A conserved cell division protein directly regulates FtsZ dynamics in filamentous and unicellular actinobacteria
- Department of Molecular Microbiology, John Innes Centre, United Kingdom
- Department of Cell and Developmental Biology, John Innes Centre, United Kingdom
- Department of Biological Sciences, Duquesne University, United States
Figures
Figure 1 with 3 supplements
sepH is required for sporulation septation in Streptomyces venezuelae.
(A) Schematic illustrating the multicellular life style of Streptomyces including the two FtsZ-dependent modes of cell division that occur in vegetative and sporogenic hyphae: cross-wall formation …
Figure 1—figure supplement 1
sepH is a direct target of the transcriptional regulators WhiA and WhiB.
ChIP-seq traces showing the enrichment of the FLAG-tagged developmental regulators WhiA and WhiB at binding sites upstream of sepH (vnz_27360) or their absence in the untagged wild-type (WT) control …
Figure 1—figure supplement 2
Spore length analysis of wild-type (WT) S. venezuelae, the ΔsepH mutant (SV56), and the complemented mutant strain ΔsepH/sepH+ (MB747).
A minimum of 347 spores were quantified for each biological replicate (n = 3) and strain. The dashed red lines indicate the median, and black dotted lines the 25/75th percentiles. Statistical …
-
Figure 1—figure supplement 2—source data 1
Spore size measurement data.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig1-figsupp2-data1-v1.xlsx
Figure 1—figure supplement 3
Localization and corresponding protein abundance of SepH-YPet in the wild-type (WT) and the ΔftsZ mutant.
(A) Localization pattern of constitutively produced SepH-YPet in the WT (MB858) and in an ΔftsZ mutant strain (MB859). Scale bar: 5 μm. (B) Virtual automated Western blot showing the accumulation of …
Figure 2 with 2 supplements
SepH is important for cell division leading to sporulation septa and vegetative cross-walls.
-
Figure 2—source data 1
Time-lapse fluorescence image series of selected and straightened hyphae (SS12) used to generate kymograph shown in Figure 2C.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig2-data1-v1.mp4
-
Figure 2—source data 2
Time-lapse fluorescence image series of selected and straightened hyphae (MB750) used to generate kymograph shown in Figure 2D.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig2-data2-v1.mp4
-
Figure 2—source data 3
Custom Python and R-scripts and extracted fluorescence intensities of Z-rings used to generate Figure 2E and F.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig2-data3-v1.zip
Figure 2—figure supplement 1
Additional examples of kymographs showing the localization of FtsZ-YPet over time in (A) wild-type (SS12) or (B) ΔsepH hyphae (MB750).
Scale bar: 2 μm.
Figure 2—figure supplement 2
FtsZ levels in wild-type and ΔsepH cells during sporulation.
FtsZ levels were determined by automated Western blot analysis using an anti-FtsZ polyclonal antibody (1:200). Lysates were analyzed in triplicate for each strain and FtsZ levels were quantified at …
Figure 3 with 3 supplements
The DUF3071 domain is crucial for SepH function in vivo.
(A) Schematic showing the SepH domain architecture and constructed truncations. Numbers indicate the relevant amino acid positions. (B–E) Fluorescence micrographs showing the localization of the …
Figure 3—figure supplement 1
Automated Western blot analysis of the different SepH-YPet constructs shown in Figure 3B–D.
Strains (MB918, MB827, MB828, SV56) were grown to mid-exponential phase and SepH-YPet fusions were detected using an anti-GFP antibody (1:200). Red arrow heads indicate expected size for each …
Figure 3—figure supplement 2
Control image showing the ΔsepH phenotype.
Cryo-SEM image showing sporulating hyphae of ΔsepH carrying an empty plasmid (MB749). Scale bar: 5 μm.
Figure 3—figure supplement 3
Constitutive expression of sepH-CTD-ypet does not rescue the ΔsepH phenotype.
Cryo-SEM image showing sporulating hyphae of ΔsepH producing SepH-CTD fused to YPet from the constitutive ermE* promoter (MB851, sepH-CTD-ypet++). Scale bar: 5 μm.
Figure 4 with 1 supplement
SepH is not associated with the nucleoid or required for chromosome segregation.
(A) Fluorescence micrographs showing the accumulation of SepH-YPet and the concomitant distribution of chromosomal DNA visualized using the nucleoid-associated protein HupA fused to mCherry (MB807). …
Figure 4—figure supplement 1
SepH does not bind DNA.
(A) Relative genome-wide distribution of putative SepH binding sites identified by ChIP-seq analysis using an anti-SepH polyclonal antibody during sporulation in wild-type versus ΔsepH (SV56) cells. …
Figure 5 with 5 supplements
SepH helix-turn-helix (HTH) motif is crucial for the interaction with FtsZ.
(A) Yeast two-hybrid analysis. The indicated proteins were fused to the GAL4 activation domain (AD) and the GAL4 DNA-binding domain (BD). The viability of the yeast strains expressing the respective …
-
Figure 5—source data 1
High-speed co-sedimentation data used in Figure 5F.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig5-data1-v1.pptx
Figure 5—figure supplement 1
Yeast-two hybrid analysis showing the complete set of tested interactions between SepH and different cell division proteins.
Growth and putative interaction between the different fusion proteins was verified by spotting the individual strains onto minimal media lacking either leucine and tryptophan (growth) or leucine, …
Figure 5—figure supplement 2
Cryo-SEM micrograph of sporulating ΔsepH hyphae expressing sepH-G79P ectopically from the native promoter (MB938).
Scale bar: 10 µm.
Figure 5—figure supplement 3
Biochemical characterization of SepH, SepH variants, and FtsZ.
(A) CD spectroscopy analysis of wild-type SepH (black) and SepH-G79P (red). Both proteins show a similar spectral pattern indicating that they are not significantly different in their secondary …
-
Figure 5—figure supplement 3—source data 1
Analytical gel filtration data.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig5-figsupp3-data1-v1.xlsx
Figure 5—figure supplement 4
Quantification of SepH and FtsZ abundance by quantitative (automated) Western blotting.
(A) and (B). Top, virtual Western blot image showing a dilution series of purified FtsZ (left) and SepH (right) used to generate a standard curve and endogenous FtsZ and SepH amounts in wild-type …
-
Figure 5—figure supplement 4—source data 1
High-speed co-sedimentation data with GMPCCP.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig5-figsupp4-data1-v1.pptx
Figure 5—figure supplement 5
High-speed co-sedimentation with GMPCCP.
3.5 µM FtsZ was incubated with 1 mM GMPCCP and in the presence or absence of 0.6 µM SepH as indicated. Reactions were incubated for 15 min followed by high-speed ultracentrifugation. The presence of …
Figure 6 with 3 supplements
SepH stimulates the polymerization of dynamic FtsZ protofilaments.
(A–D) Visualization of purified FtsZ and/or SepH using negative staining transmission electron microscopy (TEM). No structures were detected for 3.5 μM FtsZ in the absence of GTP (A), or 0.6 μM SepH …
Figure 6—figure supplement 1
Low-speed co-sedimentation with GTP.
Polymerized FtsZ (3.5 µM) was sedimented in the presence or absence of 0.6 µM SepH and 2 mM GTP following a 15 min incubation period. The presence of proteins in the supernatant (S) and pellet (P) …
-
Figure 6—figure supplement 1—source data 1
Low-speed co-sedimentation data with GTP.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig6-figsupp1-data1-v1.pptx
Figure 6—figure supplement 2
FtsZ filament morphology in the presence of excess SepH, SepH variants, and with GMPCCP.
(A–D) FtsZ (3.5 μM) filaments formed in the presence of 2 mM GTP and with either an equimolar ratio (1:1) of wild-type SepH (A) or at a 6:1 molar ratio with the different SepH variants SepH-G79P (B),…
Figure 6—figure supplement 3
Additional FtsZ polymerization results as measured by DLS.
Light scattering traces of 3.5 μM FtsZ assembly kinetics resulting from incubation with (A) SepH (0.6 μM) and 2 mM GDP, (B) with 2 mM GTP and 0.6. μM of the different SepH variants, or (C) in the …
Figure 7 with 5 supplements
SepHMs stimulates FtsZ polymerization and bundling in vitro.
(A) Phylogenetic tree showing the distribution of SepH within different actinobacterial orders. Major orders with more than two representative leaves are shown in different colors. Numbers denote …
-
Figure 7—source data 1
Alignment of SepH proteins used to construct phylogenetic tree and phylogenetic tree file with bootstrap values used to generate Figure 7A.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig7-data1-v1.zip
-
Figure 7—source data 2
Spore measurement data used in Figure 7B.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig7-data2-v1.xlsx
-
Figure 7—source data 3
Co-sedimentation data used in Figure 7F.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig7-data3-v1.xlsx
Figure 7—figure supplement 1
SepH sequence logo.
Logo generated from an alignment of 360 representative actinobacterial SepH sequences. Amino acids are colored according to their chemical properties. The SepH N-terminal region contains a highly …
-
Figure 7—figure supplement 1—source data 1
Alignment used to generate SepH sequence logo.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig7-figsupp1-data1-v1.zip
Figure 7—figure supplement 2
SDS gel showing purified SepHMs and FtsZMs.
Coomassie-stained SDS gel with SepH-6xHis (SepHMs) and untagged FtsZ (FtsZMs) from M. smegmatis.
Figure 7—figure supplement 3
Size exclusion chromatogram of purified SepHMs.
Based on the migration of MW standards, purified SepHMs is predicted to form a tetramer (4×). Experiment was performed in duplicate.
-
Figure 7—figure supplement 3—source data 1
Size exclusion chromatogram data.
- https://cdn.elifesciences.org/articles/63387/elife-63387-fig7-figsupp3-data1-v1.xlsx
Figure 7—figure supplement 4
GTP hydrolysis rate of FtsZMs with and without SepHMs.
Mean GTP hydrolysis rates of 6 µM FtsZMs, 3 µM SepHMs, and 6 µM FtsZMs in the presence of 3 µM SepHMs (1:0.5) or 6 μM SepHMs (1:1). Error bars represent SEM (n = 3).
Figure 7—figure supplement 5
FtsZMs (6 μM) filament bundles formed in the presence of 6 μM SepHMs and 2 mM GTP.
Filaments were visualized by negative stain TEM. Scale bar: 200 nm.
Figure 8
Model of SepH-mediated FtsZ remodeling in Streptomyces and Mycobacterium.
SepH (green) directly binds FtsZ (yellow) and stimulates the robust assembly of FtsZ protofilaments. Filament-associated SepH from M. smegmatis can further mediate lateral interactions between FtsZ …
Author response image 1
Representative TEM images of negative stained FtsZ polymers after 30 min of incubation with 2 mM GTP and in the absence or presence of either 0.
6 μM SepH (6:1) or 3.5 μM SepH (1:1). Scale bar: 200 nm.
Author response image 2
Average distance between Z-rings in wild-type and ∆sepH mutant hyphae.
Results are based on data extracted from 5 independent time-lapse series of sporulating wild-type and sepH-deficient hyphae, respectively, which were also used to generate kymographs shown in Figure …
Videos
Video 1
Time-lapse fluorescence and DIC microscopy movie showing the localization of FtsZ-YPet in vegetative and sporulating hyphae of wild-type S. venezuelae (SS12).
Scale bar: 10 μm.
Video 2
Time-lapse fluorescence and DIC microscopy movie showing growth and localization of FtsZ-YPet in vegetative and sporulating hyphae of the S. venezuelae ΔsepH mutant (MB750).
Scale bar: 10 μm.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Streptomyces venezuelae) | sepH | StrepDB | vnz_27360 | http://strepdb.streptomyces.org.uk/ |
| Gene (S. venezuelae) | ftsZ | StrepDB | vnz_08520 | http://strepdb.streptomyces.org.uk/ |
| Gene (Mycobacterium smegmatis mc2 155) | sepHMs | Mycobrowser | msmeg_5685 | https://mycobrowser.epfl.ch/ |
| Gene (M. smegmatis mc2 155) | ftsZMs | Mycobrowser | msmeg_4222 | https://mycobrowser.epfl.ch/ |
| Strain, strain background (S. venezuelae) | WT | NZ_CP018074.1 | NRRL B-65442 | Wild type |
| Genetic reagent (S. venezuelae) | ΔsepH::apr | This paper | SV56 | Chromosomal sepH locus was replaced by apr-oriT cassette amplified with primers mb118/mb119 and then transduced into WT using ΦSV1 |
| Antibody | Anti-SepH (Rabbit polyclonal) | This paper | Cambridge Research Biochemicals | Automated Western blot (1:200) |
| Antibody | Anti-FtsZ (Rabbit polyclonal) | This paper | Cambridge Research Biochemicals | Automated Western blot (1:200) |
| Antibody | Anti-GFP (Rabbit polyclonal) | Sigma Aldrich | SAB4301138-100UL | Automated Western blot (1:200) |
| Recombinant DNA reagent | pTB146 (plasmid) | doi:10.1038/emboj.2008.264 | Plasmid for heterologous protein production | |
| Recombinant DNA reagent | pET-21b (plasmid) | Novagen | 69741 | Plasmid for heterologous protein production |
| Recombinant DNA reagent | SepH (pFRL39, plasmid) | This paper | sepH in pTB146 | Purification of SepH |
| Recombinant DNA reagent | FtsZ, (pSS287, plasmid) | This paper | ftsZ in pTB146 | Purification of FtsZ |
| Recombinant DNA reagent | FtsZMs(pSS560, plasmid) | This paper | ftsZMs in pTB146 | Purification of FtsZMs |
| Recombinant DNA reagent | SepHMs(pSS561, plasmid) | This paper | sepHMs in pET21b | Purification of SepHMs |
| Sequence-based reagent | mb118 | This paper | Redirect PCR primer | CACGTGACGTCGGCAGGCACCACCCGGGAGGTCCCCATGATTCCGGGGATCCGTCGACC |
| Sequence-based reagent | mb119 | This paper | Redirect PCR primer | AGCCGCGGAACCGGCGGACCGCCACGGCTCCTGCCGTCATGTAGGCTGGAGCTGCTTC |
| Commercial assay or kit | 12–230 KDa Wes separation module | Bio-Techne | SM-W004 | Plate and capillaries for Automated Western blot |
| Commercial assay or kit | WES anti-rabbit detection module | Bio-Techne | DM-001 | Secondary antibody, luminol and reagents for Automated Western blot |
| Commercial assay or kit | Frozen-EZ Yeast Transformation II Kit | Cambridge Bioscience | T2001 | Yeast two-hybrid analysis |
| Commercial assay or kit | Pi ColorLock Kit | Expedeon | 303–0030 | |
| Commercial assay or kit | CellASIC ONIX B04A-03 Microfluidic Bacteria Plate | Millipore | B04A-03-5PK | Time-lapse microscopy |
| Chemical compound, drug | GTP | Jena Bioscience | NU-1012 | GTPase assay, DLS, TEM, Co- sedimentation |
| Chemical compound, drug | GDP | Sigma Aldrich | G7127-10MG | DLS, TEM, Co- sedimentation |
| Chemical compound, drug | GMPCPP (GpCpp) | Jena Bioscience | NU-405S | DLS, TEM, Co- sedimentation |
| Chemical compound, drug | WGA (Wheat Germ Agglutinin), Alexa Fluor 488 Conjugate | Molecular Probes | W11261 | Cell wall staining |
| Chemical compound, drug | 7-AAD (7-Aminoactinomycin D) | Molecular Probes | A1310 | DNA staining |
| Chemical compound, drug | HADA (3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl) carbonyl]amino]-D-alanine hydrochloride) | Other | Cell wall staining; Gift from M. Thanbichler: synthesized after doi:10.1038/nprot.2014.197 | |
| Software, algorithm | Fiji | Open-source software package | Image analysis | |
| Software, algorithm | ZenBlue 2012 | Zeiss | Version 1.120 | Image analysis |
| Software, algorithm | Compass for SW | Bio-Techne | Version 4.0 | WES |
| Software, algorithm | Prism | GraphPad | Version 9.0 | Data analysis |
| Software, algorithm | CLUSTALX | http://www.clustal.org/clustal2/ | Phylogenetic analysis | |
| Software, algorithm | MAFFT | https://mafft.cbrc.jp/alignment/software/ | Phylogenetic analysis | |
| Software, algorithm | MUSCLE | https://www.ebi.ac.uk/Tools/msa/muscle/ | Phylogenetic analysis | |
| Software, algorithm | CD-HIT | http://weizhongli-lab.org/cd-hit/ | Phylogenetic analysis | |
| Software, algorithm | TRIM-AL | http://trimal.cgenomics.org/ | Phylogenetic analysis | |
| Software, algorithm | PHYML | http://www.atgc-montpellier.fr/phyml/ | Phylogenetic analysis | |
| Software, algorithm | iTOL | https://itol.embl.de/ | Phylogenetic analysis | |
| Software, algorithm | WebLogo3 | http://weblogo.threeplusone.com/ | Sequence logo |
Additional files
-
Supplementary file 1
Tables listing bacterial strains, plasmids, and oligonucleotides used in this study.
- https://cdn.elifesciences.org/articles/63387/elife-63387-supp1-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/63387/elife-63387-transrepform-v1.docx
