Figures and data in Starvation-induced regulation of carbohydrate transport at the blood–brain barrier is TGF-β-signaling dependent

Figures
Tables
Additional files

9 figures, 1 table and 1 additional file

Figures

Figure 1

Download asset Open asset

Tret1-1 expression is upregulated upon starvation.

(A) Scheme of the starvation paradigm. Fed animals were kept for 96 hr on normal food before dissecting. Starved animals were transferred onto a water-soaked filter paper 56 hr after larval hatching. Forty hour later these animals were also dissected and immunohistochemistry was performed. (**B–E**) Brains of fed larvae expressing CD8-GFP in the subperineurial glial cells (Gli>>CD8-GFP) stained for GFP (green) and Tret1-1 (magenta/gray). (**B`–E`**) Brains of starved larvae with the same genotype. (**D, D`**) Tret1-1 expression in the perineurial glial cells is induced upon starvation. (**E, E`**) Close up of the BBB. Tret1-1 is localized in vesicles and its expression is elevated upon starvation. Tret1-1 is localized to the plasma membrane (arrows).

Figure 2 with 1 supplement

Download asset Open asset

Tret1-1 intracellular trafficking depends on Rab7 and Rab10.

(**A, C**) Tret1-1 staining of the ventral nerve cord of glia-specific (repo-Gal4) knockdowns (**A`, B`, C`, D`**) shows a close up of the BBB. Dotted lines show the outline of the perineurial glia. (**B, B`**) Tret1-1 expression is strongly reduced by a glial Rab7 (*Rab7^JF02377*) knockdown. (**D, D`**) Disrupting Rab10 expression in glia (*Rab10^GD13414*) induces accumulation of Tret1-1 in the perineurial glia cytosol. (**E–G`**) Glial expression of the dominant-negative constructs *Rab7^T22N* and *Rab10^T23N* induce similar phenotypes as the RNA interference mediated knockdowns. (**F, F`**) Expressing *Rab7^T22N* reduces Tret1-1 staining. (**G, G`**) Glia expression of *Rab10^T23N* induces transporter mislocalization and a strong accumulation in the perineurial cytosol. (**F–G`**) The dominant-negative Rab-constructs are Rab-YFP fusions. Panglial overexpression thus leads to a weak background staining in the green channel (asterisks). (C) Tret1-1 staining of surface and cortex glia-specific knockdown using 46 F-Gal4 and *Rab7^JF02377* and *Rab10^GD13414*. Loss of Rab7 reduces Tret1-1 staining, while Rab10 disruption induces transporter mislocalization.

Figure 2—figure supplement 1

Download asset Open asset

Rab7, Rab10, Rab19, and Rab23 colocalize with Tret1-1 vesicles.

Co-staining of endogenous EYFP-tagged Rab-GTPases (green) and Tret1-1 (magenta) in the surface glia of third-instar larval brains. (**A–D**) GFP-stained Rab-GTPases. (**A`–D`**) Tret1-1 is stained in magenta. (**A``–D``**) Merge of GFP and Tret1-1 staining. Representative overlapping stainings are indicated by an arrow. All *Drosophila* Rab-GTPases endogenously labeled with EYFP were tested. Tret1-1-positive vesicles show overlapping staining with Rab7^EYFP, Rab10^EYFP, Rab19^EYFP, and Rab23^EYFP.

Figure 3 with 1 supplement

Download asset Open asset

Tret1-1 is transcriptionally upregulated upon starvation.

(A) Tret1-1 is transcriptionally upregulated upon starvation since the Tret1-1 reporter *Tret1-1>stgGFP* is significantly upregulated in brains of starved compared to fed larvae as seen in western blots. Shown are images of representative western blots for anti-GFP and anti-tubulin (loading control). n=3 (A`) Quantification of Western blots. N=3. (B) Tret1-1 protein is significantly upregulated upon starvation in *Tret1-1>stgGFP* animals. Quantified is the GFP fluorescence normalized to DAPI in individual nuclei. N=5 , n > 34.

Figure 3—figure supplement 1

Download asset Open asset

Tret1-1 promoter drives specific expression.

(A) Schematic of the *Tret1-1* locus and the transcripts encoding the two Tret1-1 isoforms. The *Tret1-1* promoter region used to generate *Tret1-1-Gal4* and *tret1-1-stgGFP* is highlighted in gray. (**B–B``**) Tret1-1PA staining (green, gray) overlaps with *Tret1-1*-driven RFP (magenta, gray) (*Tret1-1-Gal4 UAS-RFP*), verifying the specificity of the *Tret1-1* promotor region. Arrows indicate representative overlays. (**C–C```**) Co-staining of Apontic (blue, gray) and stgGFP (green, gray) that shows that *Tret1-1*-driven stgGFP is specifically expressed in perineurial glial nuclei. Arrows indicate representative overlay expressions.

Figure 4

Download asset Open asset

Tret1-1 upregulation upon starvation is sugar-dependent.

(**A- A``**) Brains of larvae kept on normal food, under starvation conditions or on sugar food (10% sucrose) were stained for Tret1-1. (A`) Tret1-1 expression is elevated upon starvation of the animal. (**A``**) Dietary sugar reverses Tret1-1 upregulation completely. (B) Quantification of Tret1-1 expression in starved wild type animals and wild type animals on sugar food. The quantification shows the ratio of relative Tret1-1 fluorescence intensity in the perineurial glial cells of starved versus fed and sugar-fed vs. fed animals. N≥4; n=9-15; *p<0,05.

Figure 5

Download asset Open asset

Carbohydrate uptake rate into the surface glia is elevated upon starvation.

(A) Carbohydrate uptake capacity of *Xenopus laevis* oocytes heterologously expressing Tret1-1PA-3xHA. Tret1-1PA facilitates uptake of glucose and trehalose. In contrast, fructose uptake rate is minor. (**B–C`**) Expressing *Tret1-1^GD17787* in glial cells induces a loss of the specific Tret1-1 staining in perineurial glia. (C`) No increase upon starvation can be detected. (D) Glucose uptake was measured in ex vivo brains of fed or starved larvae using the genetically encoded glucose sensor FLII¹²Pglu-700µδ6. Shown are mean traces (n = 10). Error bars are standard error. (E) The glucose uptake rate is significantly higher in brains of starved control larvae compared to fed control larvae. Knocking down Tret1-1 prohibits the increased glucose uptake upon starvation. (F) In addition, the maximum intracellular glucose concentration is significantly higher in starved control larvae than in fed control larvae, suggesting that the uptake rate exceeds the rate of metabolism. This effect is also abolished when Tret1-1 is impaired in BBB-glia. N = 3, n ≥ 10.

Figure 6 with 1 supplement

Download asset Open asset

Tret1-1 regulation upon starvation is insulin and AKH independent.

(**A–C`**) Tret1-1 staining of the ventral nerve cord of starved and fed larvae expressing dominant-negative forms (InR^K1409A or InR^R418P) of the insulin receptor (InR) in the perineurial and subperineurial glial cells. (**B, B`, C, C`**) Tret1-1 levels in fed and starved animals expressing InR dominant negative are indistinguishable from wild type. (**B`, C`**) Tret1-1 upregulation upon starvation is seen in all cases. (D) Quantification of Tret1-1 upregulation in animals expressing InR^K1409A or InR^R418P. Shown is the ratio of relative Tret1-1 fluorescence intensity in the perineurial glial cells of starved versus fed animals. No significant differences between the genotypes are observed. N = 4, n = 12–16. (**E–G`**) Tret1-1 staining of the ventral nerve cord of starved and fed wild-type and *Akh^−/−* mutant animals (*Akh^SAP* or *Akh^AP*). Tret1-1 levels in fed and starved mutant animals are indistinguishable from wild type. (**F`, G`**) Tret1-1 upregulation upon starvation can be seen in all mutants. (H) Quantification of Tret1-1 intensities of *Akh^SAP* or *Akh^AP*. Shown is the ratio of relative Tret1-1 fluorescence intensity in the perineurial glial cells of starved versus fed animals. No significant differences are observed. N = 3, n = 5–8.

Figure 6—figure supplement 1

Download asset Open asset

Tret1-1 regulation upon starvation is ALK-independent.

(**A, B`**) Tret1-1 staining of the ventral nerve cord of starved and fed control (*repo>>mCherry-dsRNA*, **A, A`**) and *alk* knockdown (*repo>>alk^GD42*, **B, B`**) animals. (B`) Tret1-1 upregulation is still induced in starved *alk* knockdown animals.

Figure 7

Download asset Open asset

Tret1-1 upregulation upon starvation is BMP-mediated TGF-β signaling dependent.

(**A, A`, I, I`**) Tret1-1 staining of the ventral nerve cord of starved and fed control (*repo>>mCherry-dsRNA*) animals and animals with a glial TGF-β knockdown. (**B, B`, C, C`**) Knockdown of the type I receptor Put in glial cells using two different dsRNA constructs (*put^GD2545* and *put^KK102676*) abolished Tret1-1 upregulation upon starvation. (**D, D`**) Glia-specific knockdown of *wit* using *wit^KK100911* does not affect Tret1-1 upregulation upon starvation. (**F, F`**) Glia-specific knockdown of the activin-branch-specific type II receptor Babo (using *babo^NIG8224R-1*) does not have any influence on Tret1-1 upregulation upon starvation (compare to control in **E, E`**). (**G, G`, H, H`**) The glia-specific knockdown of the BMP-branch-specific type II receptor Sax (using *sax^GD2546* and *sax^GD50*) does not influence Tret1-1 expression (compare to control in **E, E`**). (**I, I`**) In contrast, glia-specific knockdown of the main BMP-branch-specific type II receptor Tkv (using *tkv^KK1023019*) abolishes Tret1-1 upregulation upon starvation (compare to control in **E, E`**). This indicates that signaling via the BMP branch of TGF-β signaling regulates Tret1-1 induction upon starvation. (J) Quantification of Tret1-1 upregulation upon starvation. Shown is the ratio of relative Tret1-1 fluorescence intensity in the perineurial glial cells of starved versus fed animals. N ≥ 4, n = 10–22. (K) Schematic representation of the two branches of the TGF-β signaling pathway.

Figure 8

Download asset Open asset

Tret1-1 upregulation depends on Gbb-mediated signaling.

(**A–C**) Tret1-1 staining of the ventral nerve cord of fed control (9137>>GFP) animals or animals overexpressing either Gbb or Dpp in the perineurial and subperineurial glial cells (using 9137-Gal4). (B) Overexpression of Gbb induces increased Tret1-1 expression in fed animals. (C) Differently, overexpression of Dpp does not have any effect on the Tret1-1 expression. (D) Quantification of Tret1-1 upregulation upon overexpression of Gbb or Dpp in fed animals. The quantification shows Tret1-1 expression levels in the perineurial glial cells normalized to those in controls (9137>>GFP). N = 4; n = 20–25; (**E–F``**) Gbb is expressed in perineurial glial cells (coexpression with Tret1-1) and in other glial cell types, most likely subperineurial glial cells and cortex glial cells. (**G–H`**) Upon starvation expression of Tret1-1 and Gbb is increased in the VNC. (I) Quantification of Gbb upregulation upon starvation in the brain. N = 5; n > 17.

Author response image 1

Download asset Open asset

Tret1-1 upregulation upon starvation is independent of TOR signaling.

Quantified is the ratio of Tret1-1 fluorescence intensities in starved larval VNCs vs. VNCs of fed animals. Knockdown of TOR expressing using either TOR³³⁹⁵¹ or TOR³⁵⁵⁷⁸ in glial cells shows a comparable upregulation of Tret1-1 to the control. N=5 n >9.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Drosophila melanogaster)	Tret1-1		FBgn0050035
Genetic reagent (D. melanogaster)	jeb^KK111857	Vienna Drosophila Resource Center	v103047; FBgn0086677; FBst0474909
Genetic reagent (D. melanogaster)	jeb^GD5472	Vienna Drosophila Resource Center	v30800; FBgn0086677; FBst0458662
Genetic reagent (D. melanogaster)	Alk^GD42	Vienna Drosophila Resource Center	v11446; FBgn0040505; FBst0450267
Genetic reagent (D. melanogaster)	put^KK102676	Vienna Drosophila Resource Center	v107071; FBgn0003169; FBst0478894
Genetic reagent (D. melanogaster)	put^GD2545	Vienna Drosophila Resource Center	v37279; FBgn0003169; FBst0461929
Genetic reagent (D. melanogaster)	wit^KK100911	Vienna Drosophila Resource Center	v103808; FBgn0024179; FBst0475666
Genetic reagent (D. melanogaster)	sax^GD50	Vienna Drosophila Resource Center	v42457; FBgn0003317; FBst0464598
Genetic reagent (D. melanogaster)	sax^GD2546	Vienna Drosophila Resource Center	FBgn0003317
Genetic reagent (D. melanogaster)	tkv^KK102319	Vienna Drosophila Resource Center	v105834; FBgn0003716; FBst0477660
Genetic reagent (D. melanogaster)	Rab10^GD13414	Vienna Drosophila Resource Center	v28758; FBgn0015789; FBst0457628
Genetic reagent (D. melanogaster)	Rab10^GD16778	Vienna Drosophila Resource Center	v46792; FBgn0015789; FBst0466897
genetic reagent (D. melanogaster)	Rab10^KK109210	Vienna Drosophila Resource Center	v101454; FBgn0015789; FBst0473327
Genetic reagent (D. melanogaster)	Tret1-1^GD17787	Vienna Drosophila Resource Center	v52360; FBgn0050035; FBst0469787
Genetic reagent (D. melanogaster)	Rab7^T22N	Bloomington Drosophila Stock Center	9778; FBgn0015795
Genetic reagent (D. melanogaster)	Rab10^T23N	Bloomington Drosophila Stock Center	9778; FBgn0015795; FBst0009778
Genetic reagent (D. melanogaster)	Rab7^EYFP	Bloomington Drosophila Stock Center	62545; FBgn0015795; FBst0062545
Genetic reagent (D. melanogaster)	Rab10^EYFP	Bloomington Drosophila Stock Center	62548; FBgn0015789; FBst0062548
Genetic reagent (D. melanogaster)	Rab19^EYFP	Bloomington Drosophila Stock Center	62552; FBgn0015793; FBst0062552
Genetic reagent (D. melanogaster)	Rab23^EYFP	Bloomington Drosophila Stock Center	62554; FBgn0037364; FBst0062554
Genetic reagent (D. melanogaster)	Rab7^TRIP.JF02377	Bloomington Drosophila Stock Center	27051; FBgn0015795; FBst0027051
Genetic reagent (D. melanogaster)	InR^K1409A	Bloomington Drosophila Stock Center	FBgn0283499
Genetic reagent (D. melanogaster)	InR^R418P	Bloomington Drosophila Stock Center	FBgn0283499
Genetic reagent (D. melanogaster)	UAS-dpp	Bloomington Drosophila Stock Center	1486; FBgn0000490
Genetic reagent (D. melanogaster)	Cherry^dsRNA	Bloomington Drosophila Stock Center	35785; FBti0143385
Genetic reagent (D. melanogaster)	UAS-CD8-GFP	Bloomington Drosophila Stock Center	30002 or 30003
Genetic reagent (D. melanogaster)	Akh^AP	Gáliková et al., 2015 doi: 10.1534/genetics.115.178897	FBal0319564
Genetic reagent (D. melanogaster)	Akh^SAP	Gáliková et al., 2015 doi: 10.1534/genetics.115.178897	FBal0319565
Genetic reagent (D. melanogaster)	babo^NIG8224R	Japanese National Institute of Genetics	FBal0275907
Genetic reagent (D. melanogaster)	gliotactin-Gal4	Sepp et al., 2001 Doi: 10.1006/dbio.2001.0411	–
Genetic reagent (D. melanogaster)	repo-Gal4	Sepp et al., 2001 Doi: 10.1006/dbio.2001.0411	–
Genetic reagent (D. melanogaster)	46 F-Gal4	Xie and Auld, 2011 Doi: 10.1242/dev.064816	–
Genetic reagent (D. melanogaster)	9137-Gal4	DeSalvo et al., 2014 Doi: 10.3389/fnins.2014.00346	–
Genetic reagent (D. melanogaster)	UAS-FLII¹²Pglu-700µδ6	Volkenhoff et al., 2018 Doi: 10.1016/j.jinsphys.2017.07.010	Maintained at S. Schirmeier lab
Genetic reagent (D. melanogaster)	UAS-Gbb	P. Soba	–
Genetic reagent (D. melanogaster)	UAS-RFP	S. Heuser	–
Genetic reagent (D. melanogaster)	w¹¹¹⁸	Lindsley and Zimm, 1992 ISBN 9780124509900	–
Genetic reagent (D. melanogaster)	Tret1-1-stGFP	This paper	Maintained at S. Schirmeier	Tret1-1 promoter fusion to a nuclei-targeted GFP
Genetic reagent (D. melanogaster)	Tret1-1-Gal4	This paper	Maintained at S. Schirmeier	Tret1-1 promoter induced Gal4 expression
Antibody	anti-Tret1-1 guinea pig polyclonal	Volkenhoff et al., 2015	Maintained at S. Schirmeier Lab	(1:50)
Antibody	anti-Laminin rabbit polyclonal	Abcam	ab11575	(1:1000)
Antibody	anti-Repo mouse monoclonal	Developmental Studies Hybridoma Bank	8D12 anti-Repo	(1:2)
Antibody	anti-GFP mouse monoclonal	Molecular Probes	A11120	(1:1000)
Antibody	anti-GFP chicken polyclonal	Abcam	Ab92456	(1:1000)
Antibody	anti-GFP JL-8 mouse monoclonal	Clontech	Cat. 632381	(1:10000) WB
Antibody	anti-Tubulin mouse monoclonal	Developmental Studies Hybridoma Bank	12G10 anti-alpha-tubulin	(1:80) WB
Antibody	anti-Apontic rabbit polyclonal	Eulenberg and Schuh, 1997	Gifted from Reinhard Schuh	(1:150)
Antibody	anti-Gbb mouse monoclonal	Developmental Studies Hybridoma Bank	GBB 3D6-24	(1:20)
Recombinant DNA reagent	pBPGuw-stingerGFP (vector)	C. Klämbt
Recombinant DNA reagent	pBPGuwGal4 (vector)	Addgene	17575
Recombinant DNA reagent	pGEM-He-Juel (vector)	S. Bröer
Sequence-based reagent	Forward primer_Tret1-1prom	This paper	PCR primers	CACCGGTCTCAAGCTCTCTTTTTTGCCTTACATATTTT
Sequence-based reagent	Reverse primer_Tret1-1prom	This paper	PCR primers	TGGGTAAGTTGGAGAGAGAG
Sequence-based reagent	Forward primer Tret1-1 PA	This paper	PCR primers	CGTCTAGAATGAGTGGACGCGAC
Peptide, recombinant protein	Reverse primer Tret1-1 PA	This paper	PCR primers	CGAAGCTTCTAGCTTACGTCACGT
Commercial assay or kit	pENTR/D- TOPO Cloning Kit	Thermo Fisher Scientific	K240020
Commercial assay or kit	mMESSAGE mMACHINE T7 Kit	Thermo Fisher Scientific	AM1344
Chemical compound, drug	¹⁴C₁₂-trehalose	Hartmann Analytic, Braunschweig	#1249
Chemical compound, drug	¹⁴C₆-glucose	Biotrend, Köln	#MC144-50
Chemical compound, drug	¹⁴C₆-fructose	Biotrend, Köln	#MC1459-50
Chemical compound, drug	Rotiszint eco plus scintillation cocktail	Carl Roth	Art. No. 0016.3
Software, algorithm	SigmaPlot	Jadel	SPSS Inc
Software, algorithm	Fiji	NIH