1. Biochemistry and Chemical Biology

Modular metabolite assembly in Caenorhabditis elegans depends on carboxylesterases and formation of lysosome-related organelles

  1. Henry H Le
  2. Chester JJ Wrobel
  3. Sarah M Cohen
  4. Jingfang Yu
  5. Heenam Park
  6. Maximilian J Helf
  7. Brian J Curtis
  8. Joseph C Kruempel
  9. Pedro Reis Rodrigues
  10. Patrick J Hu
  11. Paul W Sternberg  Is a corresponding author
  12. Frank C Schroeder  Is a corresponding author
  1. Boyce Thompson Institute and Department of Chemistry and Chemical Biology, Cornell University, United States
  2. Division of Biology and Biological Engineering, California Institute of Technology, United States
  3. Department of Molecular and Integrative Physiology, University of Michigan Medical School, United States
  4. Departments of Medicine and Cell and Developmental Biology, Vanderbilt University School of Medicine, United States
https://doi.org/10.7554/eLife.61886
Share this article
Cite this article
  1. Henry H Le
  2. Chester JJ Wrobel
  3. Sarah M Cohen
  4. Jingfang Yu
  5. Heenam Park
  6. Maximilian J Helf
  7. Brian J Curtis
  8. Joseph C Kruempel
  9. Pedro Reis Rodrigues
  10. Patrick J Hu
  11. Paul W Sternberg
  12. Frank C Schroeder
(2020)
Modular metabolite assembly in Caenorhabditis elegans depends on carboxylesterases and formation of lysosome-related organelles
eLife 9:e61886.
https://doi.org/10.7554/eLife.61886
  2. Download BibTeX
  3. Download .RIS
12 figures, 10 tables and 2 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
Modular ascarosides in nematodes and proposed role of the Rab-GTPase GLO-1.

(a) Modular ascarosides are assembled from simple ascarosides, e.g. ascr#1 (5) or ascr#3 (9), and building blocks from other metabolic pathways, e.g. glucosyl uric acid (6), p-aminobenzoic acid (PABA, 8) indole-3-carboxylic acid (11), or succinyl octopamine (12). We hypothesize that glo-1-dependent gut granules play a central role in their biosynthesis. (b) Examples for modular ascarosides and their biological context. (c) UAR-1 in P. pacificus converts simple ascarosides into the 4′-ureidoisobutyric-acid-bearing ascarosides, for example ubas#3 (4). (d) Strategy for comparative metabolomic analysis of LRO-deficient glo-1 mutants. (e) Example for modular ascarosides whose production is increased in glo-1 mutants.

Figure 1—source data 1

Source data for Figure 1d.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Dendrogram of serine hydrolase annotated in C. elegans and Ppa-uar-1 (marked blue).

cest genes (direct homologs of Ppa-uar-1) are colored in red.

Figure 1—figure supplement 2
Download asset Open asset
MS peak areas relative to wildtype (N2) of several building blocks of modular ascarosides.

Bars represent the mean of six replicates and error bars standard deviation.

Figure 1—figure supplement 2—source data 1

Source data for Figure 1—figure supplement 2.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig1-figsupp2-data1-v2.xlsx
Figure 2 with 10 supplements
Download asset Open asset
Comparative metabolomic analysis ofglo-1mutants.

(a) Partial MS2 network (positive ion mode) for C. elegans endo-metabolome highlighting three clusters of modular glucosides that are down regulated in the glo-1 mutants (also see Figure 2—figure supplements 1–4). Red represents downregulated and blue upregulated features compared to wildtype C. elegans. (b) Cluster I feature several modular indole glucoside derivatives. Structures were proposed based on MS2 fragmentation patterns, also see Appendix 1—table 1. Compounds whose non-phosphorylated analogs were synthesized are marked (*). Shown ion chromatograms demonstrate loss of iglu#4 in glo-1 mutants. (c,d) Examples for modular glucosides detected as part of clusters II and III. Ion chromatograms show abolishment of angl#4 (25) (c) and tyglu#4 (26) (d) production in glo-1 mutants. (e) Modular glucosides are derived from combinatorial assembly of a wide range of building blocks. Incorporation of moieties was confirmed via total synthesis of example compounds (green) or stable isotope labeling (blue). For all compounds, 3-phosphorylation was proposed based on the established structures of iglu#2 (16), angl#2 (18), and uglas#11 (3).

Figure 2—figure supplement 1
Download asset Open asset
Full MS2 molecular network of endo-metabolome acquired in positive ion mode (left).

Red and blue represent features that are down- and up-regulated in glo-1 mutant worms, respectively. Clusters II and III with representative modular glucoside structures that are glo-1 dependent (right).

Figure 2—figure supplement 2
Download asset Open asset
Full MS2 molecular network of endo-metabolome acquired in negative ion mode.

Red and blue represent features that are down- and up-regulated in glo-1 mutant worms, respectively.

Figure 2—figure supplement 3
Download asset Open asset
Full MS2 molecular network of exo-metabolome acquired in positive ion mode.

Red and blue represent features that are down- and upregulated in glo-1 mutant worms, respectively.

Figure 2—figure supplement 4
Download asset Open asset
Full MS2 molecular network of exo-metabolome acquired in negative ion mode.

Red and blue represent features that are down- and upregulated in glo-1 mutant worms, respectively.

Figure 2—figure supplement 5
Download asset Open asset
MS peak areas relative to wildtype (N2) of simple and modular ascarosides, glucosylated ascarosides, and phosphorylated ascarosides in glo-1 (a, b, c) and glo-4 (d, e, f) mutant worms.

Bars represent the mean of 6 (glo-1) and 2 (glo-4) biological replicates and error bars standard deviation. (c) Peak area relative to wildtype of simple and modular ascarosides in glo-4 mutant worms. Bars represent the mean of two replicates. n.d., not detected.

Figure 2—figure supplement 5—source data 1

Source data for Figure 2—figure supplement 5a–f.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig2-figsupp5-data1-v2.xlsx
Figure 2—figure supplement 6
Download asset Open asset
Identification of iglu metabolites.

(a) Ion chromatograms of synthetic iglu#4 (19), and the levels of iglu#3 (34) in wildtype (N2), cest-4, cest-2.2 and cest-1.1. (b) MS2 spectra of synthetic iglu#3 (34) and the natural compound. Ion chromatograms of other indole containing glucosides in C. elegans and corresponding synthetic samples (black traces), including iglu#5 (SI-2), whose production is reduced but not abolished in glo-1 mutants, as well as largely glo-1 dependent iglu#7 (SI-3) and, iglu#9 (SI-4).

Figure 2—figure supplement 7
Download asset Open asset
Concentration of simple and modular glucosides in the endo- or exo-metabolomes wild-type C. elegans.

Concentrations were calculated with respect to the volume pre-extraction, that is, the aggregate volume of the worm bodies and the volume of the media. Bars represent mean of six replicates. Error bars are standard deviation of the mean, and p-values are depicted in the Figure.

Figure 2—figure supplement 7—source data 1

Source data for Figure 2—figure supplement 7.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig2-figsupp7-data1-v2.xlsx
Figure 2—figure supplement 8
Download asset Open asset
Production of modular glucosides is life-stage-dependent.

Levels of (a) iglu#2 (16), (b) iglu#4 (19), (c) angl#4 (25), and (d) tyglu#6 (proposed structure, SI-6) at different stages of development of C. elegans.

Figure 2—figure supplement 8—source data 1

Source data for Figure 2—figure supplement 8a–d.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig2-figsupp8-data1-v2.xlsx
Figure 2—figure supplement 9
Download asset Open asset
Peak area relative to wildtype (N2) of building blocks of modular glucosides in glo-1 mutant worms.

Bars represent mean of 6 replicates, with error bar representing standard deviation.

Figure 2—figure supplement 9—source data 1

Source data for Figure 2—figure supplement 9.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig2-figsupp9-data1-v2.xlsx
Figure 2—figure supplement 10
Download asset Open asset
Representative ion chromatograms and MS2 spectra of upregulated leucine- and proline-containing peptides.
Figure 3 with 4 supplements
Download asset Open asset
Carboxylesterases are required for modular assembly.

(a) Serine hydrolase dendrogram relating P. pacificus uar-1 to homologous predicted genes in C. elegans. Ppa-uar-1, cest-3, cest-8, cest-9.2 (green) mediate ester formation at the 4′-position of ascarosides in P. pacificus and C. elegans. Genes shown in red color were selected for the current study. (b,c) Production of ascr#8 (2), ascr#81 (27), and ascr#82 (28) is abolished in cest-2.2 mutants Isogenic revertant strains of the cest-2.2 null mutants in which the STOP-IN cassette was precisely excised, demonstrate wild-type-like recovery of the associated metabolite. (d,e) Production of uglas#1 and uglas#11 is abolished in cest-1.1(null) mutants and recovered in genetic revertants. (f) Biosynthesis of positional isomers uglas#14 (31) and uglas#15 (32) is unaltered or increased in cest-1.1 mutants (f). (g) Production of uglas#1 and uglas#11, but not gluric#1, is abolished in cest-1.1(S213) mutants. (h,i) Production of the anthranilic-acid-modified glucoside iglu#4 is largely abolished in cest-4 mutants and fully recovered in genetic revertants. (j) Production of iglu#6 (36) and iglu#8 (37), whose structures are closely related to that of iglu#4, is not abolished in cest-4 mutants. Ion chromatograms in panels b, d, and g further demonstrate abolishment in glo-1 mutants. n.d., not detected. Error bars are standard deviation of the mean, and p-values are depicted in the Figure.

Figure 3—source data 1

Source data for Figure 3c,e,f,g,I,j.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Relative abundances of ascr#8 (2) and related metabolites in cest-1.1, cest-2.2, cest-4 mutants, and wild type (N2).

Values were normalized relative to ascr#82 (28). Bars represent the mean of 3 replicates, and error bars are standard deviation.

Figure 3—figure supplement 1—source data 1

Source data for Figure 3—figure supplement 1.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig3-figsupp1-data1-v2.xlsx
Figure 3—figure supplement 2
Download asset Open asset
Ion chromatograms demonstrating that abundances of potential precursors of (a) cest-1.1-dependent, (b) cest-2.2-dependent, and (c) cest-4-dependent metabolites is large unchanged in the corresponding mutants.
Figure 3—figure supplement 3
Download asset Open asset
Ion chromatograms demonstrating recovery of (a) cest-1.1-dependent, (b) cest-8-dependent, (c) cest-2.2-dependent, (d) cest-4-dependent metabolites from CRISPR/Cas9 reversions of the corresponding null mutants.
Figure 3—figure supplement 4
Download asset Open asset
Relative abundance of other indole containing glucosides in cest-4 mutants, demonstrating that cest-4 is specifically required for the production of iglu#3 (34) and #4 (19).

Bars represent the mean of three replicates, and error bars are standard deviation.

Figure 3—figure supplement 4—source data 1

Source data for Figure 3—figure supplement 4.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig3-figsupp4-data1-v2.xlsx
Figure 4 with 4 supplements
Download asset Open asset
CEST-2.2 localizes to intestinal granules.

(a) Relative amounts of cest-2.2-dependent metabolites in worms expressing C-terminally mCherry-tagged CEST-2.2. (b) Red fluorescence in intestinal granules in wild-type and cest-2.2-mCherry gravid adults. Top, wild-type (N2) control; bottom, cest-2.2-mCherry worms.

Figure 4—source data 1

Source data for Figure 4a.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Amino acid sequence alignments of human acetyl cholinesterase (hAChE), P. pacificus UAR-1, and C. elegans CEST-1.1, CEST-2.2, and CEST-4.
Figure 4—figure supplement 2
Download asset Open asset
Transmembrane domain prediction for CEST proteins in this study (cest-1.1, cest-2.2, cest-4, cest-6, cest-19, cest-33, ges-1).

Predictions were performed by the TMHMM, as described previously.

Figure 4—figure supplement 3
Download asset Open asset
Red fluorescence in intestinal granules in gravid adults, expressing C-terminally mCherry-tagged CEST-2.2.

Images in the two bottom rows are from younger worms closer to young adult stage.

Figure 4—figure supplement 4
Download asset Open asset
Co-localization of green and red autofluorescence in wild-type (N2) gravid adults.
Figure 5 with 1 supplement
Download asset Open asset
Relative abundance of (a) simple and modular ascarosides and (b) simple and modular glucosides in the endo-metabolome of Cbr-glo-1 mutants relative to wild-type C. briggsae.

n.d., not detected. (c) Model for modular metabolite assembly. CEST proteins (membrane-bound in the LROs, red) mediate attachment of building blocks from diverse metabolic pathways to glucose scaffolds and peroxisomal β-oxidation-derived ascarosides via ester and amide bonds. Some of the resulting modular ascarosides may undergo additional peroxisomal β-oxidation following activation by acs-7 (Dolke et al., 2019).

Figure 5—source data 1

Source data for Figure 5a–b.

Attached as a separate file.

https://cdn.elifesciences.org/articles/61886/elife-61886-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Download asset Open asset
Gut granules in C. briggsae.

(a) C. briggsae WT AF16 has gut granules similar to C. elegans which are also both birefringent and easily tagged by Lysotracker Red (see arrows). Gut granule loss is evident in both (b) Cbr-glo-1(sy1382) and (c) Cbr-glo-1(sy1383).

Scheme 1
Download asset Open asset
Synthesis of 2-((tert-butoxycarbonyl)amino)benzoic acid (Boc-AA, SI-1).
Scheme 2
Download asset Open asset
Synthesis of N-β-(6-(2ʹ-aminobenzoyl)-glucopyranosyl) indole (iglu#3, 34).
Scheme 3
Download asset Open asset
Synthesis of N-β-(6-nicotinoylglucopyranosyl) indole (iglu#5, SI-2).
Scheme 4
Download asset Open asset
Synthesis of N-β-(6-(2ʹ-methylbut-2ʹE-enoyl)-glucopyranosyl) indole (iglu#7, SI-3).
Scheme 5
Download asset Open asset
Synthesis of N-β-(6-(pyrrole-2ʹ-carbonyl)-glucopyranosyl) indole (iglu#9, SI-4).
Scheme 6
Download asset Open asset
Synthesis of an HPLC standard of ((2R,3S,4S,5R,6S)−6-((2-aminobenzoyl)oxy)−3,4,5-trihydroxytetrahydro-2H-pyran-2-yl)methyl 2-aminobenzoate (angl#3, SI-5).
Scheme 7
Download asset Open asset
Synthesis of an HPLC standard of N-(p-aminobenzoyl)glutamate (PABA-glutamate) (29).

Tables

Key resources table
Reagent type (species)
or resource		DesignationSource or referenceIdentifiersAdditional information
Strain, strain background
Caenorhabditis elegans		N2Caenorhabditis Genetics Center (CGC)Wild type
Strain, strain background
Caenorhabditis elegans		GH10David Gemsglo-1(zu437)
Strain, strain background
Caenorhabditis elegans		RB811Caenorhabditis Genetics Center (CGC)glo-4(ok623)
Strain, strain background
Caenorhabditis elegans		RB2053Caenorhabditis Genetics Center (CGC)ges-1(ok2716)
Strain, strain background
Caenorhabditis elegans		PS8031This workcest-1.1(sy1180)
Strain, strain background
Caenorhabditis elegans		PS8032This workcest-1.1(sy1181)
Strain, strain background
Caenorhabditis elegans		DP683This workcest-1.1(dp683) (S213A)
Strain, strain background
Caenorhabditis elegans		PS8259This workcest-1.1(sy1180 sy1250)
Strain, strain background
Caenorhabditis elegans		PS8260This workcest-1.1(sy1180 sy1251)
Strain, strain background
Caenorhabditis elegans		PS8261This workcest-1.1(sy1181 sy1252)
Strain, strain background
Caenorhabditis elegans		PS8262This workcest-1.1(sy1181 sy1253)
Strain, strain background
Caenorhabditis elegans		PS8008This workcest-2.2(sy1170)
Strain, strain background
Caenorhabditis elegans		PS8009This workcest-2.2 (sy1171)
Strain, strain background
Caenorhabditis elegans		PS8236This workcest-2.2(sy1170 sy1236)
Strain, strain background
Caenorhabditis elegans		PS8238This workcest-2.2(sy1171 sy1238)
Strain, strain background
Caenorhabditis elegans		FCS02SunyBiotechcest-2.2-mCherry
Strain, strain background
Caenorhabditis elegans		PS8116This workcest-4(sy1192)
Strain, strain background
Caenorhabditis elegans		PS8117This workcest-4(sy1193)
Strain, strain background
Caenorhabditis elegans		PS8781This workcest-4(sy1192)
Strain, strain background
Caenorhabditis elegans		PS8782This workcest-4(sy1193)
Strain, strain background
Caenorhabditis elegans		PS8783This workcest-4(sy1194)
Strain, strain background
Caenorhabditis elegans		PS8784This workcest-4(sy1195)
Strain, strain background
Caenorhabditis elegans		RB1804Caenorhabditis Genetics Center (CGC)cest-6(ok2338)
Strain, strain background
Caenorhabditis elegans		PS8029This workcest-19(sy1178)
Strain, strain background
Caenorhabditis elegans		PS8030This workcest-19(sy1179)
Strain, strain background
Caenorhabditis elegans		PS8033This workcest-33(sy1182)
Strain, strain background
Caenorhabditis elegans		PS8034This workcest-33(sy1183)
Strain (Caenorhabditis briggsae)PS8515This workCBR-glo-1(sy1382)
Strain (Caenorhabditis briggsae)PS8516This workCBR-glo-1(sy1383)
Peptide, recombinant proteinProteinase KNew England BiolabsNew England Biolabs: P8107S
Software, algorithmMetaboseekMetaboseek (metaboseek.com)Version 0.9.6
Software, algorithmGraphPad PrismGraphPad Prism (graphpad.com)Version 8.4.3
Appendix 1—table 1
MS2 data of glo-1-dependent features presented in this manuscript.
Representative MS/MS spectra of modular glucosides.
FormulaRT [min.]Compound numberSMIDm/z (M+H)m/z (M-H)ms/ms fragments, positive ionization modems/ms fragments, negative ionization modeSubstituents on glucoseStable isotope labeling
C26H26N3O12P9.30angl#10604.13381602.11813105.03366 (C7 H5 O+) 120.04469 (C7 H6 O N+)96.96870 (H2 O4 P-) 121.02911 (C7 H5 O2-) 136.03983 (C7 H6 O2 N-)anthranilic acid, nicotinic acid
C20H22N2O78.67SI-5angl#3403.14998401.13542120.04459 (C7 H6 O N+) 138.05496 (C7 H8 O2 N+)anthranilic acid, anthranilic acid
C20H23N2O11P9.2625angl#4499.11235497.09667120.04463 (C7H6ON+)96.96868 (H2 O4 P-) 78.95800 (O3 P-) 136.03999 (C7 H6 O2 N-) 223.00078 (C6 H8 O7 P-)anthranilic acid, anthranilic acid
C19H21N2O9P9.5922iglu#10453.10574451.0911994.02916 (C5 H4 O N+) 118.06535 (C8 H8 N+) C14 H12 O2 N (C14 H12 O2 N+)78.95802 (O3 P-) 96.96867 (H2 O4 P-) 110.02444 (C5 H4 O2 N-) 116.05042 (C8 H6 N-)indole, nicotinic acid
C21H22NO9P10.7923iglu#12464.11049462.09594105.03382 (C7 H5 O+) 118.06538 (C8 H8 N+) 226.08620 (C14 H12 O2 N+) 348.12271 (C21 H18 O4 N+)78.95801 (O3 P-) 96.96865 (H2 O4 P-)indole, benzoic acid
C14H18NO8P6.0516iglu#2360.08541358.0697398.98453 (H4 O4 P+) 118.06536 (C8 H8 N+) 244.09660 (C14 H14 O3 N+)78.95802 (O3 P-) 96.96869 (H2 O4 P-)indole
C21H22N2O610.6934iglu#3399.15506397.13938116.05032 (C8 H6 N-) 136.04002 (C7 H6 O2 N-) 215.09431 (C13 H13 O2 N-)indole, anthranilic acid
C21H23N2O9P10.2919iglu#4479.12252477.10684118.06536 (C8 H8 N+) 120.04456 (C7 H6 O N+) 138.05490 (C7 H8 O2 N+) 226.08612 (C14 H12 O2 N+)78.95801 (O3 P-) 96.96867 (H2 O4 P-) 116.05042 (C8 H6 N-) 136.03970 (C7 H6 O2 N-) 358.06805 (C14 H17 O8 N P-)indole, anthranilic acid
C27H26N3O10P10.4941iglu#41584.14398582.128396.04494 (C5 H6 O N+) 120.04456 (C7 H6 O N+) 124.03937 (C6 H6 O2 N+) 166.04985 (C8 H8 O3 N+) 228.06477 (C13 H10 O3 N+) 330.03705 (C12 H13 O8 N P+)78.95801 (O3 P-) 96.96867 (H2 O4 P-) 122.02431 (C6 H4 O2 N-) 136.04013 (C7 H6 O2 N-)indole, anthranilic acid, nicotinic acid
C26H29N2O10P10.4820iglu#42561.16439559.1487183.04974 (C5 H7 O+) 118.06553 (C8 H8 N+) 120.04465 (C7 H6 O N+) 202.08635 (C12 H12 O2 N+)78.95805 (O3 P-) 96.96868 (H2 O4 P-)136.03995 (C7 H6 O2 N-)indole, antranilic acid, tiglic acid
C20H20N2O68.93SI-2iglu#5385.13941383.12373106.02911 (C6 H4 O N+) 118.06535 (C8 H8 N+) 124.03936 (C6 H6 O2 N+) 268.08124 (C12 H14 O6 N+)indole, nicotinic acid
C20H21N2O9P8.2920iglu#6465.10687463.09119106.02907 (C6 H4 O N+) 118.06532 (C8 H8 N+) 124.03942 (C6 H6 O2 N+) 226.08630 (C14 H12 O2 N+) 250.07079 (C12 H12 O5 N+)78.95802 (O3 P-) 96.96868 (H2 O4 P-) 122.02421 (C6 H4 O2 N-) 340.05878 (C14 H15 O7 N P-)indole, nicotinic acid
C19H23NO611.24SI-3iglu#7362.15981360.1441383.04967 (C5 H7 O+) 101.06001 (C5 H9 O2+) 118.06536 (C8 H8 N+) 198.09097 (C13 H12 O N+) 226.08626 (C14 H12 O2 N+)indole, tiglic acid
C19H24NO9P10.4821iglu#8442.12727440.1115983.04967 (C5 H7 O+) 101.06020 (C5 H9 O2+) 118.06538 (C8 H8 N+) 226.08621 (C14 H12 O2 N+)78.95798 (O3 P-) 96.96864 (H2 O4 P-) 116.05011 (C8 H6 N-)indole, tiglic acid
C19H20N2O66.33SI-4iglu#9373.13941371.12486110.02437 (C5 H4 O2 N-) 116.05027 (C8 H6 N-)indole, nicotinic acid
C21H27N2O11P4.31oglu#4515.14365513.12797120.04459 (C7 H6 O N+) 136.07550 (C8 H10 O N+) 138.05511 (C7 H8 O2 N+) 216.06795 (C12 H10 O3 N+)78.95781 (O3 P-) 96.96854 (H2 O4 P-) 136.03995 (C7 H6 O2 N-) 223.00067 (C6 H8 O7 P-) 376.07953 (C14 H19 O9 N P-)octopamine, anthranilic acidd1 from d2-L-Tyrosine
C18H24N2O74.79sgnl#1381.16563379.14995217.09767 (C12 H13 O2 N2-)n-acetylserotonin
C25H29N3O87.34sgnl#3500.20274498.18706120.04427 (C7H6NO+) 160.07555 (C10H10NO+)n-acetylserotonin, anthranilic acid
C25H30N3O11P7.89sgnl#4580.1702578.15452120.04459 (C7 H6 O N+) 138.05498 (C7 H8 O2 N+) 160.07590 (C10 H10 O N+) 219.11266 (C12 H15 O2 N2+)(O3 P-) 96.96865 (H2 O4 P-) 136.04048 (C7 H6 O2 N-) 223.00072 (C6 H8 O7 P-)n-acetylserotonin, anthranilic acid
C29H33N2O11P8.22tyglu#12617.1906615.17492120.04458 (C7 H6 O N+) 238.08728 (C15 H12 O2 N+)78.95803 (O3 P-) 96.96867 (H2 O4 P-) 136.04008 (C7 H6 O2 N-) 135.04503 (C8 H7 O2-) 360.08469 (C14 H19 O8 N P-) 478.12738 (C29 H20 O6 N-)tyramine, anthranilic acid, phenylacetic acidd2 from d2-L-Tyrosine
C26H35N2O11P7.92tyglu#14583.20625581.19057109.02870 (C6 H5 O2+) 120.04459 (C7 H6 O N+) 138.05489 (C7 H8 O2 N+) 204.10226 (C12 H14 O2 N+) 257.12808 (C15 H17 O2 N2+) 348.14429 (C18 H22 O6 N+)78.95802 (O3 P-) 96.96866 (H2 O4 P-) 101.05991 (C5 H9 O2-) 136.04047 (C7 H6 O2 N-) 444.14252 (C19 H27 O9 N P-)tyramine, anthranilic acid, (iso)valeric acid
C28H31N2O11P7.97tyglu#16603.17495601.15927105.03380 (C7 H5 O+) 120.04455 (C7 H6 O N+) 138.05487 (C7 H8 O2 N+) 224.07047 (C14 H10 O2 N+) 257.12775 (C15 H17 O2 N2+) 368.11160 (C20 H18 O6 N+)78.95805 (O3 P-)96.96869 (H2 O4 P-) 121.02914 (C7 H5 O2-) 136.03978 (C7 H6 O2 N-) 464.11099 (C21 H23 O9 N P-)tyramine, anthranilic acid, carboxy-benzyld2 from d2-L-Tyrosine
C21H27N2O10P5.40tyglu#2499.14874497.13306120.04459 (C7 H6 O N+) 138.05487 (C7 H8 O2 N+) 138.09137 (C8 H12 O N+) 257.12814 (C15 H17 O2 N2+) 264.08633 (C13 H14 O5 N+)78.95802 (O3 P-) 96.96870 (H2 O4 P-) 136.04005 (C7 H6 O2 N-) 223.00053 (C6 H8 O7 P-) 360.08472 (C14 H19 O8 N P-)tyramine,anthranilic acidd2 from d2-L-Tyrosine
C28H32N3O11P7.6526tyglu#4618.18585616.17017120.04459 (C7 H6 O N+) 138.09137 (C8 H12 O N+) 78.95802 (O3 P-) 96.96867 (H2 O4 P-) 136.03989 (C7 H6 O2 N-) 479.12198 (C21 H24 O9 N2 P-)tyramine, anthranilic acid (x2)
C27H30N3O11P6.55tyglu#6604.1702602.15452106.02901 (C6 H4 O N+) 120.04460 (C7 H6 O N+) 124.03939 (C6 H6 O2 N+) 138.05513 (C7 H8 O2 N+) 166.04988 (C8 H8 O3 N+) 257.12781 (C15 H17 O2 N2+)78.95781 (O3 P-) 96.96851 (H2 O4 P-) 223.00017 (C6 H8 O7 P-) 381.09375 (C16 H17 O9 N2-) 534.17279 (C22 H33 O12 N P-)tyramine, anthranilic acid, nicotinic acidd2 from d2-L-Tyrosine
C26H33N2O11P7.67tyglu#8581.1906579.1749283.04968 (C5 H7 O+) 120.04460 (C7 H6 O N+) 138.05479 (C7 H8 O2 N+) 257.12848 (C15 H17 O2 N2+)78.95779 (O3 P-) 96.96852 (H2 O4 P-) 99.04408 (C5 H7 O2-) 136.03972 (C7 H6 O2 N-) 442.12637 (C19 H25 O9 N P-)tyramine, anthranilic acid, tiglic acidd2 from d2-L-Tyrosine
Appendix 1—table 2
BLASTp results from the WormBase BLAST engine when searching against the amino acid sequence of UAR-1 and CRISPR/Cas9 targets for this study (red).
SequenceScoreE-value
C01B10.102802e-75
C01B10.4a2602e-69
T22D1.112487e-66
C42D4.22334e-61
C17H12.42311e-60
C23H4.4a2258e-59
C23H4.71996e-51
C23H4.31941e-49
E01G6.31933e-49
C23H4.21681e-41
T02B5.11572e-38
F15A8.6a1541e-37
F15A8.6b1541e-37
ZC376.31533e-37
T02B5.31502e-36
ZC376.2b1481e-35
ZC376.2a1472e-35
F56C11.6b1411e-33
F56C11.6a1372e-32
Y71H2AM.131365e-32
ZC376.11351e-31
R173.3 r1296e-30
T07H6.1a1272e-29
T28C12.4a1241e-28
T28C12.4b1242e-28
K07C11.41196e-27
R12A1.41181e-26
K11G9.21164e-26
02B12.41158e-26
Y75B8A.31143e-25
Y48B6A.81134e-25
F13H6.31112e-24
Y48B6A.71095e-24
09B12.11089e-24
K11G9.11082e-23
ZC376.2c1057e-23
F07C4.12b1057e-23
C52A10.11011e-21
Y44E3A.21012e-21
K11G9.3991e-20
C52A10.2973e-20
C40C9.5d966e-20
C40C9.5b966e-20
C40C9.5a966e-20
F55D10.3961e-19
C40C9.5f942e-19
C01B10.4b942e-19
C40C9.5g942e-19
C40C9.5c943e-19
C40C9.5e943e-19
B0238.7934e-19
B0238.1921e-18
F55F3.2b836e-16
F55F3.2a837e-16
C23H4.4b505e-06
Y43F8A.3a420.002
Y43F8A.3b350.18
Appendix 1—table 3
List of C. elegans strains used in this study.
Strain nameIdentifierDescriptionAssociated metabolites
PS8031cest-1.1(sy1180)cest-1.1 nulluglas#1 uglas#11
PS8032cest-1.1(sy1181)cest-1.1 nulluglas#1 uglas#11
PS8259cest-1.1(sy1180 sy1250)cest-1.1 null reverted to WT sequenceuglas#1 uglas#11
PS8260cest-1.1(sy1180 sy1251)cest-1.1 null reverted to WT sequenceuglas#1 uglas#11
PS8261cest-1.1(sy1181 sy1252)cest-1.1 null reverted to WT sequenceuglas#1 uglas#11
PS8262cest-1.1(sy1181 sy1253)cest-1.1 null reverted to WT sequenceuglas#1 uglas#11
PS8008cest-2.2(sy1170)cest-2.2 nullascr#8, ascr#81, ascr#82
PS8009cest-2.2(sy1171)cest-2.2 nullascr#8, ascr#81, ascr#82
PS8236cest-2.2(sy1170 sy1236)cest-2.2 null reverted to WT sequenceascr#8, ascr#81, ascr#82
PS8238cest-2.2(sy1171 sy1238)cest-2.2 null reverted to WT sequenceascr#8, ascr#81, ascr#82
PS8116cest-4(sy1192)cest-4 nulliglu class modular glucosides
PS8117cest-4(sy1193)cest-4 nulliglu class modular glucosides
JJ1271glo-1(zu437)glo-1 nullMost known modular ascarosides/glucosides
PS8781cest-4(sy1192)cest-4 null reverted to WT sequenceiglu class modular glucosides
PS8782cest-4(sy1193)cest-4 null reverted to WT sequenceiglu class modular glucosides
PS8783cest-4(sy1194)cest-4 null reverted to WT sequenceiglu class modular glucosides
PS8784cest-4(sy1195)cest-4 null reverted to WT sequenceiglu class modular glucosides
PS8515CBR-glo-1-A (sy1382)C. briggsae glo-1 nullMost known modular ascarosides/glucosides
PS8516CBR-glo-1-B (sy1383)C. briggsae glo-1 nullMost known modular ascarosides/glucosides
PS8029cest-19(sy1178)cest-19 nullUndetermined
PS8030cest-19(sy1179)cest-19 nullUndetermined
PS8033cest-33(sy1182)cest-33 nullUndetermined
PS8034cest-33(sy1183)cest-33 nullUndetermined
RB2053ges-1 (ok2716)ges-1 nullUndetermined
RB1804cest-6(ok2338)cest-6 nullUndetermined
DP683cest-1.1(dp683)cest-1.1 (S213A) point mutantuglas#1 uglas#11
FCS02cest-2.2-mCherrycest-2.2 C-terminal mCherryascr#8, ascr#81, ascr#82
Appendix 1—table 4
NMR spectroscopic data for iglu#3 (34).

1H (600 MHz), HSQC, and HMBC NMR spectroscopic data were acquired in methanol-d4. Chemical shifts were referenced to δ(CHD2OD)=3.31 ppm and δ(13CHD2OD)=49.00 ppm.



Positionδ 13C [ppm]δ 1H ([ppm] JHH[Hz])HMBC
186.95.51 (J1,2 = 9.3)C-2, C-3, C-5, C-2’, C-9’
273.03.99 (J2,3 = 9.0)C-1, C-3
378.73.65 (J3,4 = 9.0)C-4
471.33.64 (J4,5 = 9.1)C-3
577.53.91 (J5,6a = 5.5)C-4
6a64.14.43 (J6a,6b = 12.1)C-5, C-1′′
6b4.67 (J5,6b = 2.2)C-4, C-1′′
2′126.37.37 (J2’,3’=3.3)C-1 (weak), C-3', C-4’, C-8’ (weak), C-9’
3′102.96.48
4′130.4
5′121.47.52 (J5’,6’=8.0)C-3’, C-7’, C-9’
6′120.87.03 (J6’,7’=7.4,
J3’,6’=1.1)		C-4’, C-8’
7′122.47.06C-5’, C-9’
8′111.57.53C-4’, C-6’
9′137.5
1′′168.6
2′′112.8
3′′132.17.90 (J3’’,4’’=8.2,
J3’’,5’’=1.4)		C-1’’, C-5’’, C-7’’
4′′118.26.73 (J4’’,5’’=7.6)C-2’’, C-6’’
5′′135.07.32 (J5’’,6’’=7.8)C-3’’, C-7’’
6′′118.66.84C-2’’, C-4’’
7′′149.9
Appendix 1—table 5
NMR spectroscopic data for iglu#5 (SI-2).

1H (600 MHz), HSQC, and HMBC NMR spectroscopic data were acquired in methanol-d4. Chemical shifts were referenced to δ(CHD2OD)=3.31 ppm and δ(13CHD2OD)=49.00 ppm.



Positionδ 13C [ppm]δ 1H ([ppm] JHH[Hz])HMBC
186.95.51 (J1,2 = 9.2)C-2, C-3, C-5, C-2’, C-9’
273.04.00 (J2,3 = 9.0)C-1, C-3
378.73.65 (J3,4 = 9.0)C-4
471.43.63 (J4,5 = 8.9)C-3
577.43.95 (J5,6a = 5.8)C-4
6a65.34.51 (J6a,6b = 12.1)C-4, C-5, C-1′′
6b4.75 (J5,6b = 2.3)C-4, C-5, C-1′′
2′126.47.37 (J2’,3’=3.5)C-3', C-4’, C-9’
3′103.16.47C-2', C-4’, C-9’
4′130.5
5′121.47.51 (J5’,6’=7.9)C-4’, C-6’, C-9’
6′120.87.01 (J6’,7’=7.5,
J3’,6’=1.2)		C-4’, C-8’
7′122.57.05C-4’, C-5’, C-8’, C-9’
8′111.47.49C-4’, C-6’
9′137.6
1′′165.8
2′′127.7
3′′150.89.12 (J3’’,6’’=0.5,
J3’’,7’’=2.0)		C-2’’, C-5’’, C-7’’
5′′153.78.74 (J5’’,6’’=4.9,
J5’’’,7’’=1.7)		C-3’’, C-6’’, C-7’’
6′′125.17.54 (J6’’’,7’’=8.0)C-2’’, C-5’’
7′′138.98.37C-1’’, C-2’’, C-5’’
Appendix 1—table 6
NMR spectroscopic data for iglu#7 (SI-3).

1H (600 MHz), HSQC, and HMBC NMR spectroscopic data were acquired in methanol-d4. Chemical shifts were referenced to δ(CHD2OD)=3.31 ppm and δ(13CHD2OD)=49.00 ppm.



Positionδ 13C [ppm]δ 1H ([ppm] JHH[Hz])HMBC
186.95.46 (J1,2 = 9.1)C-2, C-3, C-5, C-2’, C-9’
273.23.96 (J2,3 = 9.0)C-1, C-3
378.93.61 (J3,4 = 9.0)C-2, C-4
471.43.55 (J4,5 = 9.6)C-3, C-5, C-6
577.63.81 (J5,6a = 5.6)C-1 (weak), C-3, C-4
6a64.54.27 (J6a,6b = 11.9)C-4, C-5, C-1′′
6b4.49 (J5,6b = 2.2)C-4, C-5, C-1′′
2′126.67.35 (J2’,3’=3.5)C-1 (weak), C-3', C-4’, C-5’ (weak), C-8’ (weak), C-9’
3′103.26.48
4′130.6
5′121.67.53 (J5’,6’=7.9)C-3’, C-7’, C-9’
6′120.97.05 (J6’,7’=7.5, J3’,6’=1.1)C-4’, C-8’, C-9’ (weak)
7′122.57.11C-5’, C-8’ (weak), C-9’
8′111.77.50C-4’, C-6’
9′137.6
1′′169.2
2′′129.3
3′′138.96.87 (J3’’,4’’=6.8)C-1’’, C-4’’, C-5’’
4′′14.21.79C-2’’, C-3’’
5′′11.91.81C-1’’, C-2’’, C-3’’
Appendix 1—table 7
NMR spectroscopic data for iglu#9 (SI-4).

1H (600 MHz), HSQC, and HMBC NMR spectroscopic data were acquired in methanol-d4. Chemical shifts were referenced to δ(CHD2OD)=3.31 ppm and δ(13CHD2OD)=49.00 ppm.



Positionδ 13C [ppm]δ 1H ([ppm] JHH[Hz])HMBC
186.95.47 (J1,2 = 9.1)C-2, C-3, C-5, C-2’, C-9’
273.23.96 (J2,3 = 9.0)C-1, C-3
378.73.62 (J3,4 = 9.8)C-4
471.33.61 (J4,5 = 9.7)C-3
577.93.86 (J5,6a = 5.7)
6a63.94.38 (J6a,6b = 11.9)C-5, C-1′′
6b4.68 (J5,6b = 2.1)C-4, C-1′′
2′126.67.36 (J2’,3’=3.4)C-3', C-4’, C-9’
3′103.16.47C-2', C-4’, C-9’
4′130.6
5′121.47.52 (J5’,6’=7.8)C-7’, C-9’
6′120.87.02 (J6’,7’=7.3, J3’,6’=1.2)C-4’, C-8’
7′122.47.05C-5’, C-9’
8′111.67.50C-4’, C-6’
9′137.4
1′′162.4
2′′123.0
4′′124.76.96 (J4’’,5’’=2.5, J4’’,6’’=1.4)C-2’’, C-5’’, C-6’’
5′′110.66.20 (J5’’,6’’=3.8)C-2’’(weak), C-4’’(weak)
6′′116.86.90C-2’’, C-4’’, C-5’’
Appendix 1—table 8
DNA oligonucleotides used for this study.
Target geneSequence nameStrainAllelleGuide sequencessDNA repair oligonucleotide sequence
cest-1.1T02B5.1PS8031, PS8032sy1180, sy1181ACTCCTTCCCATGATTTCGGTATTCATTTGTTACCAAAACTCCTTCCCATGATTTG
CTAGCTTATCACTTAGTCACCTCTGCTCTGGACAAA
CTTCCCCGGTGGACGGGGTTTTCGATATCGAAGGTCTCCAATTG
cest-2.2ZC376.2PS8008, PS8009sy1170, sy1171GGAGGCGAAGGAGTATAAAGCCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA
GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAA
GCTAGCAAGCGGCTTGTATGAGTGATCAGAAGTAAGAGATA
cest-4C17H12.4PS8116, PS8117sy1192, sy1193ACTCCGGTCCATTTCTCAGGCATACCTTTTGCATTTCTCACTCCGGTCCATTTCTCGCTAGC
TTATCACTTAGTCACCTCTGCTCTGGACAAACTTCCCAGGCGG
TTCTGGTTTTTGAAATCTTAATTTTCCAATTG
Appendix 1—table 9
List of all modular metabolites referred to in the text and Figures.
Compound numberSMID IDIUPAC NameEvidenceStructure
1icas#3(R)−8-(((2R,3R,5R,6S)−5-((1H-indole-3-carbonyl)oxy)−3-hydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)nonanoic acidPreviously identified via synthesis (Srinivasan et al., 2012)

2ascr#84-((R,E)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)hept-2-enamido)benzoic acidPreviously identified via synthesis (Pungaliya et al., 2009)

3uglas#11(2R,3R,4S,5R,6R)−5-hydroxy-6-(hydroxymethyl)−4-(phosphonooxy)−2-(2,6,8-trioxo-1,2,6,7,8,9-hexahydro-3H-purin-3-yl)tetrahydro-2H-pyran-3-yl (R)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)heptanoatePreviously identified via synthesis (Curtis et al., 2020)

4ubas#3(R)−4-(((2R,3R,5R,6S)−3-hydroxy-6-methyl-5-(((R)−2-methyl-3-ureidopropanoyl)oxy)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acidPreviously inferred via tandem mass spectrometry (Falcke et al., 2018)

5ascr#1(R)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)heptanoic acidPreviously identified via NMR and synthesis (Jeong et al., 2005)

6gluric#13-((2R,3R,4S,5S,6R)−3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yl)−7,9-dihydro-1H-purine-2,6,8 (3H)-trionePreviously identified via synthesis (Curtis et al., 2020)

7ascr#7(R,E)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)hept-2-enoic acidPreviously identified via synthesis (Pungaliya et al., 2009)

8PABA4-Aminobenzoic acidCommercial product (Sigma-Aldrich)

9ascr#3(R,E)−8-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)non-2-enoic acidPreviously identified via synthesis (Butcher et al., 2007)

10ascr#10(R)−8-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)nonanoic acidPreviously identified via synthesis (Srinivasan et al., 2012)

111H-indole-3-carboxylic acidCommercial product (Sigma-Aldrich)

12(R)−4-((2-hydroxy-2-(4-hydroxyphenyl)ethyl)amino)−4-oxobutanoic acidIdentified via synthesis (This manuscript)

13iglas#1((2R,3S,4S,5R,6R)−3,4,5-trihydroxy-6-(1H-indol-1-yl)tetrahydro-2H-pyran-2-yl)methyl (R)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)heptanoatePreviously identified via synthesis (Artyukhin et al., 2018)

14glas#10(2S,3R,4S,5S,6R)−3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yl (R)−8-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)nonanoatePreviously identified via NMR and synthesis (Coburn et al., 2013)

15iglu#1(2R,3S,4S,5R,6R)−2-(hydroxymethyl)−6-(1H-indol-1-yl)tetrahydro-2H-pyran-3,4,5-triolPreviously identified via NMR and synthesis (Coburn et al., 2013)

16iglu#2(2R,3R,4S,5R,6R)−3,5-dihydroxy-2-(hydroxymethyl)−6-(1H-indol-1-yl)tetrahydro-2H-pyran-4-yl dihydrogen phosphatePreviously identified via NMR (Coburn et al., 2013)

17angl#1(2S,3R,4S,5S,6R)−3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yl 2-aminobenzoatePreviously identified via NMR and synthesis (Coburn et al., 2013)

18angl#2(2S,3R,4S,5R,6R)−3,5-dihydroxy-6-(hydroxymethyl)−4-(phosphonooxy)tetrahydro-2H-pyran-2-yl 2-aminobenzoatePreviously identified via NMR (Coburn et al., 2013)

19iglu#4(2R,3R,4S,5R,6R)−3,5-dihydroxy-6-(1H-indol-1-yl)−4-(phosphonooxy)tetrahydro-2H-(pyran-2-yl)methyl 2-aminobenzoateProposed structure, based on identification of non-phosphorylated derivative (34) via synthesis (This manuscript)

20iglu#6((2R,3R,4S,5R,6R)−3,5-dihydroxy-6-(1H-indol-1-yl)−4-(phosphonooxy)tetrahydro-2H-pyran-2-yl)methyl nicotinateProposed structure, based on identification of non-phosphorylated derivative (SI-2) via synthesis (This manuscript)

21iglu#8((2R,3R,4S,5R,6R)−3,5-dihydroxy-6-(1H-indol-1-yl)−4-(phosphonooxy)tetrahydro-2H-pyran-2-yl)methyl (E)−2-methylbut-2-enoateProposed structure, based on identification of non-phosphorylated derivative (SI-3) via synthesis (This manuscript)

22iglu#10((2R,3R,4S,5R,6R)−3,5-dihydroxy-6-(1H-indol-1-yl)−4-(phosphonooxy)tetrahydro-2H-pyran-2-yl)methyl 1H-pyrrole-2-carboxylateProposed structure, based on identification of non-phosphorylated derivative (SI-4) via synthesis (This manuscript)

23iglu#12((2R,3R,4S,5R,6R)−3,5-dihydroxy-6-(1H-indol-1-yl)−4-(phosphonooxy)tetrahydro-2H-pyran-2-yl)methyl benzoateProposed structure. Inferred via tandem mass spectrometry (This manuscript)

24iglu#41(2R,3R,4S,5R,6R)−6-(((2-aminobenzoyl)oxy)methyl)−5-hydroxy-2-(1H-indol-1-yl)−4-(phosphonooxy)tetrahydro-2H-pyran-3-yl 1H-pyrrole-2-carboxylateProposed structure. Inferred from iglu#3 (34) via tandem mass spectrometry (This manuscript)

25angl#4((2R,3R,4S,5R,6S)−6-((2-aminobenzoyl)oxy)−3,5-dihydroxy-4-(phosphonooxy)tetrahydro-2H-pyran-2-yl)methyl 2-aminobenzoateProposed structure. Inferred from angl#3 (SI 5) via tandem mass spectrometry (This manuscript)

26tyglu#4((2R,3R,4S,5R,6R)−5-((2-aminobenzoyl)oxy)−3-hydroxy-6-((4-(2-aminoethyl)phenoxy)−4-(phosphonooxy)tetrahydro-2H-pyran-2-yl))methyl 2-aminobenzoateProposed structure. Initially described (O'Donnell et al., 2020) and further inferred via tandem mass spectrometry (This manuscript)

27ascr#81(4-((R,E)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)hept-2-enamido)benzoyl)-L-glutamic acidIdentified via synthesis (Artyukhin et al., 2018)

28ascr#82((S)−4-carboxy-4-(4-((R,E)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)hept-2-enamido)benzamido)butanoyl)-L-glutamic acidPreviously inferred via tandem mass spectrometry (Artyukhin et al., 2018)

29PABA-glu(4-aminobenzoyl)-L-glutamic acidIdentified via synthesis (This manuscript)

30uglas#1(2R,3R,4S,5S,6R)−4,5-dihydroxy-6-(hydroxymethyl)−2-(2,6,8-trioxo-1,2,6,7,8,9-hexahydro-3H-purin-3-yl)tetrahydro-2H-pyran-3-yl (R)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)heptanoateIdentified via synthesis (Curtis et al., 2020)

31uglas#14((2R,3S,4S,5R,6R)−3,4,5-trihydroxy-6-(2,6,8-trioxo-1,2,6,7,8,9-hexahydro-3H-purin-3-yl)tetrahydro-2H-pyran-2-yl)methyl (R)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)heptanoateIdentified via synthesis (Curtis et al., 2020)

32uglas#15((2R,3R,4S,5R,6R)−3,5-dihydroxy-4-(phosphonooxy)−6-(2,6,8-trioxo-1,2,6,7,8,9-hexahydro-3H-purin-3-yl)tetrahydro-2H-pyran-2-yl)methyl (R)−6-(((2R,3R,5R,6S)−3,5-dihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)heptanoatePreviously inferred via tandem mass spectrometry (Artyukhin et al., 2018; Curtis et al., 2020)

33
2-Aminobenzoic acidCommercial product (Sigma-Aldrich)

34iglu#3((2R,3S,4S,5R,6R)−3,4,5-trihydroxy-6-(1H-indol-1-yl)tetrahydro-2H-pyran-2-yl)methyl 2-aminobenzoateIdentified via synthesis (This manuscript)

35icas#2(2S,3R,5R,6R)−5-hydroxy-2-methyl-6-(((R)−5-oxohexan-2-yl)oxy)tetrahydro-2H-pyran-3-yl 1H-indole-3-carboxylateIdentified via synthesis (Dong et al., 2016)

36icas#6.2(2S,3R,5R,6R)−5-hydroxy-6-(((2R,5S)−5-hydroxyhexan-2-yl)oxy)−2-methyltetrahydro-2H-pyran-3-yl 1H-indole-3-carboxylateIdentified via synthesis (Dong et al., 2016)

SI 1
2-((tert-butoxycarbonyl)-amino)benzoic acidCharacterized via synthesis (This manuscript)

SI 2iglu#5((2R,3S,4S,5R,6R)−3,4,5-trihydroxy-6-(1H-indol-1-yl)tetrahydro-2H-pyran-2-yl)methyl nicotinateIdentified via synthesis (This manuscript)

SI 3iglu#7((2R,3S,4S,5R,6R)−3,4,5-trihydroxy-6-(1H-indol-1-yl)tetrahydro-2H-pyran-2-yl)methyl (E)−2-methylbut-2-enoateIdentified via synthesis (This manuscript)

SI 4iglu#9((2R,3S,4S,5R,6R)−3,4,5-trihydroxy-6-(1H-indol-1-yl)tetrahydro-2H-pyran-2-yl)methyl 1H-pyrrole-2-carboxylateIdentified via synthesis (This manuscript)

SI 5angl#3((2R,3S,4S,5R,6S)−6-((2-aminobenzoyl)oxy)−3,4,5-trihydroxytetrahydro-2H-pyran-2-yl)methyl 2-aminobenzoateProposed structure based on synthesis of a reference sample for MS (This manuscript)

SI 6tyglu#6(2R,3R,4S,5S,6R)−6-(((2-aminobenzoyl)oxy)methyl)−2-((4-(2-aminoethyl)-phenoxy))−5-hydroxy-4-(phosphonooxy)-tetrahydro-2H-pyran-3-yl nicotinateProposed structure. Initially described (O'Donnell et al., 2020) and further inferred via tandem mass spectrometry (This manuscript)

Additional files

Supplementary file 1

NMR spectra appendix.

NMR spectra of synthetic intermediates and newly identified metabolites.

https://cdn.elifesciences.org/articles/61886/elife-61886-supp1-v2.pdf
Transparent reporting form
https://cdn.elifesciences.org/articles/61886/elife-61886-transrepform-v2.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Henry H Le
  2. Chester JJ Wrobel
  3. Sarah M Cohen
  4. Jingfang Yu
  5. Heenam Park
  6. Maximilian J Helf
  7. Brian J Curtis
  8. Joseph C Kruempel
  9. Pedro Reis Rodrigues
  10. Patrick J Hu
  11. Paul W Sternberg
  12. Frank C Schroeder
(2020)
Modular metabolite assembly in Caenorhabditis elegans depends on carboxylesterases and formation of lysosome-related organelles
eLife 9:e61886.
https://doi.org/10.7554/eLife.61886