Strain, strain background (Bacteroides cellulosilyticus) | INSeq library (B. cellulosilyticus WH2) | Wu et al., 2015 | | |
Strain, strain background (Bacteroides ovatus) | INSeq library (B. ovatus ATCC 8483) | Wu et al., 2015 | | |
Strain, strain background (Bacteroides thetaiotaomicron) | INSeq library (B. thetaiotaomicron 7330) | Wu et al., 2015 | | |
Strain, strain background (Bacteroides thetaiotaomicron) | INSeq library (B. thetaiotaomicron VPI-5482) | Wu et al., 2015 | | |
Strain, strain background (Bacteroides vulgatus) | INSeq library (B. vulgatus ATCC 8482) | Hibberd et al., 2017 | | |
Strain, strain background (Bacteroides cellulosilyticus) | B. cellulosilyticus WH2 | McNulty et al., 2013 | | |
Strain, strain background (Bacteroides ovatus) | B. ovatus ATCC 8483 | ATCC | Cat. No. ATCC 8483 | |
Strain, strain background (Bacteroides thetaiotaomicron) | B. thetaiotaomicron 7330 | Hibberd et al., 2017 | | |
Strain, strain background (Bacteroides thetaiotaomicron) | B. thetaiotaomicron VPI-5482 | ATCC | Cat. No. ATCC 29148 | |
Strain, strain background (Bacteroides vulgatus) | B. vulgatus ATCC 8482 | ATCC | Cat. No. ATCC 8482 | |
Strain, strain background (Bacteroides caccae) | B. caccae TSDC17.2–1.2 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Bacteroides finegoldii) | B. finegoldii TSDC17.2–1.1 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Bacteroides massiliensis) | B. massiliensis TSDC17.2–1.1 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Collinsella aerofaciens) | C. aerofaciens TSDC17.2–1.1 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Escherichia coli) | E. coli TSDC17.2–1.2 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Odoribacter splanchnicus) | O. splanchnicus TSDC17.2–1.2 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Parabacteroides distasonis) | P. distasonis TSDC17.2–1.1 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Ruminococcaceae sp.) | Ruminococcaceae sp. TSDC17.2–1.2 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Subdoligranulum variabile) | S. variabile TSDC17.2–1.1 | Ridaura et al., 2013 | | Donor fecal sample F60T2 |
Strain, strain background (Alicyclobacillus acidiphilus) | A. acidiphilus DSM 14558 | DSMZ; Stämmler et al., 2016 | Cat. No. 14558 | |
Strain, strain background (Agrobacterium radiobacter) | A. radiobacter DSM 30147 | DSMZ; Stämmler et al., 2016 | Cat. No. 30147 | |
Strain, strain background (Mus musculus, male) | C57BL/6J mice; rederived germ-free | The Jackson Laboratory | Cat. No. 00064 | |
Sequence-based reagent | M12 oligonucleotide, double stranded | Wu et al., 2015 | | CTGTCCGTTCCGACTACCCTCCCGAC |
Sequence-based reagent | INSeq PCR primer; F | Wu et al., 2015 | | CAAGCAGAAGACGGCATACG |
Sequence-based reagent | INSeq PCR primer; R | Wu et al., 2015 | | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGA |
Sequence-based reagent | INSeq Indexing primer | Wu et al., 2015 | | ACAGGTTGGATGATAAGTCCCCGGTC |
Peptide, recombinant protein | Amyloglucosidase | Megazyme | Cat. No. E-AMGFR | |
Peptide, recombinant protein | alpha-Amylase | Megazyme | Cat. No. E-PANAA | |
Peptide, recombinant protein | Endo-1,5-α-Arabinanase | Megazyme | Cat. No. E-EARAB | |
Peptide, recombinant protein | α-l-Arabinofuranosidase (Aspergillus niger) | Megazyme | Cat. No. E-AFASE | |
Peptide, recombinant protein | α-l-Arabinofuranosidase (Cellvibrio japonicus) | Megazyme | Cat. No. E-ABFCJ | |
Peptide, recombinant protein | Endo-Inulinase | Megazyme | Cat. No. E-ENDOIAN | |
Peptide, recombinant protein | MmeI restriction endonuclease | NEB | Cat. No. R0637L | |
Peptide, recombinant protein | T4 DNA ligase | NEB | Cat. No. M0202M | |
Peptide, recombinant protein | Superfi DNA polymerase | Fisher Scientific | Cat. No. 12351050 | |
Commercial assay or kit | Bicinchoninic acid protein assay kit | Thermo Scientific | Cat. No. 23225 | |
Commercial assay or kit | Nextera DNA library prep kit | Illumina | Cat. No. 15028211 | |
Commercial assay or kit | QIAquick 96 PCR purification kit | Qiagen | Cat. No. 28181 | |
Commercial assay or kit | MinElute gel extraction kit | Qiagen | Cat. No. 28604 | |
Commercial assay or kit | Quant-iT dsDNA assay kit, high sensitivity | Thermo Scientific | Cat. No. Q33120 | |
Commercial assay or kit | CountBright absolute counting beads | Thermo Scientific | Cat. No. C36950 | |
Commercial assay or kit | Ninhydrin test kit | Anaspec | Cat. No. AS-25241 | |
Commercial assay or kit | Biotin quantitation kit | Thermo Scientific | Cat. No. 28005 | |
Software, algorithm | R, version 3.5.2 | | https://www.r-project.org/ | |
Software, algorithm | metaMS | Wehrens et al., 2014 | | |
Software, algorithm | COPRO-Seq pipeline | Hibberd et al., 2017 | https://gitlab.com/hibberdm/COPRO-Seq | |
Software, algorithm | INSeq pipeline | Wu et al., 2015 | https://github.com/mengwu1002/Multi-taxon_analysis_pipeline | |
Software, algorithm | lme4 | Bates et al., 2015 | https://github.com/lme4/lme4/ | |
Software, algorithm | emmeans | | https://github.com/rvlenth/emmeans | |
Software, algorithm | GAGE | Luo et al., 2009 | | |
Software, algorithm | limma | Ritchie et al., 2015 | http://bioconductor.org/packages/release/bioc/html/limma.html | |
Software, algorithm | FlowJo V10.5.3 | | https://www.flowjo.com/ | |
Other | Teklad Global 18% Protein Rodent diet | Envigo | Cat. No. 2018S | |
Other | High saturated fats low fruits and vegetables mouse chow (HiSF-LoFV) | Ridaura et al., 2013 | | |
Other | Pea fiber | Rattenmaier | Cat. No. Pea Fiber EF 100 | |
Other | Sugar beet arabinan | Megazyme | Cat. No. P-ARAB | |
Other | Glucomannan | Megazyme | Cat. No. P-GLCML | |
Other | Maltodextrin (DE 13–17) | Sigma–Aldrich | Cat No. 419680 | |
Other | Gut microbiota medium, for bacterial culture | Goodman et al., 2011 | | |
Other | Bacteroides minimal medium, for bacterial culture | McNulty et al., 2013 | | |
Other | Pullulan length standards | Shodex | Cat. No. Standard P-82 | |
Other | [1,2,3,4,5,6-2H]-Myo-inositol | CDN Isotopes | Cat. No. D3019 | |
Other | MSTFA (N-methyl-N-trimethylsilyltrifluoro)acetamide plus 1% TCMS (2,2,2-trifluoro-N-methyl-N-(trimethylsilyl)-acetamide, chlorotrimethylsilane) | Thermo Scientific | Cat. No. TS-48915 | |
Other | PureProteome NHS flexibind magnetic beads | Millipore Sigma | Cat. No. LSKMAGN01 | |
Other | (3-Aminopropyl)triethoxysilane | Sigma–Aldrich | Cat. No. 440140 | |
Other | 3-(Trihydroxysilyl)propylmethylphosphonate | Sigma–Aldrich | Cat. No. 435716 | |
Other | Alexa Fluor 488 NHS ester | Thermo Scientific | Cat. No. A20000 | |
Other | Promofluor 415 NHS ester | PromoKine | Cat. No. PK-PF415-1-01 | |
Other | Promofluor 633P NHS ester | PromoKine | Cat. No. PK-PF633P-1–01 | |
Other | Promofluor 510-LSS NHS ester | PromoKine | Cat. No. PK-PF510LSS-1–01 | |
Other | 1-Cyano-4-dimethylaminopyridinium tetrafluoroborate | Sigma–Aldrich | Cat. No. RES1458C | |
Other | 2-Picoline borane | Sigma–Aldrich | Cat. No. 654213 | |
Other | PureProteome streptavidin magnetic beads | Millipore Sigma | Cat. No. LSKMAGT02 | |
Other | Percoll Plus | GE Healthcare | Cat. No. 17544502 | |