Adiponectin preserves metabolic fitness during aging
- Touchstone Diabetes Center, Department of Internal Medicine, The University of Texas Southwestern Medical Center, United States
- Department of Endocrinology and Metabolism, Tianjin Medical University General Hospital, China
- Department of Radiology, University of Texas Southwestern Medical Center, United States
- Department of Comparative Medicine and Immunobiology, Yale School of Medicine, United States
- Yale Center for Research on Aging, Yale School of Medicine, United States
- Department of Cell Biology, The University of Texas Southwestern Medical Center, United States
Figures
Figure 1 with 1 supplement
Lack of adiponectin (APN) in aging mice shortens lifespan.
(A) Kaplan–Meier survival curves for wild-type (WT) and adiponectin null (APN-KO) mice on chow diet. (B) Kaplan–Meier survival curves for WT and APN-KO mice on high-fat diet (HFD). (C) Median …
Figure 1—figure supplement 1
Mouse models used for longevity studies: adiponectin null (APN-KO) mice and adiponectin transgenic (ΔGly) mice.
(A) Experimental strategy for longevity experiments. (B) Diagram of the aging process. Lifespan and healthspan are always strongly coupled. (C) Circulating adiponectin levels measured in 50-week-old …
Figure 2 with 1 supplement
Lack of adiponectin (APN) in aging mice worsens glucose and lipid homeostasis.
(A) Body weights during aging processes for wild-type (WT) and adiponectin null (APN-KO) mice fed on chow diet. (B) Body weights during aging processes for WT and APN-KO mice fed on high-fat diet …
Figure 2—figure supplement 1
Body composition of wild-type (WT) mice and adiponectin null (APN-KO) mice.
(A) Fat mass, lean mass, and relative subcutaneous, visceral, and brown fat pad weights of 140-weeks old WT(n=5) and APN-KO (n=5) mice fed chow diet or 100-week-old WT (n = 5–7) and APN-KO mice (n = …
Figure 3
Deletion of adiponectin (APN) in aged mice exacerbates functional decline.
(A) H&E staining of an Epi fat depot of 20-week-old and 100-week-old wild-type (WT) and adiponectin null (APN-KO) mice fed on high-fat diet (HFD) or 140-week-old WT and APN-KO mice on chow diet. (B) …
Figure 4 with 1 supplement
Absence of adiponectin (APN) in aged mice exacerbates inflammation and accelerates aging.
(A) Expression of inflammatory markers in epididymal fat depots of 140-week-old wild-type (WT) and adiponectin null (APN-KO) mice fed on chow diet and 100-week-old WT and APN-KO fed on HFD(n = 10 …
Figure 4—figure supplement 1
Adiponectin deficiency in aged mice exacerbates inflammation and accelerates aging.
(A) Expression of inflammatory and fibrosis markers in liver of 140-week-old wild-type (WT) and adiponectin null (APN-KO) mice fed on chow diet (n = 7 for WT, n = 7 for APN-KO mice). (B) Serum …
Figure 5
Increasing adiponectin protects against aging-induced metabolic disturbance.
(A) Kaplan–Meier survival curves for controls and ΔGly mice on chow diet. Median survival time and maximum lifespan for each cohort. n denotes the number of mice per group. p-Values were determined …
Figure 6
Old adiponectin overexpressing mice exhibit improved glucose and lipid homeostasis.
(A) H&E staining of SubQ fat depot and Epi fat depot of 140-week-old controls and ΔGly mice fed on chow diet. (B) Mac2 staining of epididymal fat sections in 140-week-old controls and ΔGly mice. (C) …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | WT C57BL/6J | Jackson Laboratory | JAX 000664 RRID:IMSR_JAX:000664 | N/A |
| Genetic reagent (Mus musculus) | APN-KO | PMID:16326714 | N/A | N/A |
| Genetic reagent (Mus musculus) | ΔGly | PMID:14576179 | N/A | N/A |
| Chemical compound, drug | TRIzolTM Reagent | Thermo Fisher | Cat# 15596018 | N/A |
| Chemical compound, drug | Insulin | Eli Lilly | Product ID: A10008415 | N/A |
| Chemical compound, drug | Dulbecco’s phosphate buffered saline | Sigma-Aldrich | Cat# D806552 | N/A |
| Chemical compound, drug | High-fat diet (HFD) | Research Diets | Cat# D12492 | N/A |
| Chemical compound, drug | DAPI | Life Technology | Cat# P36941 | N/A |
| Chemical compound, drug | Bovine serum albumin | Sigma | Cat# A9418 | N/A |
| Commercial assay or kit | Adiponectin ELISA kit | Invitrogen | Cat# EZMADP-60K RRID:AB_2651034 | N/A |
| Commercial assay or kit | Insulin ELISA Jumbo kit | ALPCO | Cat# 80-INSMS-E10 | N/A |
| Commercial assay or kit | Mouse/rat IGF-1 Quantikine ELISA kit | R and D | R and D Systems, Inc, Minneapolis, MN | N/A |
| Commercial assay or kit | Corticosterone Competitive ELISA kit | Invitrogen | Cat# EIACORT | N/A |
| Commercial assay or kit | iScript cDNA synthesis kit | BIO-RAD | Cat# 170–8891 | N/A |
| Commercial assay or kit | Sybr Green Master Mix | Thermo Fisher | Cat# A25778 | N/A |
| Commercial assay or kit | Senescence detection kit | Abcom | Cat#: AB65351 | N/A |
| Antibody | Mac2 (rat monoclonal) | BioLegend | Cat# 125401 RRID:AB_1134237 | IF(1:500) IHC(1:500) |
| Antibody | Perilipin (goat polyclonal) | Novus | Cat# NB100-60554 RRID:AB_922242 | IF(1:500) |
| Antibody | Insulin (guinea pig polyclonal) | Dako | Cat# A0564 RRID:AB_10013624 | IF(1:500) |
| Antibody | Glucagon (rabbit polyclonal) | Invitrogen | Cat# 15954–1-AP RRID:AB_2878200 | IF(1:500) |
| Antibody | Alexa Fluor 488 goat anti-guinea pig IgG (HCL) | Invitrogen | Cat# A-11073 RRID:AB_2534117 | IF(1:250) |
| Antibody | Alexa Fluor 594 donkey anti-rabbit IgG (HCL) | Invitrogen | Cat# A32754 RRID:AB_2762827 | IF(1:250) |
| Antibody | Alexa Fluor 594 donkey anti-goat IgG (HCL) | Invitrogen | Cat# A32758 RRID:AB_2762828 | IF(1:250) |
| Antibody | Alexa Fluor 488 goat anti-rat IgG (HCL) | Invitrogen | Cat# A48262 | IF(1:250) |
| Antibody | CD45-PerCP/Cyanine5.5 (rat monoclonal) | Biolegend | Cat# 103132 RRID:AB_893340 | FACS(1:400) |
| Antibody | CD11b-Pacific Blue (rat monoclonal) | Biolegend | Cat# 101224 RRID:AB_755986 | FACS(1:200) |
| Antibody | F4/80 -PE (rat monoclonal) | Biolegend | Cat# 123110 RRID:AB_893486 | FACS(1:200) |
| Antibody | CD11c -APC (Armenian Hamster monoclonal) | Biolegend | Cat# 117310 RRID:AB_313779 | FACS(1:200) |
| Antibody | CD206 -FITC (rat monoclonal) | Biolegend | Cat# 141703 RRID:AB_10900988 | FACS(1:200) |
| Sequence-based reagent | Gapdh _F | This paper | PCR primers | TGTGAACGGATTTGGCCGTA |
| Sequence-based reagent | Gapdh _R | This paper | PCR primers | ACTGTGCCGTTGAATTTGCC |
| Sequence-based reagent | F4/80_F | This paper | PCR primers | TGACTCACCTTGTGGTCCTAA |
| Sequence-based reagent | F4/80_R | This paper | PCR primers | CTTCCCAGAATCCAGTCTTTCC |
| Sequence-based reagent | IL-6_F | This paper | PCR primers | CCAGAGATACAAAGAAATGATGG |
| Sequence-based reagent | IL-6_R | This paper | PCR primers | ACTCCAGAAGACCAGAGGAAAT |
| Sequence-based reagent | TNFα_F | This paper | PCR primers | GAGAAAGTCAACCTCCTCTCTG |
| Sequence-based reagent | TNFα_R | This paper | PCR primers | GAAGACTCCTCCCAGGTATATG |
| Software, algorithm | Prism | GraphPad Software | GraphPad Software | N/A |
| Software, algorithm | Illustrator | Adobe | N/A | N/A |
| Other | Keyence BZ-X700 fluorescence microscope | Keyence | N/A | N/A |
| Other | Zeiss Axioskop FS2 microscope | Zeiss | N/A | N/A |
Additional files
-
Source data 1
All raw datasets of each figure for this study.
- https://cdn.elifesciences.org/articles/65108/elife-65108-data1-v2.xls
-
Supplementary file 1
Statistical information in each figure.
Table displaying the sample size, statistical test method, and p-value for the list figures.
- https://cdn.elifesciences.org/articles/65108/elife-65108-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/65108/elife-65108-transrepform-v2.docx
