Single-molecule view of coordination in a multi-functional DNA polymerase
- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, United States
Figures
Figure 1
Activities of Pol I and three-dimensional structures of Pol I homologs.
(A) Processes catalyzed by Pol I during lagging strand DNA replication or base excision repair. A growing primer strand is extended through repeated cycles of nucleotide incorporation, resulting in …
Figure 2
DNA substrates used in this study.
(A) Substrate containing a 5’ flap on the downstream strand (designated downstream flap DNA). (B) Substrate containing the same 5’ flap as in A, plus a single unpaired base at the primer 3’ terminus …
Figure 3 with 4 supplements
Probing the location of DNA substrates within Pol I.
(A) Schematic representation of the donor (green, attached to primer strand) and acceptor (magenta, attached to thumb region of Pol I) labeling sites. Pol I is depicted in cartoon form, with the …
Figure 3—figure supplement 1
Additional examples of smFRET trajectories (blue) and corresponding donor intensity (green) and acceptor intensity (red).
The bold lines are idealized state paths from Hidden Markov modeling.
Figure 3—figure supplement 2
Interaction of Pol I with mismatched primer/template.
(A) Schematic illustration of mismatched primer/template. (B) FRET efficiency histogram for Pol I interacting with mismatched primer/template. (C) FRET efficiency histogram for Pol I containing …
Figure 3—figure supplement 3
Histogram of emission intensities resulting from direct excitation of A594 in Pol I bound to downstream flap DNA, compiled from 102 individual emission trajectories.
The single peak centered at ∼350 a.u. indicates that only one enzyme molecule binds to the DNA. The peak at ∼0 a.u. corresponds to periods during which Pol I is not bound to the DNA.
Figure 3—figure supplement 4
Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with flap-containing DNA substrates, compiled from a total of n transitions.
The solid lines are best fits to a single exponential function, with the rate constants indicated.
Figure 4 with 2 supplements
Interaction of Pol I with primer/template DNA or DNA substrates containing a nick or gap.
(A) Representative smFRET trajectories for DNA substrates interacting with Pol I, as indicated. Schematic representations of DNA substrates are shown in Figure 2. Bold lines are idealized state …
Figure 4—figure supplement 1
Histograms and TDPs of Pol I L361A and KF interacting with 1nt gap DNA.
Composite FRET efficiency histograms (left) and transition density plots (right) for Pol I L361A (top panels) and KF (bottom panels) interacting with 1nt gap substrate. The numbers of trajectories …
Figure 4—figure supplement 2
Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with nick- or gap-containing DNA substrates, compiled from a total of n transitions.
The solid lines are best fits to a single-exponential function, with the rate constants indicated.
Figure 5
Probing the location of the 5’ nuc domain within Pol I bound to flap substrates.
(A) Schematic representation of donor (yellow, attached to 5’ nuc domain) and acceptor (cyan, attached to downstream template strand) labeling sites. (B) Representative set of donor, acceptor and …
Figure 6
Location of the 5’ nuc domain within Pol I bound to primer/template substrate.
(A) Schematic representation of donor (yellow) and acceptor (cyan) labeling sites. (B) Representative set of donor, acceptor and FRET trajectories. (C) FRET efficiency histograms compiled from n …
Figure 7
Possible configurations of Pol I-DNA complexes.
Complex P’: in the absence of a nearby downstream strand, the primer 3’ terminus resides in the pol domain within the enzyme core (grey) and the 5’ nuc domain (blue) is extended away from the core. …
Appendix 2—figure 1
PAGE analysis of Pol I expression and purification steps.
(M = size marker; FT = flow-through).
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | CJ803 | Yale coli genetic stock center | ||
| Recombinant DNA | pXS67 | Yale coli genetic stock center | ||
| Commercial assay or kit | Q5 site-directed mutagenesis kit | New England Biolabs | #E0554 | |
| Quik Change kit | Agilent | 200523 | ||
| Chemical compound | Alexa Fluor 488 NHS ester | Thermo Fisher | A20000 | |
| Alexa Fluor 488 C5 maleimide | Thermo Fisher | A10254 | ||
| Alexa Fluor 594 NHS ester | Thermo Fisher | A20004 | ||
| Alexa Fluor 594 C5 maleimide | Thermo Fisher | A10256 | ||
| Software, algorithm | scikit_learn | other | public domain | |
| Software, algorithm | SciPy | other | public domain |
Appendix 1—table 1
Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 1.
| Substrate | Oligo name | Sequence | |
|---|---|---|---|
| Double flap | 17e | 5'- | TCGCAGCCGYCAATATg |
| T2b | 3'-BT10- | AGCGTCGGCAGTTATAGATATAGCTTCGGAACAC −5' | |
| D18c_2 | taCTATATCGAAGCCTTGTG −3' | ||
| Mixed flap | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D18b_2 | taGTATATCGAAGCCTTGTG −3' | ||
| Downstream flap | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D18c_2 | tacTATATCGAAGCCTTGTG −3' | ||
| Nick | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D17b | TATATCGAAGCCTTGTG −3' | ||
| 1nt gap | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D16b | ATATCGAAGCCTTGTG −3' | ||
| 2nt gap | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D15b | TATCGAAGCCTTGTG −3' | ||
| 3nt gap | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D14b | ATCGAAGCCTTGTG −3' | ||
| 4nt gap | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| D13b | TCGAAGCCTTGTG −3' | ||
| Primer/template | 17e | 5'- | TCGCAGCCGYCAATATG |
| T1b | 3'-BT10- | AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5' | |
| Primer/template- | 17e | 5'- | TCGCAGCCGYCAATATg |
| mismatch | T2b | 3'-BT10- | AGCGTCGGCAGTTATAGATATAGCTTCGGAACAC −5' |
Appendix 1—table 2
Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 2.
| Substrate | Oligo name | Sequence | |
|---|---|---|---|
| Double flap | P18mmt | 5'- | ACTTGAGAGCCGTATGAg |
| T33Y | 3'-BT10- | TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5' | |
| D16 | ttCCATTACCATCGCACG −3' | ||
| Mixed flap | P18 | 5'- | ACTTGAGAGCCGTATGAC |
| T33Y | 3'-BT10- | TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5' | |
| D16 | ttCCATTACCATCGCACG −3' | ||
| Downstream flap | P18 | 5'- | ACTTGAGAGCCGTATGAC |
| T33Y | 3'-BT10- | TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5' | |
| D16mmt | ttgCATTACCATCGCACG −3' | ||
| Primer/template | P1 | 5'- | ACTTGAGAGCCGTATG |
| T33Y | 3'-BT10- | TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5' | |
Appendix 3—table 1
Binding of Pol I to flap-containing DNA substrates.
| Substrate | () | |
|---|---|---|
| Double flap | 0.28 ± 0.03 | 13 ± 2 |
| Mixed flap | 0.27 ± 0.04 | 14 ± 3 |
| Downstream flap | 0.22 ± 0.03 | 18 ± 3 |
Appendix 3—table 2
Statistical frequencies of state-to-state transitions for Pol I interacting with flap-containing substrates.
| Transition frequencies | ||||
|---|---|---|---|---|
| Substrate | ||||
| Double flap | 0.6 ± 0.1 | 0.4 ± 0.1 | 0.4 ± 0.1 | 0.6 ± 0.1 |
| Mixed flap | 0.4 ± 0.1 | 0.6 ± 0.1 | 0.4 ± 0.1 | 0.6 ± 0.1 |
| Downstream flap | 0.34 ± 0.04 | 0.66 ± 0.04 | 0.4 ± 0.1 | 0.6 ± 0.1 |
Appendix 3—table 3
Rate constants for state-to-state transitions for Pol I interacting with flap-containing substrates.
| Rate constants (s-1) | ||||
|---|---|---|---|---|
| Substrate | ||||
| Double flap | 1.2 ± 0.1 | 0.6 ± 0.2 | 0.56 ± 0.05 | 1.0 ± 0.2 |
| Mixed flap | 0.58 ± 0.04 | 0.8 ± 0.2 | 0.8 ± 0.1 | 1.3 ± 0.3 |
| Downstream flap | 0.34 ± 0.02 | 0.7 ± 0.1 | 1.6 ± 0.1 | 2.1 ± 0.4 |
Appendix 3—table 4
Statistical frequencies of state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.
| Transition frequencies | ||||
|---|---|---|---|---|
| Substrate | ||||
| Nick | 0.4 ± 0.1 | 0.6 ± 0.1 | 0.5 ± 0.1 | 0.5 ± 0.1 |
| 1nt gap | 0.64 ± 0.04 | 0.36 ± 0.04 | 0.67 ± 0.04 | 0.33 ± 0.04 |
| 2nt gap | 0.6 ± 0.1 | 0.4 ± 0.1 | 0.7 ± 0.1 | 0.3 ± 0.1 |
| 3nt gap | 0.6 ± 0.1 | 0.4 ± 0.1 | 0.66 ± 0.04 | 0.34 ± 0.04 |
| 4nt gap | 0.54 ± 0.05 | 0.46 ± 0.05 | 0.7 ± 0.1 | 0.3 ± 0.1 |
Appendix 3—table 5
Rate constants for state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.
| Rate constants () | ||||
|---|---|---|---|---|
| Substrate | ||||
| Nick | 0.47 ± 0.02 | 0.6 ± 0.1 | 1.5 ± 0.1 | 1.7 ± 0.3 |
| 1nt gap | 0.52 ± 0.02 | 0.30 ± 0.04 | 1.6 ± 0.1 | 0.8 ± 0.1 |
| 2nt gap | 0.34 ± 0.02 | 0.23 ± 0.04 | 1.3 ± 0.1 | 0.6 ± 0.1 |
| 3nt gap | 0.32 ± 0.02 | 0.23 ± 0.04 | 1.14 ± 0.05 | 0.6 ± 0.1 |
| 4nt gap | 0.20 ± 0.02 | 0.17 ± 0.03 | 1.4 ± 0.1 | 0.6 ± 0.2 |
Appendix 3—table 6
Binding of Pol I to various DNA substrates.
| Substrate | () | |
|---|---|---|
| Nick | 0.20 ± 0.02 | 20 ± 3 |
| 1nt gap | 0.39 ± 0.02 | 8 ± 1 |
| 2nt gap | 0.47 ± 0.04 | 6 ± 1 |
| 3nt gap | 0.52 ± 0.05 | 5 ± 1 |
| 4nt gap | 0.56 ± 0.04 | 4 ± 1 |
| primer/template | 0.27 ± 0.02 | 14 ± 2 |
Appendix 4—table 1
Steady-state fluorescence controls.
| Labeled macromolecule | Label | Ligand | Normalized intensity | Anisotropy |
|---|---|---|---|---|
| Double flap | A488 | none | 1.0 | 0.05 ± 0.01 |
| Pol I | 0.94 | 0.21 ± 0.05 | ||
| Primer/template | A488 | none | 1.0 | 0.05 ± 0.01 |
| Pol I | 1.2 | 0.22 ± 0.01 | ||
| Pol I | A594 | none | 1.0 | 0.32 ± 0.02 |
| double flap | 1.2 | 0.34 ± 0.03 | ||
| primer/template | 1.1 | 0.34 ± 0.03 |
-
total emission intensity normalized to the value for the free macromolecule A488 data obtained with excitation at 495 nm, A594 with excitation at 590 nm
