Microbiota functional activity biosensors for characterizing nutrient metabolism in vivo
- Edison Family Center for Genome Sciences and Systems Biology, Washington University School of Medicine, United States
- Center for Gut Microbiome and Nutrition Research, Washington University School of Medicine, United States
- Chemical Sciences Division, Oak Ridge National Laboratory, United States
- Mondelez International, United States
Figures
Figure 1
Isolation of an arabinose-rich fraction from pea fiber.
(A) Mole fraction of neutral monosaccharides from PFABN and SBABN. Mean values ± s.d. from triplicate technical measurements are shown. (B) Proposed structure of arabinan isolated from pea fiber and …
Figure 2 with 1 supplement
Assessing the biological activity of PFABN in gnotobiotic mice colonized with a defined consortium of human gut bacterial strains.
(A) Experimental design. Germ-free mice were fed the unsupplemented HiSF-LoFV diet for 5 days then colonized with the indicated group of 14 bacterial strains (the five Bacteroides strains …
-
Figure 2—source data 1
Identifying PULs that function as key fitness determinants in the different diet contexts.
Plots represent of the log2 fitness score versus log2 fold change in protein abundance for all genes from a given organism: (A) B. thetaiotaomicron VPI-5482, (B) B. vulgatus ATCC 8482, (C) B. ovatus ATCC 8483, and (D) B. cellulosilyticus WH2, under the specified diet condition. Genes from the specified PUL are highlighted in blue. The overrepresentation of genes positioned in the right lower quadrants of the plots (i.e., those showing high expression and low fitness when they are disrupted by a transposon), was defined with a chi-square test using all other genes with both proteomic and INSeq data as the null. The central shaded region represents an ellipse of the inter-quartile range of both the fitness score and protein abundance for that organism under the specified diet condition. This region was excluded from the chi-square calculation of a PUL being overrepresented in the lower right quadrant to increase the stringency of the test. Presented p-values are FDR corrected.
- https://cdn.elifesciences.org/articles/64478/elife-64478-fig2-data1-v1.pdf
Figure 2—figure supplement 1
The effects of supplementing the HiSF-LoFV diet with unfractionated pea fiber, PFABN, or SBABN on PUL gene expression.
(A) Heat map of the average log2 fold change in abundance of proteins within PULs identified as supplement-responsive using GSEA. *p<0.05 (unpaired one-sample Z-test, FDR corrected) compared to PUL …
Figure 3 with 3 supplements
Generating microscopic paramagnetic glass beads with covalently attached fluorophores and glycans.
(A,B) Steps used for producing MFABs. The transferred cyano-group from 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP), and its modification during ligand immobilization are highlighted …
Figure 3—figure supplement 1
Characterizing the modified surface chemistry of paramagnetic glass beads.
(A) Alteration in bead surface zeta potential after modification with organosilanes, with and without amine acetylation. Each point represents the average of at least 12 technical replicate …
Figure 3—figure supplement 2
Schematic of a fluorescent arabinan-coated MFAB.
Amine and phosphonate functional groups are covalently attached to the surface of a paramagnetic silica bead via organosilane reagents. Polysaccharide is depicted attached to the bead surface via …
Figure 3—figure supplement 3
Conjugation reaction conditions influence immobilization of polysaccharides on the surfaces of the paramagnetic glass beads.
(A) SBABN subjected to CDAP-based bead immobilization across a range of pH values. Immobilized arabinose was quantified using GC–MS. (B) SBABN immobilization in the presence of a HEPES or MOPS-based …
Figure 4 with 3 supplements
Quantifying microbial degradation of PFABN- and SBABN-coated beads in colonized gnotobiotic mice fed unsupplemented or supplemented HiSF-LoFV diets.
(A) Monosaccharide composition of beads containing covalently bound PFABN or SBABN. Control beads were subjected to surface amine acetylation. The amount of monosaccharide released after acid …
Figure 4—figure supplement 1
Enzyme degradation of PFABN immobilized on an MFAB surface using CDAP chemistry.
(A,B) Soluble glycosyl hydrolases (named and abbreviated as A, B, and C) were added to PFABN-coated MFABs and the fraction of arabinan remaining on the bead surface after 30 min and 20 hr was …
Figure 4—figure supplement 2
Degradation of MFAB-bound PFABN by B. thetaiotaomicron VPI-5482 and B. cellulosilyticus WH2 in vitro.
(A,B) Input beads (A) were incubated with B. thetaiotaomicron VPI-5482 that had been grown in BMM medium to mid-log phase with glucose as the carbon source. Cells were harvested and resuspended in …
Figure 4—figure supplement 3
Assaying whether bead-linked polysaccharides are degraded in germ-free mice.
Absolute mass of monosaccharide released from three bead types prior to or after gavage, collection, and purification from germ-free (GF) mice fed the HiSF-LoFV diet supplemented with PFABN. Beads …
Figure 5
Colocalization of PFABN and glucomannan on the same bead results in augmented degradation of glucomannan in gnotobiotic mice colonized with the defined consortium and fed the pea fiber supplemented HiSF-LoFV diet.
(A) In vitro growth of supplement-responsive Bacteroides species in minimal medium containing glucose or glucomannan as the sole carbon source. Data from samples where no exogenous carbon source was …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Bacteroides cellulosilyticus) | INSeq library (B. cellulosilyticus WH2) | Wu et al., 2015 | ||
| Strain, strain background (Bacteroides ovatus) | INSeq library (B. ovatus ATCC 8483) | Wu et al., 2015 | ||
| Strain, strain background (Bacteroides thetaiotaomicron) | INSeq library (B. thetaiotaomicron 7330) | Wu et al., 2015 | ||
| Strain, strain background (Bacteroides thetaiotaomicron) | INSeq library (B. thetaiotaomicron VPI-5482) | Wu et al., 2015 | ||
| Strain, strain background (Bacteroides vulgatus) | INSeq library (B. vulgatus ATCC 8482) | Hibberd et al., 2017 | ||
| Strain, strain background (Bacteroides cellulosilyticus) | B. cellulosilyticus WH2 | McNulty et al., 2013 | ||
| Strain, strain background (Bacteroides ovatus) | B. ovatus ATCC 8483 | ATCC | Cat. No. ATCC 8483 | |
| Strain, strain background (Bacteroides thetaiotaomicron) | B. thetaiotaomicron 7330 | Hibberd et al., 2017 | ||
| Strain, strain background (Bacteroides thetaiotaomicron) | B. thetaiotaomicron VPI-5482 | ATCC | Cat. No. ATCC 29148 | |
| Strain, strain background (Bacteroides vulgatus) | B. vulgatus ATCC 8482 | ATCC | Cat. No. ATCC 8482 | |
| Strain, strain background (Bacteroides caccae) | B. caccae TSDC17.2–1.2 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Bacteroides finegoldii) | B. finegoldii TSDC17.2–1.1 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Bacteroides massiliensis) | B. massiliensis TSDC17.2–1.1 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Collinsella aerofaciens) | C. aerofaciens TSDC17.2–1.1 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Escherichia coli) | E. coli TSDC17.2–1.2 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Odoribacter splanchnicus) | O. splanchnicus TSDC17.2–1.2 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Parabacteroides distasonis) | P. distasonis TSDC17.2–1.1 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Ruminococcaceae sp.) | Ruminococcaceae sp. TSDC17.2–1.2 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Subdoligranulum variabile) | S. variabile TSDC17.2–1.1 | Ridaura et al., 2013 | Donor fecal sample F60T2 | |
| Strain, strain background (Alicyclobacillus acidiphilus) | A. acidiphilus DSM 14558 | DSMZ; Stämmler et al., 2016 | Cat. No. 14558 | |
| Strain, strain background (Agrobacterium radiobacter) | A. radiobacter DSM 30147 | DSMZ; Stämmler et al., 2016 | Cat. No. 30147 | |
| Strain, strain background (Mus musculus, male) | C57BL/6J mice; rederived germ-free | The Jackson Laboratory | Cat. No. 00064 | |
| Sequence-based reagent | M12 oligonucleotide, double stranded | Wu et al., 2015 | CTGTCCGTTCCGACTACCCTCCCGAC | |
| Sequence-based reagent | INSeq PCR primer; F | Wu et al., 2015 | CAAGCAGAAGACGGCATACG | |
| Sequence-based reagent | INSeq PCR primer; R | Wu et al., 2015 | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGA | |
| Sequence-based reagent | INSeq Indexing primer | Wu et al., 2015 | ACAGGTTGGATGATAAGTCCCCGGTC | |
| Peptide, recombinant protein | Amyloglucosidase | Megazyme | Cat. No. E-AMGFR | |
| Peptide, recombinant protein | alpha-Amylase | Megazyme | Cat. No. E-PANAA | |
| Peptide, recombinant protein | Endo-1,5-α-Arabinanase | Megazyme | Cat. No. E-EARAB | |
| Peptide, recombinant protein | α-l-Arabinofuranosidase (Aspergillus niger) | Megazyme | Cat. No. E-AFASE | |
| Peptide, recombinant protein | α-l-Arabinofuranosidase (Cellvibrio japonicus) | Megazyme | Cat. No. E-ABFCJ | |
| Peptide, recombinant protein | Endo-Inulinase | Megazyme | Cat. No. E-ENDOIAN | |
| Peptide, recombinant protein | MmeI restriction endonuclease | NEB | Cat. No. R0637L | |
| Peptide, recombinant protein | T4 DNA ligase | NEB | Cat. No. M0202M | |
| Peptide, recombinant protein | Superfi DNA polymerase | Fisher Scientific | Cat. No. 12351050 | |
| Commercial assay or kit | Bicinchoninic acid protein assay kit | Thermo Scientific | Cat. No. 23225 | |
| Commercial assay or kit | Nextera DNA library prep kit | Illumina | Cat. No. 15028211 | |
| Commercial assay or kit | QIAquick 96 PCR purification kit | Qiagen | Cat. No. 28181 | |
| Commercial assay or kit | MinElute gel extraction kit | Qiagen | Cat. No. 28604 | |
| Commercial assay or kit | Quant-iT dsDNA assay kit, high sensitivity | Thermo Scientific | Cat. No. Q33120 | |
| Commercial assay or kit | CountBright absolute counting beads | Thermo Scientific | Cat. No. C36950 | |
| Commercial assay or kit | Ninhydrin test kit | Anaspec | Cat. No. AS-25241 | |
| Commercial assay or kit | Biotin quantitation kit | Thermo Scientific | Cat. No. 28005 | |
| Software, algorithm | R, version 3.5.2 | https://www.r-project.org/ | ||
| Software, algorithm | metaMS | Wehrens et al., 2014 | ||
| Software, algorithm | COPRO-Seq pipeline | Hibberd et al., 2017 | https://gitlab.com/hibberdm/COPRO-Seq | |
| Software, algorithm | INSeq pipeline | Wu et al., 2015 | https://github.com/mengwu1002/Multi-taxon_analysis_pipeline | |
| Software, algorithm | lme4 | Bates et al., 2015 | https://github.com/lme4/lme4/ | |
| Software, algorithm | emmeans | https://github.com/rvlenth/emmeans | ||
| Software, algorithm | GAGE | Luo et al., 2009 | ||
| Software, algorithm | limma | Ritchie et al., 2015 | http://bioconductor.org/packages/release/bioc/html/limma.html | |
| Software, algorithm | FlowJo V10.5.3 | https://www.flowjo.com/ | ||
| Other | Teklad Global 18% Protein Rodent diet | Envigo | Cat. No. 2018S | |
| Other | High saturated fats low fruits and vegetables mouse chow (HiSF-LoFV) | Ridaura et al., 2013 | ||
| Other | Pea fiber | Rattenmaier | Cat. No. Pea Fiber EF 100 | |
| Other | Sugar beet arabinan | Megazyme | Cat. No. P-ARAB | |
| Other | Glucomannan | Megazyme | Cat. No. P-GLCML | |
| Other | Maltodextrin (DE 13–17) | Sigma–Aldrich | Cat No. 419680 | |
| Other | Gut microbiota medium, for bacterial culture | Goodman et al., 2011 | ||
| Other | Bacteroides minimal medium, for bacterial culture | McNulty et al., 2013 | ||
| Other | Pullulan length standards | Shodex | Cat. No. Standard P-82 | |
| Other | [1,2,3,4,5,6-2H]-Myo-inositol | CDN Isotopes | Cat. No. D3019 | |
| Other | MSTFA (N-methyl-N-trimethylsilyltrifluoro)acetamide plus 1% TCMS (2,2,2-trifluoro-N-methyl-N-(trimethylsilyl)-acetamide, chlorotrimethylsilane) | Thermo Scientific | Cat. No. TS-48915 | |
| Other | PureProteome NHS flexibind magnetic beads | Millipore Sigma | Cat. No. LSKMAGN01 | |
| Other | (3-Aminopropyl)triethoxysilane | Sigma–Aldrich | Cat. No. 440140 | |
| Other | 3-(Trihydroxysilyl)propylmethylphosphonate | Sigma–Aldrich | Cat. No. 435716 | |
| Other | Alexa Fluor 488 NHS ester | Thermo Scientific | Cat. No. A20000 | |
| Other | Promofluor 415 NHS ester | PromoKine | Cat. No. PK-PF415-1-01 | |
| Other | Promofluor 633P NHS ester | PromoKine | Cat. No. PK-PF633P-1–01 | |
| Other | Promofluor 510-LSS NHS ester | PromoKine | Cat. No. PK-PF510LSS-1–01 | |
| Other | 1-Cyano-4-dimethylaminopyridinium tetrafluoroborate | Sigma–Aldrich | Cat. No. RES1458C | |
| Other | 2-Picoline borane | Sigma–Aldrich | Cat. No. 654213 | |
| Other | PureProteome streptavidin magnetic beads | Millipore Sigma | Cat. No. LSKMAGT02 | |
| Other | Percoll Plus | GE Healthcare | Cat. No. 17544502 |
Additional files
-
Supplementary file 1
Characterization of fractions isolated from pea fiber.
(A) Initial procedure that yielded eight fractions during sequential extraction. (B) Glycosyl-linkage analysis of PFABN and SBABN. (C) Summary data of Bacteroides growth in defined minimal medium supplemented with glucose, PFABN, and SBABN.
- https://cdn.elifesciences.org/articles/64478/elife-64478-supp1-v1.xlsx
-
Supplementary file 2
Effects of pea fiber, PFABN, and SBABN supplementation of the HiSF-LoFV diet on the absolute abundances of members of the defined community in gnotobiotic mice.
- https://cdn.elifesciences.org/articles/64478/elife-64478-supp2-v1.xlsx
-
Supplementary file 3
Metaproteomic analysis of the effects of pea fiber, PFABN, and SBABN supplementation of the HiSF-LoFV diet on gene expression in members of the defined community.
Cyclic loess normalized protein abundance Z-scores of (A) Bacteroides caccae TSDC17.2–1.2, (B) Bacteroides cellulosilyticus WH2, (C) Bacteroides finegoldii TSDC17.2–1.1, (D) Bacteroides massiliensis TSDC17.2–1.1, (E) Bacteroides ovatus ATCC8483, (F) Bacteroides thetaiotaomicron VPI-5482, (G) Bacteroides vulgatus ATCC8482, (H) Collinsella aerofaciens TSDC17.2–1.1, (I) Escherichia coli TSDC17.2–1.2, (J) Odoribacter splanchnicus TSDC17.2–1.2, (K) Parabacteroides distasonis TSDC17.2–1.1, (L) Ruminococcaceae sp TSDC17.2–1.2, (M) Subdoligranulum variabile TSDC17.2–1.1.
- https://cdn.elifesciences.org/articles/64478/elife-64478-supp3-v1.xlsx
-
Supplementary file 4
INSeq analysis of fitness determinants in diet-responsive Bacteroides represented in the defined community as a function of pea fiber, PFABN and SBABN supplementation of the HiSF-LoFV diet.
Summary statistics from linear models of gene fitness during (A) pea fiber, (B) PFABN, and (C) SBABN supplementation in (1) Bacteroides cellulosilyticus WH2, (2) Bacteroides ovatus ATCC8483, (3) Bacteroides thetaiotaomicron VPI-5482, and (4) Bacteroides vulgatus ATCC8482.
- https://cdn.elifesciences.org/articles/64478/elife-64478-supp4-v1.xlsx
-
Supplementary file 5
GC–MS analysis of the mass of monosaccharides bound to the surface of MFABs prior to and after their introduction into gnotobiotic mice (related to Figures 4 and 5).
- https://cdn.elifesciences.org/articles/64478/elife-64478-supp5-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64478/elife-64478-transrepform-v1.docx
