Figures and data in Single-molecule view of coordination in a multi-functional DNA polymerase

Figures
Tables
Additional files

9 figures, 10 tables and 1 additional file

Figures

Figure 1

Download asset Open asset

Activities of Pol I and three-dimensional structures of Pol I homologs.

(A) Processes catalyzed by Pol I during lagging strand DNA replication or base excision repair. A growing primer strand is extended through repeated cycles of nucleotide incorporation, resulting in displacement of a downstream strand (RNA in the case of Okazaki fragment maturation or DNA in the case of base excision repair). The resulting substrate rearranges to a double flap structure that is cleaved by the 5’ nuclease activity of Pol I (site indicated by a half arrow head). The final ligation step is performed by a DNA ligase (not shown). (B) Crystal structure of the Pol I homolog *Taq* polymerase with DNA primer/template bound in the *pol* domain (PDB ID: 1TAU). The polymerase core is shown in gray and the *5’ nuc* domain is shown in light blue. (C) Crystal structure of human FEN1 bound to a DNA substrate (PDB: 3Q8M). In both B and C, the DNA strands are colored as in A and the green and red arrows denote the approximate locations of the sites for donor (scheme 2) or acceptor (scheme 1) labeling, respectively.

Figure 2

Download asset Open asset

DNA substrates used in this study.

(A) Substrate containing a 5’ flap on the downstream strand (designated downstream flap DNA). (B) Substrate containing the same 5’ flap as in A, plus a single unpaired base at the primer 3’ terminus (designated double flap DNA). Because of the base sequences of the strands (Appendix 1), the structures shown in A and B are ‘locked in’. (C) Substrate that can exist as a mixture of the structures shown in A and B (designated mixed flap DNA). (D) Substrates containing a nick (n = 0) or gaps of various size (n = 1–4). (E). Primer/template substrate. (F) Schematic illustration of donor (green) and acceptor (red) labeling sites for the first FRET scheme. Pol I is depicted in cartoon form, with the core colored grey and the *5' nuc* domain colored blue. (G) Schematic illustration of donor (yellow) and acceptor (blue) labeling sites for the second FRET scheme.

Figure 3 with 4 supplements

Download asset Open asset

Probing the location of DNA substrates within Pol I.

(A) Schematic representation of the donor (green, attached to primer strand) and acceptor (magenta, attached to thumb region of Pol I) labeling sites. Pol I is depicted in cartoon form, with the core colored gray and the *5’ nuc* domain colored blue. (B) Representative smFRET trajectory (blue) and donor (green) and acceptor (magenta) emission trajectories, for Pol I interacting with mixed flap substrate. The bold line is the idealized state path determined from Hidden Markov modeling. (C) Composite FRET efficiency histograms for states P and N, compiled from n individual FRET trajectories (n value indicated in each plot), for various combinations of DNA substrate and protein. The proteins, from top to bottom, are WT Pol I, Pol I L361A, and KF L361A. The corresponding populations of states P and N are indicated. (D) Transition density plots for Pol I interacting with flap-containing DNA substrates, compiled from a total of n transitions. From left to right: double flap DNA, mixed flap DNA and downstream flap DNA. (E) Rate constants for intramolecular transfer of DNA substrates from *pol* domain to *5’ nuc* domain (P→N) or from *5’ nuc* domain to *pol* domain (N→P).

Figure 3—figure supplement 1

Download asset Open asset

Additional examples of smFRET trajectories (blue) and corresponding donor intensity (green) and acceptor intensity (red).

The bold lines are idealized state paths from Hidden Markov modeling.

Figure 3—figure supplement 2

Download asset Open asset

Interaction of Pol I with mismatched primer/template.

(A) Schematic illustration of mismatched primer/template. (B) FRET efficiency histogram for Pol I interacting with mismatched primer/template. (C) FRET efficiency histogram for Pol I containing L361A mutation interacting with mismatched primer/template. The fractional populations of states E and P are indicated in each case.

Figure 3—figure supplement 3

Download asset Open asset

Histogram of emission intensities resulting from direct excitation of A594 in Pol I bound to downstream flap DNA, compiled from 102 individual emission trajectories.

The single peak centered at ∼350 a.u. indicates that only one enzyme molecule binds to the DNA. The peak at ∼0 a.u. corresponds to periods during which Pol I is not bound to the DNA.

Figure 3—figure supplement 4

Download asset Open asset

Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with flap-containing DNA substrates, compiled from a total of n transitions.

The solid lines are best fits to a single exponential function, with the rate constants indicated.

Figure 4 with 2 supplements

Download asset Open asset

Interaction of Pol I with primer/template DNA or DNA substrates containing a nick or gap.

(A) Representative smFRET trajectories for DNA substrates interacting with Pol I, as indicated. Schematic representations of DNA substrates are shown in Figure 2. Bold lines are idealized state paths determined from Hidden Markov modeling. (B) Composite FRET efficiency histograms for states P and N compiled from n individual FRET trajectories, for various DNA substrates interacting with Pol I, as indicated. The corresponding populations of states P and N are indicated. (C) Transition density plots for Pol I interacting with various DNA substrates compiled from a total of n transitions, as indicated. (D) Rate constants for intramolecular transfer of various DNA substrates between *pol* domain and *5’ nuc* domain (P→N, grey) or between *5’ nuc* domain and *pol* domain (N→P, blue).

Figure 4—figure supplement 1

Download asset Open asset

Histograms and TDPs of Pol I L361A and KF interacting with 1nt gap DNA.

Composite FRET efficiency histograms (left) and transition density plots (right) for Pol I L361A (top panels) and KF (bottom panels) interacting with 1nt gap substrate. The numbers of trajectories or transitions used to compile each plot are indicated.

Figure 4—figure supplement 2

Download asset Open asset

Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with nick- or gap-containing DNA substrates, compiled from a total of n transitions.

The solid lines are best fits to a single-exponential function, with the rate constants indicated.

Figure 5

Download asset Open asset

Probing the location of the *5’ nuc* domain within Pol I bound to flap substrates.

(A) Schematic representation of donor (yellow, attached to *5’ nuc* domain) and acceptor (cyan, attached to downstream template strand) labeling sites. (B) Representative set of donor, acceptor and FRET trajectories for mixed flap DNA substrate. The bold lines are idealized state paths from Hidden Markov modeling. (C) FRET efficiency histograms compiled from n individual FRET trajectories. (D) Transition density plots compiled from a total of n transitions. Since the FRET efficiency is not defined during periods when Pol I is not bound to DNA, the FRET efficiency is set to −0.2. The quadrant enclosed by the dotted lines corresponds to periods during which Pol I is bound to DNA.

Figure 6

Download asset Open asset

Location of the *5’ nuc* domain within Pol I bound to primer/template substrate.

(A) Schematic representation of donor (yellow) and acceptor (cyan) labeling sites. (B) Representative set of donor, acceptor and FRET trajectories. (C) FRET efficiency histograms compiled from n individual FRET trajectories. (D) Transition density plot compiled from a total of n transitions. Same presentation as Figure 5D.

Figure 7

Download asset Open asset

Possible configurations of Pol I-DNA complexes.

Complex P’: in the absence of a nearby downstream strand, the primer 3’ terminus resides in the *pol* domain within the enzyme core (grey) and the *5’ nuc* domain (blue) is extended away from the core. The donor and acceptor probes for the first labeling scheme are green and magenta, respectively, while the donor and acceptor for the second labeling scheme are yellow and blue. The FRET efficiencies for the first and second labeling schemes are denoted E₁ and E₂, respectively. Complex P: The primer 3’ terminus resides in the *pol* domain and the *5’ nuc* domain is located in proximity to a nearby downstream strand. Complex N: The *5’ nuc* domain is docked with the downstream strand and the DNA primer 3’ terminus resides within the same domain.

Appendix 2—figure 1

Download asset Open asset

PAGE analysis of Pol I expression and purification steps.

(M = size marker; FT = flow-through).

Author response image 1

Download asset Open asset

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Escherichia coli)	CJ803	Yale coli genetic stock center
Recombinant DNA	pXS67	Yale coli genetic stock center
Commercial assay or kit	Q5 site-directed mutagenesis kit	New England Biolabs	#E0554
	Quik Change kit	Agilent	200523
Chemical compound	Alexa Fluor 488 NHS ester	Thermo Fisher	A20000
	Alexa Fluor 488 C₅ maleimide	Thermo Fisher	A10254
	Alexa Fluor 594 NHS ester	Thermo Fisher	A20004
	Alexa Fluor 594 C₅ maleimide	Thermo Fisher	A10256
Software, algorithm	scikit_learn	other		public domain
Software, algorithm	SciPy	other		public domain

Appendix 1—table 1

Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 1.

Substrate	Oligo name	Sequence
Double flap	17e	5'-	TCGCAGCCGYCAATATg
	T2b	3'-BT₁₀-	AGCGTCGGCAGTTATAGATATAGCTTCGGAACAC −5'
	D18c_2		taCTATATCGAAGCCTTGTG −3'
Mixed flap	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D18b_2		taGTATATCGAAGCCTTGTG −3'
Downstream flap	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D18c_2		tacTATATCGAAGCCTTGTG −3'
Nick	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D17b		TATATCGAAGCCTTGTG −3'
1nt gap	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D16b		ATATCGAAGCCTTGTG −3'
2nt gap	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D15b		TATCGAAGCCTTGTG −3'
3nt gap	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D14b		ATCGAAGCCTTGTG −3'
4nt gap	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
	D13b		TCGAAGCCTTGTG −3'
Primer/template	17e	5'-	TCGCAGCCGYCAATATG
	T1b	3'-BT₁₀-	AGCGTCGGCAGTTATACATATAGCTTCGGAACAC −5'
Primer/template-	17e	5'-	TCGCAGCCGYCAATATg
mismatch	T2b	3'-BT₁₀-	AGCGTCGGCAGTTATAGATATAGCTTCGGAACAC −5'

Appendix 1—table 2

Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 2.

Substrate	Oligo name	Sequence
Double flap	P18mmt	5'-	ACTTGAGAGCCGTATGAg
	T33Y	3'-BT₁₀-	TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5'
	D16		ttCCATTACCATCGCACG −3'
Mixed flap	P18	5'-	ACTTGAGAGCCGTATGAC
	T33Y	3'-BT₁₀-	TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5'
	D16		ttCCATTACCATCGCACG −3'
Downstream flap	P18	5'-	ACTTGAGAGCCGTATGAC
	T33Y	3'-BT₁₀-	TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5'
	D16mmt		ttgCATTACCATCGCACG −3'
Primer/template	P1	5'-	ACTTGAGAGCCGTATG
	T33Y	3'-BT₁₀-	TGAACTCTCGGCATACTGGTAAYGGTAGCGTGC −5'

Appendix 3—table 1

Binding of Pol I to flap-containing DNA substrates.

Substrate	$f_{B}$	$K_{d}$ ( $nM$ )
Double flap	0.28 ± 0.03	13 ± 2
Mixed flap	0.27 ± 0.04	14 ± 3
Downstream flap	0.22 ± 0.03	18 ± 3

Appendix 3—table 2

Statistical frequencies of state-to-state transitions for Pol I interacting with flap-containing substrates.

	Transition frequencies
Substrate	$f_{P \to N}$	$f_{P \to U}$	$f_{N \to P}$	$f_{N \to U}$
Double flap	0.6 ± 0.1	0.4 ± 0.1	0.4 ± 0.1	0.6 ± 0.1
Mixed flap	0.4 ± 0.1	0.6 ± 0.1	0.4 ± 0.1	0.6 ± 0.1
Downstream flap	0.34 ± 0.04	0.66 ± 0.04	0.4 ± 0.1	0.6 ± 0.1

Appendix 3—table 3

Rate constants for state-to-state transitions for Pol I interacting with flap-containing substrates.

	Rate constants (s^-1)
Substrate	$k_{P \to N}$	$k_{P \to U}$	$k_{N \to P}$	$k_{N \to U}$
Double flap	1.2 ± 0.1	0.6 ± 0.2	0.56 ± 0.05	1.0 ± 0.2
Mixed flap	0.58 ± 0.04	0.8 ± 0.2	0.8 ± 0.1	1.3 ± 0.3
Downstream flap	0.34 ± 0.02	0.7 ± 0.1	1.6 ± 0.1	2.1 ± 0.4

Appendix 3—table 4

Statistical frequencies of state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.

	Transition frequencies
Substrate	$f_{P \to N}$	$f_{P \to U}$	$f_{N \to P}$	$f_{N \to U}$
Nick	0.4 ± 0.1	0.6 ± 0.1	0.5 ± 0.1	0.5 ± 0.1
1nt gap	0.64 ± 0.04	0.36 ± 0.04	0.67 ± 0.04	0.33 ± 0.04
2nt gap	0.6 ± 0.1	0.4 ± 0.1	0.7 ± 0.1	0.3 ± 0.1
3nt gap	0.6 ± 0.1	0.4 ± 0.1	0.66 ± 0.04	0.34 ± 0.04
4nt gap	0.54 ± 0.05	0.46 ± 0.05	0.7 ± 0.1	0.3 ± 0.1

Appendix 3—table 5

Rate constants for state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.

	Rate constants ( $/ s$ )
Substrate	$k_{P \to N}$	$k_{P \to U}$	$k_{N \to P}$	$k_{N \to U}$
Nick	0.47 ± 0.02	0.6 ± 0.1	1.5 ± 0.1	1.7 ± 0.3
1nt gap	0.52 ± 0.02	0.30 ± 0.04	1.6 ± 0.1	0.8 ± 0.1
2nt gap	0.34 ± 0.02	0.23 ± 0.04	1.3 ± 0.1	0.6 ± 0.1
3nt gap	0.32 ± 0.02	0.23 ± 0.04	1.14 ± 0.05	0.6 ± 0.1
4nt gap	0.20 ± 0.02	0.17 ± 0.03	1.4 ± 0.1	0.6 ± 0.2

Appendix 3—table 6

Binding of Pol I to various DNA substrates.

Substrate	$f_{B}$	$K_{d}$ ( $nM$ )
Nick	0.20 ± 0.02	20 ± 3
1nt gap	0.39 ± 0.02	8 ± 1
2nt gap	0.47 ± 0.04	6 ± 1
3nt gap	0.52 ± 0.05	5 ± 1
4nt gap	0.56 ± 0.04	4 ± 1
primer/template	0.27 ± 0.02	14 ± 2

Appendix 4—table 1

Steady-state fluorescence controls.

Labeled macromolecule	Label	Ligand	Normalized intensity $^{a, b}$	Anisotropy $^{a}$
Double flap	A488	none	1.0	0.05 ± 0.01
		Pol I	0.94	0.21 ± 0.05
Primer/template	A488	none	1.0	0.05 ± 0.01
		Pol I	1.2	0.22 ± 0.01
Pol I	A594	none	1.0	0.32 ± 0.02
		double flap	1.2	0.34 ± 0.03
		primer/template	1.1	0.34 ± 0.03

$^{a}$ total emission intensity normalized to the value for the free macromolecule $^{b}$ A488 data obtained with excitation at 495 nm, A594 with excitation at 590 nm

Additional files

Transparent reporting form: https://cdn.elifesciences.org/articles/62046/elife-62046-transrepform-v1.docx
Download elife-62046-transrepform-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Raymond F Pauszek III
Rajan Lamichhane
Arishma Rajkarnikar Singh
David P Millar

(2021)

Single-molecule view of coordination in a multi-functional DNA polymerase

eLife 10:e62046.

https://doi.org/10.7554/eLife.62046

Figures

Activities of Pol I and three-dimensional structures of Pol I homologs.

DNA substrates used in this study.

Probing the location of DNA substrates within Pol I.

Additional examples of smFRET trajectories (blue) and corresponding donor intensity (green) and acceptor intensity (red).

Interaction of Pol I with mismatched primer/template.

Histogram of emission intensities resulting from direct excitation of A594 in Pol I bound to downstream flap DNA, compiled from 102 individual emission trajectories.

Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with flap-containing DNA substrates, compiled from a total of n transitions.

Interaction of Pol I with primer/template DNA or DNA substrates containing a nick or gap.

Histograms and TDPs of Pol I L361A and KF interacting with 1nt gap DNA.

Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with nick- or gap-containing DNA substrates, compiled from a total of n transitions.

Probing the location of the 5’ nuc domain within Pol I bound to flap substrates.

Location of the 5’ nuc domain within Pol I bound to primer/template substrate.

Possible configurations of Pol I-DNA complexes.

PAGE analysis of Pol I expression and purification steps.

Tables

Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 1.

Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 2.

Binding of Pol I to flap-containing DNA substrates.

Statistical frequencies of state-to-state transitions for Pol I interacting with flap-containing substrates.

Rate constants for state-to-state transitions for Pol I interacting with flap-containing substrates.

Statistical frequencies of state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.

Rate constants for state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.

Binding of Pol I to various DNA substrates.

Steady-state fluorescence controls.

Additional files

Transparent reporting form

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

Activities of Pol I and three-dimensional structures of Pol I homologs.

DNA substrates used in this study.

Probing the location of DNA substrates within Pol I.

Additional examples of smFRET trajectories (blue) and corresponding donor intensity (green) and acceptor intensity (red).

Interaction of Pol I with mismatched primer/template.

Histogram of emission intensities resulting from direct excitation of A594 in Pol I bound to downstream flap DNA, compiled from 102 individual emission trajectories.

Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with flap-containing DNA substrates, compiled from a total of n transitions.

Interaction of Pol I with primer/template DNA or DNA substrates containing a nick or gap.

Histograms and TDPs of Pol I L361A and KF interacting with 1nt gap DNA.

Dwell time histograms for overall decay of state P (left column) or state N (right column) for Pol I interacting with nick- or gap-containing DNA substrates, compiled from a total of n transitions.

Probing the location of the 5’ nuc domain within Pol I bound to flap substrates.

Location of the 5’ nuc domain within Pol I bound to primer/template substrate.

Possible configurations of Pol I-DNA complexes.

PAGE analysis of Pol I expression and purification steps.

Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 1.

Sequences of DNA oligonucleotides used to construct substrates for FRET scheme 2.

Binding of Pol I to flap-containing DNA substrates.

Statistical frequencies of state-to-state transitions for Pol I interacting with flap-containing substrates.

Rate constants for state-to-state transitions for Pol I interacting with flap-containing substrates.

Statistical frequencies of state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.

Rate constants for state-to-state transitions for Pol I interacting with nick- or gap-containing substrates.

Binding of Pol I to various DNA substrates.

Steady-state fluorescence controls.

Transparent reporting form

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)