1. Microbiology and Infectious Disease
Download icon

Microbiota functional activity biosensors for characterizing nutrient metabolism in vivo

  1. Darryl A Wesener
  2. Zachary W Beller
  3. Samantha L Peters
  4. Amir Rajabi
  5. Gianluca Dimartino
  6. Richard J Giannone
  7. Robert L Hettich
  8. Jeffrey I Gordon  Is a corresponding author
  1. Edison Family Center for Genome Sciences and Systems Biology, Washington University School of Medicine, United States
  2. Center for Gut Microbiome and Nutrition Research, Washington University School of Medicine, United States
  3. Chemical Sciences Division, Oak Ridge National Laboratory, United States
  4. Mondelez International, United States
Research Article
Cite this article as: eLife 2021;10:e64478 doi: 10.7554/eLife.64478
5 figures, 1 table and 6 additional files

Figures

Isolation of an arabinose-rich fraction from pea fiber.

(A) Mole fraction of neutral monosaccharides from PFABN and SBABN. Mean values ± s.d. from triplicate technical measurements are shown. (B) Proposed structure of arabinan isolated from pea fiber and sugar beet as determined by glycosyl-linkage analysis. The colored arabinose monosaccharides highlight the different glycosyl branching patterns found in arabinan isolated from the two sources. (C) Growth curves of four Bacteroides strains cultured in minimal medium containing either glucose or arabinan as the sole carbon source. Data from samples where no exogenous carbon source was added are subtracted from all curves. Solid lines represent the mean and shaded area the s.e.m. of quadruplicate cultures (data shown are representative of 3 independent experiments). (See also Supplementary file 1).

Figure 2 with 1 supplement
Assessing the biological activity of PFABN in gnotobiotic mice colonized with a defined consortium of human gut bacterial strains.

(A) Experimental design. Germ-free mice were fed the unsupplemented HiSF-LoFV diet for 5 days then colonized with the indicated group of 14 bacterial strains (the five Bacteroides strains represented in the form of Tn mutant libraries are highlighted in boldface). Two days after gavage of the consortium different groups of animals were switched to a HiSF-LoFV diet supplemented with raw pea fiber, PFABN or SBABN and fed that diet monotonously for 10 days (average dose of supplement consumed/per day is shown). Control animals were maintained on the unsupplemented HiSF-LoFV diet. (B) Absolute abundances of supplement-responsive bacterial strains, plus the total bacterial load of all 14 strains in fecal samples obtained at the indicated time points (each dot represents a single animal; bar height represents the mean; error bars represent s.d.). *p<0.01 for comparisons denoted by horizontal lines (generalized linear mixed-effects model [Gaussian]; two-way ANOVA with Tukey’s HSD, FDR corrected; the data shown are from Experiment two in Supplementary file 2 and are representative of two independent biological experiments). (C) Specific activity of each diet supplement on the summed total absolute abundances of the four diet-responsive Bacteroides. Open circles represent mean values and error bars the s.e.m. of two independent biological experiments (n = 10–11 mice/treatment arm). *p<0.01 for comparisons defined by the horizontal lines (generalized linear mixed-effects model [Gaussian]; two-way ANOVA with Tukey’s HSD, FDR corrected). (See also Supplementary files 24).

Figure 2—source data 1

Identifying PULs that function as key fitness determinants in the different diet contexts.

Plots represent of the log2 fitness score versus log2 fold change in protein abundance for all genes from a given organism: (A) B. thetaiotaomicron VPI-5482, (B) B. vulgatus ATCC 8482, (C) B. ovatus ATCC 8483, and (D) B. cellulosilyticus WH2, under the specified diet condition. Genes from the specified PUL are highlighted in blue. The overrepresentation of genes positioned in the right lower quadrants of the plots (i.e., those showing high expression and low fitness when they are disrupted by a transposon), was defined with a chi-square test using all other genes with both proteomic and INSeq data as the null. The central shaded region represents an ellipse of the inter-quartile range of both the fitness score and protein abundance for that organism under the specified diet condition. This region was excluded from the chi-square calculation of a PUL being overrepresented in the lower right quadrant to increase the stringency of the test. Presented p-values are FDR corrected.

https://cdn.elifesciences.org/articles/64478/elife-64478-fig2-data1-v1.pdf
Figure 2—figure supplement 1
The effects of supplementing the HiSF-LoFV diet with unfractionated pea fiber, PFABN, or SBABN on PUL gene expression.

(A) Heat map of the average log2 fold change in abundance of proteins within PULs identified as supplement-responsive using GSEA. *p<0.05 (unpaired one-sample Z-test, FDR corrected) compared to PUL protein abundance when mice were fed the base HiSF-LoFV diet. (B) Organization of supplement-responsive PULs. GH family annotations are included within the colored arrow and are based on PULDB (http://www.cazy.org/PULDB/) accessed on December 6, 2019. Genes denoting the beginning and end of each PUL are noted with their locus tags above the left and right boundaries of the PUL. Dashed lines represent the continuation of a single PUL. PUL annotations and boundaries are identical to those described in Patnode et al., 2019.

Figure 3 with 3 supplements
Generating microscopic paramagnetic glass beads with covalently attached fluorophores and glycans.

(A,B) Steps used for producing MFABs. The transferred cyano-group from 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP), and its modification during ligand immobilization are highlighted in red (panel b). Arabinose oligosaccharide is shown as a representative ligand for immobilization. Amine and phosphonate functional groups are denoted by ‘+’ and ‘–’ symbols, respectively. See Figure 3—figure supplement 2 for a more complete depiction of the chemical linkages represented on the surface of an MFAB with bound arabinan. (C) Arabinose released during acid hydrolysis from amine plus phosphonate beads with and without surface amine groups acetylated. Beads were coated with SBABN that had been activated using increasing mass ratios of CDAP. Each point represents a single technical measurement (n = 4). Bar height represents the mean value.

Figure 3—figure supplement 1
Characterizing the modified surface chemistry of paramagnetic glass beads.

(A) Alteration in bead surface zeta potential after modification with organosilanes, with and without amine acetylation. Each point represents the average of at least 12 technical replicate measurements. (B) Quantification of reactive surface amine functional groups on amine plus phosphonate beads with and without surface amine acetylation. Octylamine was used to generate a standard curve. Each bead type was analyzed in triplicate. Each point represents a single technical measurement. (C) Fluorophore immobilization on the surface of beads after modification with organosilanes, with and without amine acetylation. The height of each bar represents the geometric mean of values obtained from greater than 1000 beads. The concentration of NHS ester-activated fluorophore was 0.1 μM. Results are representative of three independent experiments. (D) Level of fluorophore immobilized on an amine plus phosphonate bead after reaction with increasing concentrations of NHS ester-activated fluorophore, with and without bead surface amine acetylation. The height of each bar represents the geometric mean of values obtained from greater than 1000 beads. Results are representative of those obtained in three independent experiments.

Figure 3—figure supplement 2
Schematic of a fluorescent arabinan-coated MFAB.

Amine and phosphonate functional groups are covalently attached to the surface of a paramagnetic silica bead via organosilane reagents. Polysaccharide is depicted attached to the bead surface via (1) reductive amination, (2) the product of isourea reduction (an aminal-like linkage), or (3) an isourea bond. An Alexa Fluor 488 (mixed isomer) fluorophore is attached to the bead surface via an amide bond. The product of cyanate-ester hydrolysis, a carbamate, is shown. The carbon and nitrogen atoms from the transferred cyano-group are shown in red.

Figure 3—figure supplement 3
Conjugation reaction conditions influence immobilization of polysaccharides on the surfaces of the paramagnetic glass beads.

(A) SBABN subjected to CDAP-based bead immobilization across a range of pH values. Immobilized arabinose was quantified using GC–MS. (B) SBABN immobilization in the presence of a HEPES or MOPS-based buffer at an identical pH. Monosaccharides were quantified using GC–MS. (C) Maltodextrin oligosaccharide immobilization after CDAP activation. In (A–C), each data point represents a single technical measurement while bar heights depict the mean values and error bars the s.d.

Figure 4 with 3 supplements
Quantifying microbial degradation of PFABN- and SBABN-coated beads in colonized gnotobiotic mice fed unsupplemented or supplemented HiSF-LoFV diets.

(A) Monosaccharide composition of beads containing covalently bound PFABN or SBABN. Control beads were subjected to surface amine acetylation. The amount of monosaccharide released after acid hydrolysis was quantified by GC-MS. Each point represents a single measurement. Bar height denotes the mean while error bars represent the s.d. (n = 6 biological replicates). (B,C) Percentage of arabinose, galactose and xylose remaining on the surface of beads recovered from the cecums of mice fed the indicated diets (n = 5 mice/treatment group). Each point represents a single animal. Bar height denotes the mean while error bars represent the s.d. p<0.05 (Mann–Whitney U test compared to the group furthest to the left). (See also Supplementary file 5).

Figure 4—figure supplement 1
Enzyme degradation of PFABN immobilized on an MFAB surface using CDAP chemistry.

(A,B) Soluble glycosyl hydrolases (named and abbreviated as A, B, and C) were added to PFABN-coated MFABs and the fraction of arabinan remaining on the bead surface after 30 min and 20 hr was quantified (by GC–MS). Data are expressed relative to the input preparation of beads that were not exposed to the indicated enzyme alone or to a combination of two or three of the enzymes. Each point represents a single technical measurement (n = 2or three for beads exposed to a single or multiple enzymes). Mean values ± s.d. are plotted. (Note that the modest difference in the amount of bound arabinan remaining on PFABN beads after a 30 min versus a 20 hr incubation with just the commercially available arabinoxylan arabinofuranosidase preparation [enzyme C] is consistent with the fact that it has modest activity against other arabinan polysaccharides.)

Figure 4—figure supplement 2
Degradation of MFAB-bound PFABN by B. thetaiotaomicron VPI-5482 and B. cellulosilyticus WH2 in vitro.

(A,B) Input beads (A) were incubated with B. thetaiotaomicron VPI-5482 that had been grown in BMM medium to mid-log phase with glucose as the carbon source. Cells were harvested and resuspended in BMM with or without different concentrations of supplemented destarched PFABN. PFABN-MFABs were added and the mixture was incubated at 37°C: aliquots of the reaction mixture were withdrawn at the time points shown (B). (C–E) Input beads (C) were incubated with B. cellulosilyticus WH2 that had been grown to mid-log phase in BMM containing glucose (D) or PFABN (E) as the carbon sources. Cells were harvested and resuspended in BMM with or without different concentrations of destarched PFABN. MFABs were harvested at the indicated time points and the percentage of arabinose remaining on the bead was calculated from the mean absolute mass of arabinose on the input preparation of MFABs used in that experiment. Each point in (A) – (E) represents a single technical measurement (n = 6 or eight for input beads; 3 or 4 for beads exposed to the Bacteroides strains). Mean values ± s.d. are plotted. The green ‘X’ denotes the mean number (triplicate technical measurements) of colony forming units (CFU) in the incubation mixture at time of bead harvest (see right y-axis).

Figure 4—figure supplement 3
Assaying whether bead-linked polysaccharides are degraded in germ-free mice.

Absolute mass of monosaccharide released from three bead types prior to or after gavage, collection, and purification from germ-free (GF) mice fed the HiSF-LoFV diet supplemented with PFABN. Beads were collected from the cecum 4 hr after gavage. Each point represents a single biological replicate (n = 6 for input beads, four for germ-free animals). Bar height represents the mean while error bars denote the s.d. *p<0.05, Mann–Whitney U test.

Colocalization of PFABN and glucomannan on the same bead results in augmented degradation of glucomannan in gnotobiotic mice colonized with the defined consortium and fed the pea fiber supplemented HiSF-LoFV diet.

(A) In vitro growth of supplement-responsive Bacteroides species in minimal medium containing glucose or glucomannan as the sole carbon source. Data from samples where no exogenous carbon source was added are subtracted from all curves. The line represents the mean and shaded regions the s.e.m. of quadruplicate measurements. (B) Monosaccharide compositions of beads with covalently bound PFABN, glucomannan, or both PFABN and glucomannan. Control beads were subjected to surface amine acetylation. The amount of monosaccharide released after acid hydrolysis was quantified by GC-MS. Each point represents a single measurement. Bar height represents the mean and error bars the s.d. (n = 6 biological replicates). (C) Beads containing PFABN alone, glucomannan alone, or both glycans, as well as ‘empty’ acetylated control beads, each containing a unique fluorophore, were simultaneously introduced by oral gavage into gnotobiotic mice, recovered 4 hr later from their cecums. Each bead-type is subsequently purified by FACS. A representative flow cytometry plot of beads isolated from the cecum is shown. (D) Monosaccharide remaining on beads coated with PFABN alone, glucomannan alone, or both glycans after collection and purification from the cecums of mice fed the unsupplemented or pea fiber-supplemented HiSF-LoFV diet. Colors are identical to those used in panel b. The amount of remaining monosaccharide is expressed relative to the absolute mass of monosaccharide immobilized on the surface of each type of input bead. Each point represents a single animal. Bar height represents the mean and error bars the s.d. (n = 5–8 biological replicates). *p<0.05 (Mann–Whitney U test). (See also Supplementary file 5).

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Bacteroides cellulosilyticus)INSeq library (B. cellulosilyticus WH2)Wu et al., 2015
Strain, strain background (Bacteroides ovatus)INSeq library (B. ovatus ATCC 8483)Wu et al., 2015
Strain, strain background (Bacteroides thetaiotaomicron)INSeq library (B. thetaiotaomicron 7330)Wu et al., 2015
Strain, strain background (Bacteroides thetaiotaomicron)INSeq library (B. thetaiotaomicron VPI-5482)Wu et al., 2015
Strain, strain background (Bacteroides vulgatus)INSeq library (B. vulgatus ATCC 8482)Hibberd et al., 2017
Strain, strain background (Bacteroides cellulosilyticus)B. cellulosilyticus WH2McNulty et al., 2013
Strain, strain background (Bacteroides ovatus)B. ovatus ATCC 8483ATCCCat. No. ATCC 8483
Strain, strain background (Bacteroides thetaiotaomicron)B. thetaiotaomicron 7330Hibberd et al., 2017
Strain, strain background (Bacteroides thetaiotaomicron)B. thetaiotaomicron VPI-5482ATCCCat. No. ATCC 29148
Strain, strain background (Bacteroides vulgatus)B. vulgatus ATCC 8482ATCCCat. No. ATCC 8482
Strain, strain background (Bacteroides caccae)B. caccae TSDC17.2–1.2Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Bacteroides finegoldii)B. finegoldii TSDC17.2–1.1Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Bacteroides massiliensis)B. massiliensis TSDC17.2–1.1Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Collinsella aerofaciens)C. aerofaciens TSDC17.2–1.1Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Escherichia coli)E. coli TSDC17.2–1.2Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Odoribacter splanchnicus)O. splanchnicus TSDC17.2–1.2Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Parabacteroides distasonis)P. distasonis TSDC17.2–1.1Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Ruminococcaceae sp.)Ruminococcaceae sp. TSDC17.2–1.2Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Subdoligranulum variabile)S. variabile TSDC17.2–1.1Ridaura et al., 2013Donor fecal sample F60T2
Strain, strain background (Alicyclobacillus acidiphilus)A. acidiphilus DSM 14558DSMZ; Stämmler et al., 2016Cat. No. 14558
Strain, strain background (Agrobacterium radiobacter)A. radiobacter DSM 30147DSMZ; Stämmler et al., 2016Cat. No. 30147
Strain, strain background (Mus musculus, male)C57BL/6J mice; rederived germ-freeThe Jackson LaboratoryCat. No. 00064
Sequence-based reagentM12 oligonucleotide, double strandedWu et al., 2015CTGTCCGTTCCGACTACCCTCCCGAC
Sequence-based reagentINSeq PCR primer; FWu et al., 2015CAAGCAGAAGACGGCATACG
Sequence-based reagentINSeq PCR primer; RWu et al., 2015AATGATACGGCGACCACCGAACACTCTTTCCCTACACGA
Sequence-based reagentINSeq Indexing primerWu et al., 2015ACAGGTTGGATGATAAGTCCCCGGTC
Peptide, recombinant proteinAmyloglucosidaseMegazymeCat. No. E-AMGFR
Peptide, recombinant proteinalpha-AmylaseMegazymeCat. No. E-PANAA
Peptide, recombinant proteinEndo-1,5-α-ArabinanaseMegazymeCat. No. E-EARAB
Peptide, recombinant proteinα-l-Arabinofuranosidase (Aspergillus niger)MegazymeCat. No. E-AFASE
Peptide, recombinant proteinα-l-Arabinofuranosidase (Cellvibrio japonicus)MegazymeCat. No. E-ABFCJ
Peptide, recombinant proteinEndo-InulinaseMegazymeCat. No. E-ENDOIAN
Peptide, recombinant proteinMmeI restriction endonucleaseNEBCat. No. R0637L
Peptide, recombinant proteinT4 DNA ligaseNEBCat. No. M0202M
Peptide, recombinant proteinSuperfi DNA polymeraseFisher ScientificCat. No. 12351050
Commercial assay or kitBicinchoninic acid protein assay kitThermo ScientificCat. No. 23225
Commercial assay or kitNextera DNA library prep kitIlluminaCat. No. 15028211
Commercial assay or kitQIAquick 96 PCR purification kitQiagenCat. No. 28181
Commercial assay or kitMinElute gel extraction kitQiagenCat. No. 28604
Commercial assay or kitQuant-iT dsDNA assay kit, high sensitivityThermo ScientificCat. No. Q33120
Commercial assay or kitCountBright absolute counting beadsThermo ScientificCat. No. C36950
Commercial assay or kitNinhydrin test kitAnaspecCat. No. AS-25241
Commercial assay or kitBiotin quantitation kitThermo ScientificCat. No. 28005
Software, algorithmR, version 3.5.2https://www.r-project.org/
Software, algorithmmetaMSWehrens et al., 2014
Software, algorithmCOPRO-Seq pipelineHibberd et al., 2017https://gitlab.com/hibberdm/COPRO-Seq
Software, algorithmINSeq pipelineWu et al., 2015https://github.com/mengwu1002/Multi-taxon_analysis_pipeline
Software, algorithmlme4Bates et al., 2015https://github.com/lme4/lme4/
Software, algorithmemmeanshttps://github.com/rvlenth/emmeans
Software, algorithmGAGELuo et al., 2009
Software, algorithmlimmaRitchie et al., 2015http://bioconductor.org/packages/release/bioc/html/limma.html
Software, algorithmFlowJo V10.5.3https://www.flowjo.com/
OtherTeklad Global 18% Protein Rodent dietEnvigoCat. No. 2018S
OtherHigh saturated fats low fruits and vegetables mouse chow (HiSF-LoFV)Ridaura et al., 2013
OtherPea fiberRattenmaierCat. No. Pea Fiber EF 100
OtherSugar beet arabinanMegazymeCat. No. P-ARAB
OtherGlucomannanMegazymeCat. No. P-GLCML
OtherMaltodextrin (DE 13–17)Sigma–AldrichCat No. 419680
OtherGut microbiota medium, for bacterial cultureGoodman et al., 2011
OtherBacteroides minimal medium, for bacterial cultureMcNulty et al., 2013
OtherPullulan length standardsShodexCat. No. Standard P-82
Other[1,2,3,4,5,6-2H]-Myo-inositolCDN IsotopesCat. No. D3019
OtherMSTFA (N-methyl-N-trimethylsilyltrifluoro)acetamide plus 1% TCMS (2,2,2-trifluoro-N-methyl-N-(trimethylsilyl)-acetamide, chlorotrimethylsilane)Thermo ScientificCat. No. TS-48915
OtherPureProteome NHS flexibind magnetic beadsMillipore SigmaCat. No. LSKMAGN01
Other(3-Aminopropyl)triethoxysilaneSigma–AldrichCat. No. 440140
Other3-(Trihydroxysilyl)propylmethylphosphonateSigma–AldrichCat. No. 435716
OtherAlexa Fluor 488 NHS esterThermo ScientificCat. No. A20000
OtherPromofluor 415 NHS esterPromoKineCat. No. PK-PF415-1-01
OtherPromofluor 633P NHS esterPromoKineCat. No. PK-PF633P-1–01
OtherPromofluor 510-LSS NHS esterPromoKineCat. No. PK-PF510LSS-1–01
Other1-Cyano-4-dimethylaminopyridinium tetrafluoroborateSigma–AldrichCat. No. RES1458C
Other2-Picoline boraneSigma–AldrichCat. No. 654213
OtherPureProteome streptavidin magnetic beadsMillipore SigmaCat. No. LSKMAGT02
OtherPercoll PlusGE HealthcareCat. No. 17544502

Additional files

Supplementary file 1

Characterization of fractions isolated from pea fiber.

(A) Initial procedure that yielded eight fractions during sequential extraction. (B) Glycosyl-linkage analysis of PFABN and SBABN. (C) Summary data of Bacteroides growth in defined minimal medium supplemented with glucose, PFABN, and SBABN.

https://cdn.elifesciences.org/articles/64478/elife-64478-supp1-v1.xlsx
Supplementary file 2

Effects of pea fiber, PFABN, and SBABN supplementation of the HiSF-LoFV diet on the absolute abundances of members of the defined community in gnotobiotic mice.

(A,B) COPRO-Seq results obtained from treatment groups described in Figure 2 (mean ± s.d.). (C) COPRO-Seq results obtained from treatment groups described in Figure 5 (mean ± s.d.).

https://cdn.elifesciences.org/articles/64478/elife-64478-supp2-v1.xlsx
Supplementary file 3

Metaproteomic analysis of the effects of pea fiber, PFABN, and SBABN supplementation of the HiSF-LoFV diet on gene expression in members of the defined community.

Cyclic loess normalized protein abundance Z-scores of (A) Bacteroides caccae TSDC17.2–1.2, (B) Bacteroides cellulosilyticus WH2, (C) Bacteroides finegoldii TSDC17.2–1.1, (D) Bacteroides massiliensis TSDC17.2–1.1, (E) Bacteroides ovatus ATCC8483, (F) Bacteroides thetaiotaomicron VPI-5482, (G) Bacteroides vulgatus ATCC8482, (H) Collinsella aerofaciens TSDC17.2–1.1, (I) Escherichia coli TSDC17.2–1.2, (J) Odoribacter splanchnicus TSDC17.2–1.2, (K) Parabacteroides distasonis TSDC17.2–1.1, (L) Ruminococcaceae sp TSDC17.2–1.2, (M) Subdoligranulum variabile TSDC17.2–1.1.

https://cdn.elifesciences.org/articles/64478/elife-64478-supp3-v1.xlsx
Supplementary file 4

INSeq analysis of fitness determinants in diet-responsive Bacteroides represented in the defined community as a function of pea fiber, PFABN and SBABN supplementation of the HiSF-LoFV diet.

Summary statistics from linear models of gene fitness during (A) pea fiber, (B) PFABN, and (C) SBABN supplementation in (1) Bacteroides cellulosilyticus WH2, (2) Bacteroides ovatus ATCC8483, (3) Bacteroides thetaiotaomicron VPI-5482, and (4) Bacteroides vulgatus ATCC8482.

https://cdn.elifesciences.org/articles/64478/elife-64478-supp4-v1.xlsx
Supplementary file 5

GC–MS analysis of the mass of monosaccharides bound to the surface of MFABs prior to and after their introduction into gnotobiotic mice (related to Figures 4 and 5).

(A,B) Results from experiments described in Figure 4. (C) Results from experiments depicted in Figure 5.

https://cdn.elifesciences.org/articles/64478/elife-64478-supp5-v1.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/64478/elife-64478-transrepform-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)