Real-time monitoring of peptidoglycan synthesis by membrane-reconstituted penicillin-binding proteins
- Centre for Bacterial Cell Biology, Biosciences Institute, Newcastle University, United Kingdom
- Institute for Science and Technology Austria (IST Austria), Austria
- Membrane Biochemistry and Biophysics, Bijvoet Centre for Biomolecular Research, University of Utrecht, Netherlands
Figures
Figure 1 with 4 supplements
Förster resonance energy transfer (FRET) assay to monitor peptidoglycan synthesis in real time.
(A) Scheme of the reactions of a class A penicillin-binding protein (PBP) (GTase-TPase) with unlabelled lipid II and the two versions of labelled lipid II, yielding a peptidoglycan (PG) product that …
-
Figure 1—source data 1
Numerical data to support graphs in Figure 1 and original gel images for Figure 1B.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig1-data1-v2.zip
Figure 1—figure supplement 1
Fluorescent lipid II analogues to monitor peptidoglycan synthesis in real time.
(A) Chemical structures of lipid II analogues used for the Förster resonance energy transfer assay. R corresponds to Atto550n (donor) or Atto647n (acceptor) in the corresponding analogue. The …
Figure 1—figure supplement 2
Analysis of fluorescence spectra to calculate Förster resonance energy transfer (FRET) efficiency.
Examples of deconvolution of the fluorescence spectra of peptidoglycan samples prepared in the presence of lipid II-Atto550, Lipid II-Atto647n, and unlabelled lipid II, obtained from a reaction …
-
Figure 1—figure supplement 2—source data 1
Numerical data to support graphs in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig1-figsupp2-data1-v2.xlsx
Figure 1—figure supplement 3
Förster resonance energy transfer assay to monitor peptidoglycan synthesis in real time.
-
Figure 1—figure supplement 3—source data 1
Original gel images for Figure 1—figure supplement 3.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig1-figsupp3-data1-v2.zip
Figure 1—figure supplement 4
Fluorescence intensity (FI) of lipid II-Atto550 and lipid II-Atto647n only changes significantly during reactions when both versions are present.
FI at the acceptor and donor emission wavelengths (590 and 680 nm, respectively) only changed significantly when there was peptidoglycan synthesis activity, and both lipid II-Atto647n and lipid …
-
Figure 1—figure supplement 4—source data 1
Numerical data to support graphs in Figure 1—figure supplement 4.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig1-figsupp4-data1-v2.xlsx
Figure 2 with 1 supplement
The Förster resonance energy transfer (FRET) signal arises from both the glycosyltransferase and transpeptidase reactions.
(A) Peptidoglycan (PG) synthesized in reactions of PBP1BEc in the presence or absence of 1 mM ampicillin was incubated with no PG hydrolase (U), DD-endopeptidase MepM (M), or muramidase cellosyl (C),…
-
Figure 2—source data 1
Numerical data to support graphs in Figure 2 and original gel images for Figure 2B.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig2-data1-v2.zip
Figure 2—figure supplement 1
Effect of proportion of labelled lipid II substrates on PBP1BEc activity in detergents.
Triton X-100-solubilized PBP1BEc with or without LpoB were incubated with mixtures of lipid II substrates (14C-lipid II, lipid II-Atto550, and lipid II-Atto647) with increasing molar proportions of …
-
Figure 2—figure supplement 1—source data 1
Numerical data to support graphs in Figure 2—figure supplement 1 and original gel images used to quantify labelled lipid II consumption.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig2-figsupp1-data1-v2.zip
Figure 3 with 8 supplements
The Förster resonance energy transfer (FRET) assay for peptidoglycan synthesis can be adapted for reactions on liposomes.
(A) Class A penicillin-binding proteins (PBPs) were reconstituted in E. coli polar lipid (EcPL) liposomes. To assess the orientation of the liposome-reconstituted PBPs, MGC-64PBP1B-his C777S C795S …
-
Figure 3—source data 1
Numerical data to support graphs in Figure 3 and original gel images for Figure 3C, E and G.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-data1-v2.zip
Figure 3—figure supplement 1
Activity of membrane-reconstituted PBP1BEc is optimal in E. coli polar lipids at low ionic strength.
(A) Representative SDS-PAGE analysis of the reconstitution of PBP1BEc in liposomes made of E. coli polar lipids at a 1:3000 mol:mol protein:lipid ratio. After reconstitution, proteoliposome samples …
Figure 3—figure supplement 2
The Förster resonance energy transfer (FRET) assay for peptidoglycan synthesis can be adapted for reactions on liposomes.
(A) Comparison of the two possible outcomes of FRET curves for reactions of PBP1BEc liposomes assayed in the presence of LpoB and ampicillin (left) and the final SDS-PAGE analysis of the same …
-
Figure 3—figure supplement 2—source data 1
Numerical data to support graphs in Figure 3—figure supplement 2 and original gel images for Figure 3—figure supplement 2A.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-figsupp2-data1-v2.zip
Figure 3—figure supplement 3
Moenomycin does not affect Förster resonance energy transfer (FRET) on liposomes with lipid II-Atto550 and lipid II-Atto647n in the absence of class A penicillin-binding proteins.
(A) E. coli polar lipids liposomes incorporating an equimolar amount of lipid II-Atto550 and lipid II-Atto647n at 0.5% mol of the total lipid contents were incubated in the presence of 12 µM lipid …
-
Figure 3—figure supplement 3—source data 1
Numerical data to support graphs in Figure 3—figure supplement 3.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-figsupp3-data1-v2.xlsx
Figure 3—figure supplement 4
Fluorescence intensity (FI) of lipid II-Atto550 and lipid II-Atto647n in the membrane only changes significantly during reactions when both species are present.
FI at the acceptor and donor emission wavelengths (590 and 680 nm, respectively) only changed significantly when there was peptidoglycan synthesis activity in liposomes and both lipid II-Atto647n …
-
Figure 3—figure supplement 4—source data 1
Numerical data to support graphs in Figure 3—figure supplement 4.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-figsupp4-data1-v2.xlsx
Figure 3—figure supplement 5
Amino acid sequence comparison between LpoP homologues from A.baumannii and P.aeruginosa.
(A) In the genomes of A. baumannii and P. aeruginosa, the gene encoding LpoP is present within the same operon as the gene encoding their cognate PBP1B. Both LpoP proteins are predicted lipoproteins …
Figure 3—figure supplement 6
LpoPAb stimulates the glycosyltransferase activity of PBP1BAb.
(A) Real-time glycosyltransferase activity assays using dansyl-lipid II and detergent-solubilized A. baumannii PBP1B (PBP1BAb). PBP1BAb (0.5 µM) was mixed with 10 µM dansyl-lipid II in the presence …
-
Figure 3—figure supplement 6—source data 1
Numerical data to support graphs in Figure 3—figure supplement 6.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-figsupp6-data1-v2.xlsx
Figure 3—figure supplement 7
Peptidoglycan synthesis activity of A.baumannii PBP1B in the presence of Triton X-100 followed by Förster resonance energy transfer (FRET).
(A) Representative FRET curves for activity assays using detergent-solubilized A. baumannii PBP1B (PBP1BAb). PBP1BAb (0.5 µM) was mixed with unlabelled lipid II, Atto550-labelled lipid II, and …
-
Figure 3—figure supplement 7—source data 1
Numerical data to support graphs in Figure 3—figure supplement 7 and original gel images for gels in Figure 3—figure supplement 7C.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-figsupp7-data1-v2.zip
Figure 3—figure supplement 8
Peptidoglycan synthesis activity of P. aeruginosa PBP1B in the presence of Triton X-100 followed by Förster resonance energy transfer (FRET).
(A) Representative FRET curves for activity assays using detergent-solubilized P. aeruginosa PBP1B (PBP1BPa). PBP1BPa (0.5 µM) was mixed with unlabelled lipid II, Atto550-labelled lipid II, and …
-
Figure 3—figure supplement 8—source data 1
Numerical data to support graphs in Figure 3—figure supplement 8 and original gel images for gels in Figure 3—figure supplement 8C.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig3-figsupp8-data1-v2.zip
Figure 4 with 2 supplements
Addition of lipid II slows down diffusion of PBP1B on supported lipid bilayers.
(A) Schematic illustration of the approach (not to scale). A single-cysteine version of PBP1BEc (MGC-64PBP1B-his C777S C795S) labelled with fluorescent probe Dy647 in its single Cys residue (PBP1BEc-…
-
Figure 4—source data 1
Numerical data to support graphs in Figure 4.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Control of membrane fluidity and integrity upon reconstitution of E. coli PBP1B.
(A) The fluidity of supported lipid bilayers (SLBs) is reduced when increasing PBP1BEc density. The diffusion of phospholipid probe DOPE-rhodamine in the polymer-supported SLB was monitored by …
Figure 4—figure supplement 2
E. coli PBP1B is active after reconstitution in supported lipid bilayers (SLBs).
(A, B) PBP1BEc was reconstituted on supported lipid bilayers prepared with E. coli polar lipid extract in 1.1 cm2 chambers. The protein-to-lipid ratio was 1:105 (mol:mol). Reactions were started by …
Figure 5 with 1 supplement
Förster resonance energy transfer (FRET) assay on a planar lipid membrane.
(A) FRET acquisition by TIRF microscopy. PBP1BEc was reconstituted into a polymer-supported lipid membrane to preserve its lateral diffusion. A supported lipid membrane was formed from E. coli polar …
-
Figure 5—source data 1
Numerical data to support graphs in Figure 5.
- https://cdn.elifesciences.org/articles/61525/elife-61525-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Control of membrane fluidity and integrity during the Förster resonance energy transfer assay.
(A) Fluorescence intensity profiles 1 s after photobleaching taken from the images depicted in Figure 4B. (B) Montage comparing the recovery of fluorescence after photobleaching of a tracer …
Figure 6
Peptidoglycan (PG) synthesis with labelled lipid II versions and detection of Förster resonance energy transfer (FRET).
(A) A mixture of Atto550-lipid II, Atto647n-lipid II, and unlabelled lipid II is utilized by a class A penicillin-binding protein (PBP) with or without inhibition of the TPase activity by a …
Author response image 1
Only Lipid II-Atto647N and Lipid-Atto550 were present in the membrane.
After photobleaching of the acceptor dye (Att647N), we did not observe an donor increase in intensity in the bleached area.
Videos
Video 1
Single-molecule imaging of PBP1B on supported lipid bilayers (SLBs).
PBP1BEc-Dy647 was reconstituted in E. coli polar lipids SLBs at a 1:106 (mol:mol) protein-to-lipid ratio and was tracked using single-molecule TIRF before or after the addition of 1.5 µM lipid II. …
Video 2
Förster resonance energy transfer (FRET) assay on supported lipid bilayers (SLBs).
PBP1BEc was reconstituted in E. coli polar lipids SLBs at a 1:105 (mol:mol) protein-to-lipid ratio along lipid II-Atto647 and lipid II-Atto550. Membranes were incubated with 5 µM lipid II in the …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | BL21(DE3) | New England Biolabs | C2527 | |
| Recombinant DNA reagent | pDML219 | Bertsche et al., 2006 | Expression of N-terminal His-tagged E. coli PBP1B | |
| Recombinant DNA reagent | pKPWV1B | This paper | Expression of N-terminal His-tagged Acinetobacter baumannii19606 (ATCC) PBP1B | |
| Recombinant DNA reagent | pAJFE52 | Caveney et al., 2020 | Expression of N-terminal His-tagged Pseudomonas aeruginosa PBP1B | |
| Recombinant DNA reagent | pMGCPBP1BCS1CS2 | This paper | Expression of E. coli PBP1B version with a single Cys residue in the N-terminus and C-terminal His-tag | |
| Recombinant DNA reagent | pET28His-LpoB(sol) | Egan et al., 2014 | Expression of soluble version of E. coli LpoB with an N-terminal His-tag | |
| Recombinant DNA reagent | pKPWVLpoP | This paper | Expression of N-terminal His-tagged A. baumannii 19606 (ATCC) LpoP | |
| Recombinant DNA reagent | pAJFE57 | Caveney et al., 2020 | Expression of soluble version of P. aeruginosa LpoP with an N-terminal His-tag | |
| Sequence-based reagent | PBP1B.Acineto-NdeI_f | This paper | PCR cloning primers | AGATATCATATGATGAAGTTTGAACGTGGTATC GGTTTCTTC |
| Sequence-based reagent | PBP1B.Acineto-BamHI_r | This paper | PCR cloning primers | GCGGGATCCTTAGTTGTTATAACTACCACTTGA AATG |
| Sequence-based reagent | Seq1_rev_PBP1B_Acineto | This paper | PCR cloning primers | AGGTTCTAAACGGGCAACTC |
| Sequence-based reagent | Seq2_fwd_PBP1B_Acineto | This paper | PCR cloning primers | TGGTTATGGATTGGCCTCTC |
| Sequence-based reagent | Seq3_fwd_PBP1B_Acineto | This paper | PCR cloning primers | CTGGGCAAGCCAGATTGAAG |
| Sequence-based reagent | Seq4_fwd_PBP1B_Acineto | This paper | PCR cloning primers | ACAATTACGCCAGACACCAG |
| Sequence-based reagent | PBP1B-MGC-F | This paper | PCR cloning primers | CATCATCCATGGGCTGTGGCTGGCTATGGCTACTGCTA |
| Sequence-based reagent | PBP1B-CtermH-R | This paper | PCR cloning primers | CATCATCTCGAGATTACTACCAAACATATCCTT |
| Sequence-based reagent | C777S-D | This paper | PCR mutagenesis primers | AACTTTGTTTCCAGCGGTGGC |
| Sequence-based reagent | C777S-C | This paper | PCR mutagenesis primers | GCCACCGCTGGAAACAAAGTT |
| Sequence-based reagent | C795S-D | This paper | PCR mutagenesis primers | CAATCGCTGTCCCAGCAGAGC |
| Sequence-based reagent | C795S-C | This paper | PCR mutagenesis primers | GCTCTGCTGGGACAGCGATTG |
| Chemical compound | [14C]GlcNAc-labelled lipid II (mDAP) | Breukink et al., 2003 Bertsche et al., 2005 | ||
| Chemical compound | Lipid II (mDAP) | Egan et al., 2015 | ||
| Chemical compound | Lipid II (Lys) | Egan et al., 2015 | ||
| Chemical compound | Lipid II-dansyl | Egan et al., 2015 | ||
| Chemical compound | Lipid II-Atto550 | Mohammadi et al., 2014 Van't Veer, 2016 | ||
| Chemical compound | Lipid II-Atto647n | Mohammadi et al., 2014 Van't Veer, 2016 | ||
| Chemical compound | Polar lipid extract from E. coli (EcPL) | Avanti Polar Lipids | 100600P | |
| Chemical compound | 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC) | Avanti Polar Lipids | 850375P | |
| Chemical compound | 1-Palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (POPG) | Avanti Polar Lipids | 840457P | |
| Chemical compound | Tetraoleoyl cardiolipin | Avanti Polar Lipids | 710335P | |
| Chemical compound | Dy647P1-maleimide probe | Dyomics | 647P1-03 | |
| Chemical compound | Alexa Fluor 488 C5 Maleimide | ThermoFisher Scientific | A10254 | |
| Chemical compound | Alexa Fluor 555 C2 maleimide | ThermoFisher Scientific | A20346 | |
| Chemical compound | Triton X-100 | Roche | 10789704001 | |
| Chemical compound | Moenomycin | Sigma | 32404 | |
| Chemical compound | Ampicillin | Sigma | A9518 | |
| Chemical compound | Methyl-β-cyclodextrin | Sigma-Aldrich | 332615 | |
| Chemical compound | Poly(ethylene glycol) Mn8000 | Sigma-Aldrich | 1546605 | |
| Chemical compound | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (DOPE-Rhodamine) | Avanti Polar Lipids | 810150C | |
| Chemical compound | Dioctadecylamine (DODA)-tris-Ni-NTA | Beutel et al., 2014 | ||
| Chemical compound | cOmplete, EDTA-freeProtease Inhibitor Cocktail | Roche Molecular Biochemicals | 5056489001 | |
| Chemical compound | Phenylmethylsulfonylfluoride (PMSF) | Sigma-Aldrich | P7626 | |
| Chemical compound | Ni-NTA superflow resin | Qiagen | 1018142 | |
| Chemical compound | Bio-Beads SM-2 resin | Bio-Rad | 1523920 | |
| Commercial assay, kit | Pierce BCA Protein Assay Kit | ThermoFisher Scientific | 23227 | |
| Commercial assay, kit | HiTrap SP HP column, 1 mL | GE biosciences | 17115101 | |
| Commercial assay, kit | HiTrap Desalting column, 5 mL | GE biosciences | 17140801 | |
| Commercial assay, kit | Prontosil 120–3 C18 AQ reversed-phase column | BISCHOFF Chromatography | 1204F184P3 | |
| Peptide, recombinant protein | DNase | ThermoFisher Scientific | 90083 | |
| Peptide, recombinant protein | Cellosyl | Hoechst (Germany) | Mutanolysin from Sigma (M9901) can also be used | |
| Peptide, recombinant protein | MepM | Federico Corona, following protocol in Singh et al., 2012 | ||
| Chemical compound | His6-tagged (on the C-terminus) neutral peptide | BioMatik | CMSQAALNTRNSEEEVSSRRNNGTRHHHHHH | |
| Software, algorithm | Fiji | https://fiji.sc | ||
| Software, algorithm | Matlab | MathWorks | https://www.mathworks.com | |
| Software, algorithm | frap_analysis | Jönsson, 2020 |
Additional files
-
Supplementary file 1
Table of oligonucleotides used in this study.
- https://cdn.elifesciences.org/articles/61525/elife-61525-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/61525/elife-61525-transrepform-v2.docx
