Leptin receptor neurons in the dorsomedial hypothalamus regulate diurnal patterns of feeding, locomotion, and metabolism
- UW Medicine Diabetes Institute, Department of Medicine, University of Washington, United States
- Department of Neurosurgery, Barrow Neurological Institute, United States
Figures
Figure 1 with 2 supplements
Silencing DMHLepR neurons elicits transient hyperphagia and increased adiposity in adult male mice.
(A) Experimental schematic for chronic inhibition of DMHLepR by microinjection on day 0 of an AAV1 containing a Cre-dependent GFP-fused TeTx delivered bilaterally to the DMH of LepR-Cre+ male mice …
-
Figure 1—source data 1
Longitudinal measures following DMH-LepR TeTx.
- https://cdn.elifesciences.org/articles/63671/elife-63671-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Representative viral expression is evident in both the ventral and dorsal compartments of the dorsomedial hypothalamic nucleus (DMH) following microinjection of GFP:TeTx to the DMH of LepR-Cre+ male mice.
Animal #6 represents a surgical miss and was excluded from all analyses.
Figure 1—figure supplement 2
Silencing DMHLepR neurons in female mice recapitulates body weight and fat mass increase observed in males, but not acute hyperphagia.
(A) Average daily food intake following chronic inhibition of DMHLepR by bilateral microinjection on day 0 of a Cre-dependent GFP:TeTx delivered to LepR-Cre+ female mice (TeTx; n=9) and Cre-negative …
Figure 2
Validation of DMHLepR neuronal targeting and evidence that activation of these neurons is required for leptin-induced anorexia.
(A) Left: Representative image showing extensive overlap of pSTAT3 expression in GFP:TeTx-expressing DMHLepR in mice sacrificed 90 min after leptin administration (i.p. 5 mg/kg). Right: Higher …
-
Figure 2—source data 1
Fast-refeeding +/- Leptin.
- https://cdn.elifesciences.org/articles/63671/elife-63671-fig2-data1-v2.xlsx
Figure 3 with 2 supplements
DMHLepR neuron inactivation disrupts diurnal patterns of food intake, LMA, heat production, and substrate utilization.
Two-hour binned continuous measures (left panels) and mean values across the light (L) and dark (D) periods (right panels) 30 days following microinjection of GFP:TeTx (TeTx; n=7) or GFP control …
-
Figure 3—source data 1
Female calorimetry.
- https://cdn.elifesciences.org/articles/63671/elife-63671-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Silencing DMHLepR neurons rapidly and robustly disrupts diurnal rhythms in food intake, peripheral substrate utilization, and LMA.
(A) Representative viral expression in DMHLepR from LepR-Cre+ male mice injected bilaterally with an AAV encoding Cre-dependent GFP (left) as a control (control; n=7) or Cre-dependent GFP:TeTx …
Figure 3—figure supplement 2
Silencing DMHLepR neurons in female mice recapitulates the effect in males to disrupt diurnal rhythms.
Two-hour binned continuous measures (left panels) and photoperiod-averaged values (right panels) 30 days following bilateral microinjection of Cre-dependent GFP:TeTx (TeTx; n=9) or GFP control …
Figure 4 with 1 supplement
DMHLepR neurons are required for adaptation to a dark-cycle restricted feeding schedule.
(A) Experimental timeline. Six weeks following bilateral microinjection of Cre-dependent GFP:TeTx (TeTx; n=7) or GFP control (control; n=7) to the dorsomedial hypothalamic nucleus (DMH) of LepR-Cre+ …
-
Figure 4—source data 1
Body weight, RER, EE, and LMA during TRF.
- https://cdn.elifesciences.org/articles/63671/elife-63671-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
TRF corrects phase shifts in RER, but has no effect on LMA.
(A) Ad lib body weight before TRF paradigm. Unpaired t-test, t(11.92)=2.946, p=0.0123. (B) Dark-cycle food intake during TRF lead-in. Two-way ANOVA: F(1,12)=10.74; p=0.0066 (main effect of TeTx). (C)…
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | B6; LeprIRES-Cre/+ | Jackson Labs | RRID:IMSR_JAX:008320 | |
| Antibody | Anti-GFP (chicken polyclonal) | Abcam | Cat# ab13970; RRID:AB_300798 | IF (1:10,000) |
| Antibody | Anti-pSTAT3 (rabbit monoclonal) | Cell Signaling Technology | Cat# 9145; RRID:AB_2491009 | IF (1:300) |
| Recombinant DNA reagent | AAV1-CBA-DIO-GFP:TeTx | A gift from Richard Palmiter and Larry Zweifel, Han et al., 2015 | NA | |
| Recombinant DNA reagent | AAV5-hSyn-DIO-EGFP | AddGene | Addgene viral prep #50457-AAV5; RRID:Addgene_50457 | pAAV-hSyn-DIO-EGFP was a gift from Bryan Roth |
| Sequence-based reagent | LepR_WT_forward primer | Jackson Labs | PCR primer | For: 5'- TGCACATTCCCAGCCCAGTGT |
| Sequence-based reagent | Lepr_forward primer | Jackson Labs | PCR primer | For: 5' - CACGACCAAGTGACAGCAAT |
| Sequence-based reagent | Lepr_common_reverse primer | Jackson Labs | PCR primer | Rev: 5' - GACAGGCTCTACTGGAATGGA |
| Peptide, recombinant protein | Recombinant mouse leptin | A F Parlow; National Hormone and Peptide Program | Leptin | |
| Commercial assay or kit | Mouse leptin ELISA | Crystal Chem Cat #90030 | RRID:AB_2722664 | |
| Commercial assay or kit | Mouse insulin ELISA | Crystal Chem Cat #90080 | RRID:AB_2783626 | |
| Software, algorithm | Prism 9 | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | ImageJ | Fiji | RRID:SCR_002285 | |
| Software, algorithm | Illustrator | Adobe | RRID:SCR_010279 |
