Loss of MGA repression mediated by an atypical polycomb complex promotes tumor progression and invasiveness
- Basic Sciences Division, Fred Hutchinson Cancer Research Center, United States
- Human Biology and Public Health Sciences Divisions, Fred Hutchinson Cancer Research Center, United States
- Clinical Research Division, Fred Hutchinson Cancer Research Center, United States
- Comparative Pathology, Fred Hutchinson Cancer Research Center, United States
- Department of Medicine, University of Washington School of Medicine, United States
- Greehey Children's Cancer Research Institute, The University of Texas Health Science Center, United States
Figures
Figure 1 with 1 supplement
Mga inactivation in vivo leads to accelerated tumorigenesis.
(A) Schematic of lentiCRISPRv2cre vector and strategy used for in vivo Kras (K) and Kras, Tp53 (KP) experiments. (B) Kaplan–Meier curve for survival in sgMga (Cre-Cas9) vs Empty (Cre-Cas9 lacking …
Figure 1—figure supplement 1
Mga inactivation in vivo leads to accelerated tumorigenesis.
(A) Oncoprint of TCGA and GENIE consortium data on genetic alterations in MGA in lung adenocarcinoma patients. (B) Kaplan–Meier curve for survival probability based on low and high expression of MGA …
Figure 2 with 1 supplement
MGA loss leads to the de-repression of PRC1.6 and MYC targets and upregulation of pro-invasion genes.
(A) Volcano plot of Kras tumor RNA profiling data comparing Kras and Kras-sgMga tumors (see Figure 1B–D). Upregulated pro-invasion and PRC1.6 targets highlighted in green. (B, C) Hallmark and …
Figure 2—figure supplement 1
MGA loss leads to the de-repression of PRC1.6 and MYC targets and upregulation of pro-invasion genes.
(A) Schematic depicting workflow of Kras tumor RNA-Seq. (B) PCA of Kras-sgMGA and Empty tumor RNA-Seq (n = 8 Empty, n = 6 sgMga). (C) Heatmap of downregulated immune cell and inflammation related …
Figure 3 with 1 supplement
MGA binds and stabilizes PRC1.6 complex members in lung cancer cells.
(A) Mass spectrometric analysis of proteins interacting with FLAG- His-double tagged full-length MGA or isolated aa967–1300 (encompassing the DUF4801 region) and aa2153–2853 (encompassing the bHLHZ …
Figure 3—figure supplement 1
PRC1.6 complex member mRNA levels unchanged upon MGA loss in lung cancer cells.
Normalized CPM values for PRC1.6 member RNAs in KP cells (n = 2 empty lines in triplicate, n = 3 sgMga lines in triplicate). Error bars represent SEM.
Figure 4 with 1 supplement
The region containing the DUF4801 domain is critical for MGA’s tumor suppressive function.
(A) Immunoblot showing co-immunoprecipitation of L3MBTL2 with full length or MGA∆1003–1304 (ΔDUF). (B) Representative co-staining for Ki67 and MGA deficient mouse KP cells expressing MGA or …
Figure 4—figure supplement 1
Cancer associated mutations within MGA.
(A) Frequently occurring mutations in MGA across pan-cancer TCGA. (B) Mutations occurring within MGA in TCGA LUAD patients: black and green lollipops represent truncating mutations (black: nonsense …
Figure 5 with 1 supplement
MGA is essential for PRC1.6 genomic binding in tumor cells.
(A) Venn diagram showing overlap between MAX, MGA, E2F6, and L3MBTL2 bound genes in KP cells. (B) Heatmaps showing genome-wide promoter proximal (±2 kb) binding by the indicated transcription …
Figure 5—figure supplement 1
MGA, PRC1.6, and MYC binding and activity in human and murine LUAD-derived cells.
(A) Cut and Run generated heatmaps showing genome-wide promoter proximal (±2 kb) binding by the indicated transcription factors in control (empty) and sgMga A549 human LUAD cells. (B, C) Tracks from …
Figure 6 with 1 supplement
PRC1.6 complex subunits contribute to MGA mediated repression.
(A) Heat map of 50 top upregulated RNAs in KP tumor cell line treated with sgControl, sgMga, sgL3MBTL2, and sgPCGF6 +sgL3MBTL2 as determined by RNA-Seq. Differential expression of RNAs ranked …
Figure 6—figure supplement 1
PRC1.6 complex subunits contribute to MGA mediated activation.
(A) Immunoblot of the indicated proteins following treatment with the indicated sgRNA. sgL+P = sgL3MBTL2 and sgPCGF6 (B) Heat map of 50 top downregulated RNAs in KP tumor cell line treated with …
Figure 7 with 1 supplement
MGA loss correlates with activation of STAG3 and PODXL2 in human lung cancer and results in a pro-invasive phenotype in vitro.
(A) Volcano plot of transcripts that are differentially expressed in MGA altered (n = 52) vs. WT (n = 455) from pancancer TCGA lung adenocarcinoma data. Representative genes highlighted in green. (B)…
-
Figure 7—source data 1
MGA loss correlates with activation of STAG3 AND PODXL2 in human lung cancer and results in a pro-invasive phenotype in vitro.
Source data related to Figure 7I,J,K, and L.
- https://cdn.elifesciences.org/articles/64212/elife-64212-fig7-data1-v1.xlsx
Figure 7—figure supplement 1
Manipulation of MGA in human lung cancer cell lines results in a pro-invasive phenotype and activation of PRC1.6 targets.
(A) Genetic alteration in MGA and expression changes in STAG3 in human lung adenocarcinoma. (B) Co-occurrence of STAG3 ‘mRNA high expression’ and MGA alterations in TCGA lung adenocarcinoma data. (C)…
Figure 8 with 1 supplement
MGA has tumor suppressive functions in colorectal cancer.
(A) GENIE and TCGA consortium data depicting alterations at the MGA locus in colorectal cancer. (B) Western blot for MGA, L3MBTL2, and MAX in Empty and sgMGA normal colon organoids. (C) …
-
Figure 8—source data 1
MGA has tumor suppressive functions in colorectal cancer.
Source data related to Figure 8D,F,G, and H.
- https://cdn.elifesciences.org/articles/64212/elife-64212-fig8-data1-v1.xlsx
Figure 8—figure supplement 1
MGA has tumor suppressive functions in colon cancer.
(A) Immunofluorescent staining for MGA in 2D organoid cultures. (B) Sequencing to show indel formation in clonal sgMGA (#1 and #2) organoids compared to Empty vector transduced controls. (C) Growth …
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus, male, female) | Kras | The Jackson Laboratory | RRID:IMSR_JAX:008179 | KrasLSL- G12D/WT |
| Strain, strain background (M. musculus, male, female) | KP (Kras p53) | The Jackson Laboratory | RRID:IMSR_JAX:008462 | KrasLSL-G12D/WT Trp53Flox/Flox K and P interbred at Fred Hutch |
| Cell line (human) | A549 | ATCC | CCL-185 RRID:CVCL_0023 | Lung epithelial |
| Cell line (human) | NCI-H23 | ATCC | CRL-5800 RRID:CVCL_1547 | Lung adeno- carcinoma, epithelial |
| Cell line (human) | NCI-H2291 | ATCC | CRL-5939 RRID:CVCL_1546 | Lung adeno- carcinoma, epithelial |
| Cell line (human) | LOU-NH-91 | Kind gift from Montse Sanchez- Cespedes | RRID:CVCL_2104 | Lung squamous cell carcinoma |
| Cell line (human) | 91T | Kind gift From McGarry Houghton | Reference: Stabile et al. 2002 | Non-small cell lung cancer |
| Cell line (human) | NCI-H1975 | ATCC | CRL-5908 RRID:CVCL_1511 | Lung adeno- carcinoma, epithelial |
| Cell line (human) | DLD-1 | ATCC | CCL-221 RRID:CVCL_0248 | Colorectal adeno- carcinoma, epithelial |
| Recombinant DNA reagent (human) | pcDNA3-FLAG- His-MGA | Yuzuru Shiio | Plasmid to express full length MGA isoform2 Available from the Eisenman Lab | |
| Recombinant DNA reagent (human) | pCDH-FLAG-His- MGA | This paper | Lentiviral construct to express full-length MGA Available from the Eisenman Lab | |
| Recombinant DNA reagent (human) | pCDH-FLAG-His- MGAΔDUF | This paper | Lentiviral construct to express MGA lacking the aa1003- 1304 Available from the Eisenman Lab | |
| Recombinant DNA reagent (M. musculus) | LentiCRISPRv2Cre | Addgene (Gift from Feldser lab) | ||
| Recombinant DNA reagent (M. musculus) | LentiCRISPRv2Cre sgMga1 | This paper | Insert (sgMga1 gRNA sequence): TAAGTGGAATGGTCGTTGGT | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (M. musculus) | LentiCRISPRv2Cre sgMga3 | This paper | Insert (sgMga3 gRNA sequence): TCAGAATTTTCAATATACGC | Lentiviral vector to express sgRNA Available from Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 PURO | Addgene (Gift from Feng Zhang) | Lentiviral vector to express sgRNA | |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgMGA | This paper | Insert (sgMGA gRNA sequence): CTATGCATCGTTACCTGC CG | Lentiviral vector to express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgPCGF6 | This paper | Insert (sgPCGF6 gRNA sequence): GGTATGAAGACATTCTGTGA | Lentiviral vector to express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgL3MBTL2.1 | This paper | Insert (sgL3MBTL2.1 gRNA sequence): CCGGAGTTATAACAGCAGTG | Lentiviral vector sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (Mus musculus) | LentiCRISPRv2sgL3mbtl2 | This Paper | Insert (sgL3mbtl2 gRNA sequence): CCGGAGTTACAACAGCAGTG | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (Mus musculus) | LentiCRISPRv2sgPcgf6 | This Paper | Insert (sgPcgf6 gRNA sequence): GGTATGAAGACACTCTGTAA | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (Mus musculus) | LentiCRISPRv2sgMyc | This Paper | Insert (sgMyc gRNA sequence): TGTCCCCGAGCCGCCGCTC | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgL3MBTL2.1 | This paper | Insert (sgL3MBTL2.2 gRNA sequence): TTCACTTGACTCCTCCAGAT | Lentiviral vector to express sgRNA |
| Recombinant DNA reagent (human) | pLKO non-silence | SIGMA Mission shRNA | Lentiviral vector to express shRNA | |
| Recombinant DNA reagent (human) | pLKO shMGA | SIGMA Mission shRNA | TRCN0000237941 (ID RNAi consortium) | Lentiviral vector to express shRNA |
| Antibody | MGA (rabbit, polyclonal) | Novus Biological | Catalog no. NBP1-94031 | WB (1:500 in 3%BSA), IF (acetone fixation and 1:100) |
| Antibody | MGA (mouse, monoclonal) | Developed at Fred Hutch | WB (1:500 in 5% milk) | |
| Antibody | MGA (rabbit, polyclonal) | Kind gift from Suske Lab (Univ. Marburg) | ChIP, CUT, and RUN (1:100) | |
| Antibody | Ki67 (rabbit, polyclonal) | Abcam | Catalog no. ab16667 | IF and IHC (1:200) |
| Antibody | MECA32 (mouse, monoclonal) | DSHB | Catalog no. MECA-32-S | IHC (1:100) |
| Antibody | MYC (rabbit, polyclonal) | Cell Signaling | Catalog no. 13987S | ChIP, CUT and RUN (1:200) |
| Antibody | MAX (rabbit, polyclonal) | Proteintech | Catalog no. 10426–1-AP | WB (1:1000), ChIP, CUT and RUN |
| Antibody | L3MBTL2 (rabbit, polyclonal) | Active Motif | Catalog no. 39569 | WB (1:1000), ChIP, CUT and RUN |
| Antibody | RNA polymerase II (all phosphoisomers) | Active Motif | Catalog no. 39097 | ChIP (1:100) |
| Antibody | E2F6 (rabbit, polyclonal) | Abcam | Catalog no. ab53061 | WB (1:1000), ChIP |
| Antibody | PCGF6 (rabbit, polyclonal) | Proteintech | Catalog no. 24103–1-AP | WB (1:1000) |
| Antibody | Rabbit IgG | Cell Signaling | Catalog no. 2729 | ChIP |
| Antibody | GFP (rabbit, monoclonal) | Cell Signaling | Catalog no. 2956S | CUT and RUN |
| Sequence-based reagent (human) | siSTAG3 | Qiagen | siRNA (Catalog no. SI00734440) | |
| Sequence-based reagent (human) | siPODXL2 | Qiagen | siRNA (Catalog no. SI04142495) | |
| Sequence-based reagent (human) | siMYC | Qiagen | siRNA (Catalog no./ID: 1027416) | FlexiTube GeneSolution GS4609 for MYC(human) |
| Sequence-based reagent (human) | siDeath | Qiagen | siRNA (Catalog no./ID: 1027299) | ALLSTARS HS Cell Death siRNA |
| Sequence-based reagent (human) | siCtrl/siCTRL | Qiagen | siRNA (Catalog no./ID: 1027281) | ALLSTARS Negative Control siRNA |
| Software | Biorender | Biorender.com | Used for illustrations |
Additional files
-
Supplementary file 1
RNA-Seq , ChIP-Seq and Cut & Run data used in this study.
(a) Kras tumor RNA-Seq data. (b) KP cell line RNA-Seq data. (c) KP cell line ChIP-Seq called peaks. (d) A549 CUT and RUN peaks called. (e) Human colon organoid RNA-Seq data.
- https://cdn.elifesciences.org/articles/64212/elife-64212-supp1-v1.xlsx
-
Supplementary file 2
Real-time mouse and human PCR primer sequences used in this study.
(a) Real-time mouse primers used in the study. (b) Real-time human primers used in this study.
- https://cdn.elifesciences.org/articles/64212/elife-64212-supp2-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64212/elife-64212-transrepform-v1.docx
