | R. Ahmed | Emory University | |
| Genetic reagent (M. musculus) | Mouse: B6. Pdk1fl/fl | W. Yuan | Chinese Academy of Medical Sciences and Peking Union Medical College | |
| Cell line (H. sapiens) | HEK293T (human embryonic kidney cells) | ATCC | Cat # CRL-3216, RRID: CVCL_0063 | |
| Biological sample (M. musculus) | Primary mouse splenocytes | China Agricultural University | Freshly isolated from mice | |
| Biological sample (M. musculus) | Primary mouse bone marrow cells | China Agricultural University | Freshly isolated from mice | |
| Biological sample (M. musculus) | Primary mouse serum | China Agricultural University | Freshly isolated from mice | |
| Antibody | Rat monoclonal anti-mouse CD19-PE/Cy7 | Thermo Fisher Scientific | Cat # 25-0193-82, RRID: AB_657663 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD25-PE | Thermo Fisher Scientific | Cat # 12-0251-83; RRID: AB_465608 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD4-PE/Cy7 | Thermo Fisher Scientific | Cat # 25-0041-82; RRID: AB_469576 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD4-APC/eFluor 780 | Thermo Fisher Scientific | Cat # 47-0041-82; RRID: AB_11218896 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD4-BV510 | BD Biosciences | Cat # 563106; RRID: AB_2687550 | IF (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD44-FITC | Thermo Fisher Scientific | Cat # 11-0441-82; RRID: AB_465045 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD44-APC | Thermo Fisher Scientific | Cat # 17-0441-83; RRID: AB_469391 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD45.1-APC | Thermo Fisher Scientific | Cat # 17-0453-82; RRID: AB_469398 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse CD45.1- Percp/Cy5.5 | Thermo Fisher Scientific | Cat # 45-0453-82; RRID: AB_1107003 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse CD45.2- APC | Thermo Fisher Scientific | Cat # 17-0454-82; RRID: AB_469400 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse CD45.2- eFluor 506 | Thermo Fisher Scientific | Cat # 69-0454-82 RRID: AB_2637105 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD62L- BV510 | BioLegend | Cat # 104441; RRID: AB_2561537 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD62L- APC | Thermo Fisher Scientific | Cat # 17-0621-83; RRID: AB_469411 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD45R-FITC | Thermo Fisher Scientific | Cat # 11-0452-86; RRID: AB_465056 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD45R- PerCP/Cy5.5 | Thermo Fisher Scientific | Cat # 45-0451-82; RRID: AB_1107002 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD45R- Biotin | Thermo Fisher Scientific | Cat # 13-0452-86; RRID: AB_466451 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IgD- APC | Thermo Fisher Scientific | Cat # 17-5993-82; RRID: AB_10598660 | IF (1:100) |
| Antibody | Rat monoclonal anti-mouse/human GL7- eFluor 450 | Thermo Fisher Scientific | Cat # 48-5902-82; RRID: AB_10870775 | FACS (1:100) |
| Antibody | Armenian hamster monoclonal anti-mouse PD-1- PE | Thermo Fisher Scientific | Cat # 12-9985-82; RRID: AB_466295 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse TCR Vα2-PE | Thermo Fisher Scientific | Cat # 12-5812-82; RRID: AB_465949 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/rat Foxp3-PerCP/Cy5.5 | Thermo Fisher Scientific | Cat # 45-5773-82 ; RRID: AB_914351 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/rat Foxp3-APC | Thermo Fisher Scientific | Cat # 17-5773-82 ; RRID: AB_469457 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD138-PE | BD Biosciences | Cat # 553714; RRID: AB_395000 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD138-BV421 | BD Biosciences | Cat # 562610; RRID: AB_11153126 | FACS (1:100) |
| Antibody | Armenian hamster monoclonal anti-mouse Fas-PE | BD Biosciences | Cat # 561985; RRID: AB_10895586 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse/human Bcl6-PE | BD Biosciences | Cat # 561522; RRID: AB_10717126 | FACS (1:40) |
| Antibody | Rat monoclonal anti-mouse SLAM-PE | BioLegend | Cat # 115904; RRID: AB_10895586 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse SLAM-APC | BioLegend | Cat # 115910; RRID: AB_493460 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human ICOS-PE/Cy7 | BioLegend | Cat # 313520; RRID: AB_10643411 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IFN-γ-FITC | Thermo Fisher Scientific | Cat # 11-7311-82; RRID: AB_465412 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IL-17a-PE | BD Biosciences | Cat # 559502; RRID: AB_397256 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IL-4-PE/Cy7 | Thermo Fisher Scientific | Cat # 25-7041-80; RRID: AB_2573519 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/human TCF1 | Cell Signaling Technology | Cat # 2203; RRID: AB_2199302 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human PDK1 | Cell Signaling Technology | Cat # 3062; RRID: AB_2236832 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/human Hif1a | Cell Signaling Technology | Cat # 36169; RRID: AB_2799095 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human FoxO1 | Cell Signaling Technology | Cat # 2880; RRID: AB_2106495 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-AKTT308 | Cell Signaling Technology | Cat # 13038; RRID: AB_2629447 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-AKTS473 | Cell Signaling Technology | Cat # 4060; RRID: AB_2315049 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-S6S235/236 | Cell Signaling Technology | Cat # 4858; RRID: AB_916156 | FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human p-FoxO1/3a | Cell Signaling Technology | Cat # 9464; RRID: AB_329842 | FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human p-PKCζ/λ | Cell Signaling Technology | Cat # 9378; RRID: AB_2168217 | FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human AKT | Beyotime Biotechnology | Cat # AA326 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/human GSK3β | Beyotime Biotechnology | Cat # AF1543 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-GSK3βS9 | Cell Signaling Technology | Cat # 5558 RRID: AB_10013750 | FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human p-STAT3S727 | Cell Signaling Technology | Cat # 9134 RRID: AB_331589 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human STAT3 | Cell Signaling Technology | Cat # 4904 RRID: AB_331269 | FACS (1:100) |
| Antibody | Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-FITC | BioLegend | Cat # 406403; RRID: AB_893531 | FACS (1:1000) |
| Antibody | Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-AF647 | BioLegend | Cat # 406414; RRID: AB_2563202 | FACS (1:1000) |
| Transfected construct (M. musculus) | MIGR1 (MSCV-IRES-GFP) (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-Tcf7 overexpressing (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-Bcl6 overexpressing (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-STAT3-CA (constitutive-active) (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-Cxcr5 overexpressing (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Sequence-based reagent | Tcf7_F | This paper | PCR primers | CCCTTCCTGCGGATATAGAC |
| Sequence-based reagent | Tcf7_R | This paper | PCR primers | GGTACACCAGATCCCAGCAT |
| Sequence-based reagent | Cxcr5_F | This paper | PCR primers | CATGGGCTCCATCACATACA |
| Sequence-based reagent | Cxcr5_R | This paper | PCR primers | GGCATGAATACCGCCTTAAA |
| Sequence-based reagent | Bcl6_F | This paper | PCR primers | AGACGCACAGTGACAAACCA |
| Sequence-based reagent | Bcl6_R | This paper | PCR primers | AGTGTGGGTCTTCAGGTTGG |
| Sequence-based reagent | Icos_F | This paper | PCR primers | TGCCGTGTCTTTGTCTTCTG |
| Sequence-based reagent | Icos_R | This paper | PCR primers | CTTCCCTTGGTCTTGGTGAG |
| Sequence-based reagent | Pdcd1_F | This paper | PCR primers | CTGGTCATTCACTTGGGCTG |
| Sequence-based reagent | Pdcd1_R | This paper | PCR primers | AAACCATTACAGAAGGCGGC |
| Sequence-based reagent | Maf_F | This paper | PCR primers | AGCAGTTGGTGACCATGTCG |
| Sequence-based reagent | Maf_R | This paper | PCR primers | TGGAGATCTCCTGCTTGAGG |
| Sequence-based reagent | Hif1a_F | This paper | PCR primers | CCTTAACCTGTCTGCCACTTTG |
| Sequence-based reagent | Hif1a_R | This paper | PCR primers | TCAGCTGTGGTAATCCACTCTC |
| Sequence-based reagent | Gzmb_F | This paper | PCR primers | CAAAGACCAAACGTGCTTCC |
| Sequence-based reagent | Gzmb_R | This paper | PCR primers | CTCAGCTCTAGGGACGATGG |
| Sequence-based reagent | Id2_F | This paper | PCR primers | GTCCTTGCAGGCATCTGAAT |
| Sequence-based reagent | Id2_R | This paper | PCR primers | TTCAACGTGTTCTCCTGGTG |
| Sequence-based reagent | Prdm1_F | This paper | PCR primers | ACAGAGGCCGAGTTTGAAGAGA |
| Sequence-based reagent | Prdm1_R | This paper | PCR primers | AAGGATGCCTCGGCTTGAA |
| Sequence-based reagent | Gata3_F | This paper | PCR primers | CTTATCAAGCCCAAGCGAAG |
| Sequence-based reagent | Gata3_R | This paper | PCR primers | CATTAGCGTTCCTCCTCCAG |
| Sequence-based reagent | Stat3_F | This paper | PCR primers | CAATACCATTGACCTGCCGAT |
| Sequence-based reagent | Stat3_R | This paper | PCR primers | GAGCGACTCAAACTGCCCT |
| Peptide, recombinant protein | KLH | Sigma–Aldrich | Cat# H7017 | |
| Peptide, recombinant protein | GP61-80 (GLNGPDIYKGVYQFKSVEFD) | Synthesized by ChinaPeptides | N/A | |
| Peptide, recombinant protein | recombinant murine IL-2 | R and D | Cat # 212–12 | |
| Peptide, recombinant protein | recombinant murine IL-7 | R and D | Cat # 217–17 | |
| Commercial assay or kit | Phosflow Lyse/Fix buffer, 5X | BD Biosciences | Cat # 558049; RRID: AB_2869117 | |
| Commercial assay or kit | Phosflow Perm buffer I | BD Biosciences | Cat # 557885 RRID: AB_2869104 | |
| Commercial assay or kit | Caspase-3 Staining Kit | Thermo Fisher Scientific | Cat # 88-7004-42; RRID: AB_2574939 | |
| Commercial assay or kit | Fixation/Permeabilization Solution Kit | BD Biosciences | Cat # 554714 RRID: AB_2869008 | |
| Commercial assay or kit | Dynabeads M-280 Streptavidin | Thermo Fisher Scientific | Cat # 60210 | |
| Commercial assay or kit | Lipofectamine 2000 Reagent | Thermo Fisher Scientific | Cat # 11668019 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat # 74106 | |
| Commercial assay or kit | FastQuant RT Kit | Tiangen | Cat # KR106-02 | |
| Commercial assay or kit | SuperReal PreMix Plus SYBR Green | Tiangen | Cat # FP205-02 | |
| Chemical compound, drug | Freund’s Adjuvant, Complete | Sigma–Aldrich | Cat # F5881 | |
| Chemical compound, drug | Tamoxifen | Sigma–Aldrich | Cat # T5648 | |
| Chemical compound, drug | Corn Oil | Sigma–Aldrich | Cat # C8267 | |
| Chemical compound, drug | PMA | Sigma–Aldrich | Cat # P8139 | |
| Chemical compound, drug | Ionomycin | Sigma–Aldrich | Cat # I0634 | |
| Chemical compound, drug | Polybrene | Sigma–Aldrich | Cat # H9268 | |
| Software, algorithm | Flowjo v10.5 | Treestar | RRID: SCR_008520 | |
| Software, algorithm | Graphpad Prism 8 | Graphpad | RRID: SCR_002798 | |
| Software, algorithm | Adobe Illustrator | Adobe | RRID: SCR_010279 | |
| Software, algorithm | GSEA | http://www.broadinstitute.org/gsea/ | RRID: SCR_003199 | |
| Other | 7-AAD | BD Biosciences | Cat # 559925 RRID: AB_2869266 | |
| Other | PNA-FITC | Vector Laboratories | Cat # FL-1071; RRID: AB_2315097 | FACS (1:500) |
| Other | PNA-Biotin | Vector Laboratories | Cat# BA-0074; RRID: AB_2336190 | IF (1:50) |
| Other | Streptavidin-APC/eFluor 780 | Thermo Fisher Scientific | Cat # 47-4317-82; RRID: AB_10366688 | FACS (1:500) |
| Other | Streptavidin-eFluor 450 | Thermo Fisher Scientific | Cat # 48-4317-82; RRID: AB_10359737 | FACS (1:500) |
