An oomycete effector subverts host vesicle trafficking to channel starvation-induced autophagy to the pathogen interface
- Imperial College London, United Kingdom
- Sainsbury Laboratory Cambridge University (SLCU), United Kingdom
- Gregor Mendel Institute (GMI), Austrian Academy of Sciences, Vienna BioCenter (VBC), Austria
- INGEBI-CONICET, Ciudad Autonoma de Buenos Aires, Argentina
- The Sainsbury Laboratory, University of East Anglia, United Kingdom
Figures
Figure 1
The AIM peptide of PexRD54 is not sufficient for stimulation of autophagosome formation.
(A) Confocal micrographs of Nicotiana benthamiana leaf epidermal cells transiently expressing either RFP:AIMp (left), RFP:PexRD54 (middle), or RFP:GUS (right), with GFP:ATG8CL. Scale bars = 10 µm. …
-
Figure 1—source data 1
Source data for western blots and autophagosome counts.
The ZIP archive contains full sized immune blots and data sheet values for autophagosome quantification.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig1-data1-v2.zip
Figure 2 with 7 supplements
The AIM peptide supresses autophagy flux.
(A) Western blots show depletion of GFP:ATG8CL is substantially reduced by RFP:AIMp compared to RFP:PexRD54 and RFP:GUS control beyond 2 days post infiltration. (B) Western blots show various …
-
Figure 2—source data 1
Source data for western blots and autophagosome counts.
The ZIP archive contains full sized immune blots and data sheet values for autophagosome quantification.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig2-data1-v2.zip
Figure 2—figure supplement 1
AIMp stabilizes ATG8CL but not GFP.
(A) Western blots show depletion of GFP:ATG8CL is substantially reduced by RFP:AIMp compared to RFP:PexRD54 and RFP:GUS control beyond 2 days post Agrobacterium-mediated expression. (B) Empty vector …
Figure 2—figure supplement 2
RT-PCR shows expression of RFP constructs.
RNA was extracted at 2, 4, and 6 dpi from the N. benthamiana leaves expressing RFP:PexRD54, RFP:AIMp, or RFP:GUS. RT-PCR was performed using primers that amplify 5’ RFP and 3’ UTR regions of the RFP …
Figure 2—figure supplement 3
PexRD54 is trafficked to the vacuole while AIMp remains cytoplasmic.
Single plane confocal micrographs of N. benthamiana leaf epidermal cells expressing RFP:RD54 or RFP:AIMp at 2, 4, and 6 dpi. Scale bars represent 10 μm.
Figure 2—figure supplement 4
AIM peptide mutant does not stabilize ATG8CL.
Western blot shows depletion of GFP:ATG8CL is substantially reduced by RFP:AIMp but not with mutant RFP:mAIMpAA(WEIV to AEIA) and RFP:EV control 3 days post agroinfiltration. Red asterisks indicate …
Figure 2—figure supplement 5
AIMp stabilizes both endogenous and transiently expressed NBR1/Joka2 and ATG8(s).
(A) RFP:AIMp stabilizes endogenous NBR1/Joka2 and ATG8(s), whereas PexRD54 has a milder effect on NBR1/Joka2 stabilization but no apparent effect on ATG8(s) compared to RFP:GUS control. (B) AIMp …
Figure 2—figure supplement 6
Cell penetrating AIM peptide constructs are uptaken in roots.
Maximum projection confocal micrographs of N. benthamiana root epidermal cells exogenously supplied with either CF-AIMpsyn (top) or CF-mAIMpsyn (bottom). Both AIMp and its mutant form are …
Figure 2—figure supplement 7
Cell penetrating AIM peptides translocate inside leaf cells.
Single-plane confocal micrographs of WT N. benthamiana exogenously supplied with 5-Carboxyfluorescein (CF) tagged versions of AIMsyn and mAIMsyn, showing peptide translocation into the …
Figure 3 with 5 supplements
PexRD54 associates with the host vesicle transport regulator Rab8a independently of its ATG8CL binding.
(A) In planta co-immunoprecipitation between Rab8a and PexRD54 or PexRD54AIM. RFP:Rab8a was transiently co-expressed with either GFP:EV, GFP:PexRD54 or GFP:PexRD54AIM. Red asterisks indicate …
-
Figure 3—source data 1
Source data for western blots, Rab8a/mutant sequences, autophagosome counts, and localization data sheets.
The ZIP archive contains full sized immune blots, Rab8a wt and mutant sequences, and data sheet values for autophagosome quantification and colocalization assays.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig3-data1-v2.zip
Figure 3—figure supplement 1
PexRD54 interacts with NbRab8a.
In planta co-immunoprecipitation between PexRD54 and GFP:NbRab8a, GFP:StRab8a or an GFP Empty vector (GFP:EV). FLAG:PexRD54 was transiently co-expressed with either GFP:NbRab8a, GFP:StRab8a or an …
Figure 3—figure supplement 2
Rab8a localizes to the tonoplast, plasma membrane, and punctate structures.
Single-plane confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing either GFP:Rab8a with the plasma membrane marker RFP:REM1.3 (A) or GFP:Rab8a alone (B). (A-B) Rab8a …
Figure 3—figure supplement 3
Subcellular distribution of Rab8a and its mutants.
(A) Amino acid sequences of S. tuberosum Rab8aQ74L (top), wild type Rab8a (middle) and Rab8aS29N (bottom) proteins. (B–D) Maximum projection confocal micrographs of N. benthamiana leaf epidermal …
Figure 3—figure supplement 4
PexRD54 puncta preferentially co-localize with puncta of wild type and GDP bound form of Rab8a (Rab8aS29N) rather than GTP bound form (Rab8aQ74L).
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing BFP:PexRD54 with GFP:Rab8a (A), GFP:Rab8aS29N (B), GFP:Rab8aQ74L (C), or GFP:EV (D). Transects …
Figure 3—figure supplement 5
Rab8aS29N and GFP:Rab8aQ74L do not co-localize with AIM peptide in planta.
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing either RFP:PexRD54 or RFP:AIMp, with either (B, D) GFP:Rab8aS29N or (A, C) GFP:Rab8aQ74L. While …
Figure 4 with 3 supplements
PexRD54 recruits Rab8A to ATG8CL-labeled autophagosomes.
(A–C) Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing either BFP:EV (A), BFP:PexRD54 (B), or BFP:AIMp (C), with GFP:Rab8a and RFP:ATG8CL. Dashed …
-
Figure 4—source data 1
Source data for western blots, colocalization data sheets and image analysis plugin.
The ZIP archive contains full sized immune blots, data sheet values for colocalization analyses, and Fiji Macro/plugin used for puncta colocalization.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig4-data1-v2.zip
Figure 4—figure supplement 1
PexRD54 increases Rab8a and ATG8CL co-localisation.
(A–B) Maximum projection confocal micrographs of GFP:NbRab8a transgenic N. benthamiana leaf epidermal cells transiently expressing either (A) HA:PexRD54, or (B) HA:EV, with GFP:ATG8CL and …
Figure 4—figure supplement 2
RT-PCR shows expression of 3XHA constructs.
RNA was extracted at 2dpi from the N. benthamiana leaves expressing 3XHA:EV, 3XHA:PexRD54 or 3XHA:AIMp. RT-PCR was performed using Vector primers that amplify 5’ and 3’ UTR regions of the HA …
Figure 4—figure supplement 3
PexRD54 enhances proximity of Rab8a puncta to ATG9 compartments.
Maximum projection confocal micrographs (xyz) of N. benthamiana leaf epidermal cells transiently expressing RFP:Rab8a and ATG9:GFP with either (A) BFP:PexRD54, (B) BFP:AIMp, or (C) BFP:EV. Transects …
Figure 5 with 9 supplements
Rab8a is required for PexRD54-mediated autophagosome formation.
(A–B) RNAi-mediated silencing of Rab8a leads to reduction of autophagosome numbers induced by PexRD54. (A) Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing …
-
Figure 5—source data 1
Source data for Rab8a sequences and autophagosome counts.
The ZIP archive contains NbRab8a_1–4 and StRab8a DNA sequences and data sheet values for autophagosome quantification.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig5-data1-v2.zip
Figure 5—figure supplement 1
Validation of NbRab8a-1/2 silencing by RNAi:NbRab8a1-2.
Constructs carrying hairpin plasmids (pRNAi-GG) targeting NbRab8a, or GUS reporter gene were infiltrated to N. benthamiana and the expression of targeted genes was assessed by RT-PCR at 3 days post …
Figure 5—figure supplement 2
PexRD54 increases the number of ATG8CL puncta in a Rab8a-dependent manner.
(A) Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing RFP:ATG8CL and GFP:EV with either RNAi:GUS (left column) or RNAi:NbRab8a1-2 (right column). …
Figure 5—figure supplement 3
Validation of silencing of NbRab8a-1 by RNAi:NbRab8a1-2.
RT-PCR validates silencing of NbRab8a-1 for Figure 5A–B when RNAi:NbRab8a1-2 is expressed, compared to RNAi:GUS expression.
Figure 5—figure supplement 4
Validation of RNAi:NbRab8a1-4 silencing construct.
RT-PCR validates efficient silencing of NbRab8a1-4 when RNAi:NbRab8a1-4 is expressed, compared to RNAi:GUS expression. Rab11 is not efficiently silenced by RNAi:NbRab8a1-4 compared to RNAi:GUS.
Figure 5—figure supplement 5
Silencing of NbRab8a1-4 significantly reduces ATG8CL autophagosome numbers.
Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing RFP:ATG8CL with either RNAi:Rab8a1-4 (Left panel) or RNAi:GUS (Mid panel). Images shown are maximal projections of …
Figure 5—figure supplement 6
Silencing of NbRab8a1-4 significantly reduces PexRD54-triggered ATG8CL autophagosome numbers.
(A) Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing RFP:ATG8CL and GFP:PexRD54 with either RNAi:Rab8a1-4 (Top) or RNAi:GUS (Bottom). Images …
Figure 5—figure supplement 7
Dominant negative mutant of Rab8a (N128I) decreases PexRD54-induced autophagosome formation.
(A) Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing RFP:ATG8CL with either GFP:Rab8aN128I (top) or GFP:Rab8a (bottom) together with either HA:EV …
Figure 5—figure supplement 8
Rab8a (N128I) reduces the number of PexRD54-induced autophagosomes.
A) Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing RFP:ATG8CL with either GFP:Rab8aN128I (top) or GFP:EV (bottom) together with either …
Figure 5—figure supplement 9
WT Rab8a and Rab8aS29N increases the amount of PexRD54-triggered puncta.
(A) Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing BFP:PexRD54 with either GFP:Rab8aS29N, GFP:Rab8a, GFP:Rab8aQ74L, or GFP:EV. Scale bars represent 10 μm (B) …
Figure 6 with 1 supplement
Rab8a is dispensable for Joka2-mediated autophagy.
(A) Confocal micrographs of Nicotiana benthamiana leaf epidermal cells transiently expressing either Joka2:RFP (top) or RFP:PexRD54 (bottom), with GFP:Rab8a. Dashed circle highlights co-localized …
-
Figure 6—source data 1
Source data for western blots, autophagosome counts and colocalization values.
The ZIP archive contains uncropped full sized immune blots, data sheet values for autophagosome quantification and colocalization assays.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig6-data1-v2.zip
Figure 6—figure supplement 1
Validation of NbRab8a-1 silencing.
RT-PCR verified gene silencing of NbRab8a-1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control.
Figure 7 with 11 supplements
PexRD54 triggered autophagy is reminiscent of autophagy induced during carbon starvation.
(A) Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing either RFP:EV or RFP:PexRD54, with GFPATG8CL under normal light or 24-hour-dark conditions. (B) Scatter-boxplot …
-
Figure 7—source data 1
Source data for western blots, autophagosome counts and colocalization values.
The ZIP archive contains uncropped full sized immune blots, data sheet values for autophagosome quantification and colocalization assays.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig7-data1-v2.zip
Figure 7—figure supplement 1
Light restriction enhances depletion of both endogenous ATG8s and transiently expressed RFP:ATG8CL.
(A–B) compared to normal light conditions (control treatment), dark treatment (24 hr) slightly enhances the depletion of; (A) endogenous ATG8(s); (B) transiently expressed RFP:ATG8CL. In B, N. …
Figure 7—figure supplement 2
Dark treatment increases ATG8CL/Rab8a colocalization.
Maximum projection confocal micrographs of Nb::35SGFP:Rab8a N. benthamiana leaf epidermal cells transiently expressing RFP:ATG8CL under normal light or 24-hr-dark conditions. Scale bars represent 10 …
Figure 7—figure supplement 3
Rab8a puncta colocalize with Bodipy C12.
Maximum projection confocal micrographs (xyz) of N. benthamiana leaf epidermal cells transiently expressing GFP:Rab8a, stained with Bodipy C12 and exposed to either 24-hr-dark treatment or normal …
Figure 7—figure supplement 4
Rab8a colocalizes in puncta and ring-shaped vesicle-like structures with ATG8CL and Bodipy C-12.
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing GFP:Rab8a, BFP:ATG8CL and stained with Bodipy C-12. Images shown are maximal projections of 15 …
Figure 7—figure supplement 5
PexRD54/Rab8a cluster localization with Bodipy C-12.
Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing BFP:PexRD54 with GFP:Rab8a and stained with Bodipy C-12. Transects in overlay panel correspond to plot of relative …
Figure 7—figure supplement 6
PexRD54/Rab8a cluster localization with Bodipy C-12 and Oleosin.
Confocal micrographs (xy) of N. benthamiana leaf epidermal cells transiently expressing BFP:PexRD54 with either GFP:Rab8a and stained with Bodipy C-12 or RFP:Rab8a and YFP:Oleosin. Transects in …
Figure 7—figure supplement 7
Stimulation of autophagy by PexRD54, but not Joka2, increases frequency of Rab8a and Bodipy C-12-positive puncta.
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells treated with Bodipy C-12 dye to mark lipid droplets while transiently expressing GFP Rab8 with either BFP PexRD54 …
Figure 7—figure supplement 8
Rab8a knockdown reduces the proportion of PexRD54 autophagosomes associated with Oleosin-labeled LDs.
(A) Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing BFP:PexRD54, YFP:Oleosin with either RNAi:NbRab8a1-4 or RNAi:GUS. Images shown are maximal projections of 15–25 …
Figure 7—figure supplement 9
Validation of RNAi:Seipin silencing construct.
RT-PCR validates efficient silencing of NbSeipin-A but not NbSeipin-B when RNAi:Seipin is expressed, compared to RNAi:GUS expression.
Figure 7—figure supplement 10
Seipin knockdown reduces the number Oleosin-positive LDs.
Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing YFP:Oleosin with either RNAi:Seipin or RNAi:GUS. Images shown are maximal projections of 15–25 frames with 1 μm …
Figure 7—figure supplement 11
Seipin knockdown reduces the number of PexRD54 puncta.
Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing RFP:PexRD54 with either RNAi:Seipin or RNAi:GUS. Images shown are maximal projections of 15–25 frames with 1 μm …
Figure 8 with 8 supplements
Rab8a is recruited to perihaustorial PexRD54-ATG8CL autophagosomes.
(A-D) Confocal micrographs of P. infestans-infected N. benthamiana leaf epidermal cells transiently expressing either BFP:PexRD54 (A), BFP:EV (B), BFP:AIMp (C) or Joka2:BFP (D), with both RFP:ATG8CL …
-
Figure 8—source data 1
Source data for infection assays.
The ZIP archive contains data sheet values for infection assays in Figure 8—figure supplements 6–8.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig8-data1-v2.zip
Figure 8—figure supplement 1
Rab8a localizes to various vesicle-like structures around haustoria during infection with P. infestans.
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells infected with P. infestans (three dpi) and transiently expressing GFP:Rab8a. (A) Tissue infected with P. infestans …
Figure 8—figure supplement 2
Two distinct populations of Rab8a vesicles localize to P. infestans haustoria.
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells infected with P. infestans (3 dpi) and transiently expressing RFP:ATG8CL, GFP:Rab8a and either BFP:PexRD54, BFP:AIMp, …
Figure 8—figure supplement 3
Rab8a localizes to PexRD54-autophagosomes or Golgi, but not to mitochondria or peroxisomes.
(A–C) Confocal micrographs of N. benthamiana leaf epidermal cells transiently expressing (A) GFP:Rab8a, BFP:PexRD54, and GmMan11-49-mCherry (Golgi marker) or (B) GFP:Rab8a, BFP:PexRD54, and ScCOX41-2…
Figure 8—figure supplement 4
Rab8a colocalizes with PexRD54, Oleosin and Bodipy C-12, but not with the mitochondria marker, in puncta around P. infestans haustoria.
Confocal micrographs of N. benthamiana leaf epidermal cells infected with P. infestans (3 dpi) and transiently expressing (A) RFP:Rab8a, BFP:PexRD54, and YFP:Oleosin or (B) GFP:Rab8a, BFP:PexRD54 …
Figure 8—figure supplement 5
Localisation of Rab8a and its mutants in perihaustorial autophagosomes during infection by P. infestans.
Maximum projection confocal micrographs of N. benthamiana leaf epidermal cells infected with P. infestans (3 dpi) and transiently expressing either GFP Rab8a GTP (A), GFP Rab8a GDP (B), GFP (C), or …
Figure 8—figure supplement 6
Rab8a positively contributes to immunity to P. infestans.
(A) Silencing endogenous Rab8a 1–4 significantly increases P. infestans infection lesion size (22, N = 28 infected leaves) compared to a silencing control (11, N = 37 infected leaves). N. benthamiana…
Figure 8—figure supplement 7
Silencing resilient synthetic Rab8a (Rab8asyn) rescues enhanced pathogen susceptibility phenotype caused by NB:Rab8a1-4 silencing.
(A) Complementing Rab8a 1–4 silencing with a silencing resistant GFP:Rab8asyn (NbRab8a-1) recovers resistance to P. infestans. When Rab8a 1–4 is silenced, expression of GFP:Rab8asyn significantly …
Figure 8—figure supplement 8
Overexpression of Rab8aN128I significantly increases P.
infestans hyphal growth. Expression of GFP:Rab8aN128I (36, N = 42 infected leaves ) significantly increases P. infestans necrotic lesion size compared to an empty vector GFP control (20, N = 41 …
Figure 9
AIM peptide mediated arrest of ATG8 autophagy negatively affects P. infestans infection.
(A) Confocal micrographs of P. infestans-infected N. benthamiana leaf epidermal cells transiently expressing either RFP:AIMp (top), RFP:PexRD54 (middle), or PM-haustorial marker RFP:Rem1.3 (bottom), …
-
Figure 9—source data 1
Source data for infection assays.
Data sheet values for infection assays performed in Figure 9D.
- https://cdn.elifesciences.org/articles/65285/elife-65285-fig9-data1-v2.zip
Figure 10
Model for PexRD54 subversion of host vesicle trafficking to stimulate autophagosome biogenesis at the haustorial interface.
Under carbon starvation conditions, Rab8a recruits lipid droplets (LDs) to the phagophore assembly site that contains ATG8CL to drive starvation-induced autophagy, possibly via an unknown cargo …
Videos
Video 1
Rab8a localizes to small mobile vesicles and large ring-shaped structures.
GFP:Rab8a is co-expressed with the EHM marker RFP:REM1.3 via agroinfiltration in N. benthamiana leaf epidermal cells. Confocal laser scanning microscopy was used to monitor Rab8a-labeled vesicles 3 …
Video 2
Mobile PexRD54/Rab8a-positive puncta co-migrate with ATG9 vesicles.
RFP:Rab8a, BFP:PexRD54, and ATG9-GFP are co-expressed three via agroinfiltration in N. benthamiana leaf epidermal cells. Confocal laser scanning microscopy was used to monitor PexRD54/Rab8a-labeled …
Video 3
Mobile PexRD54/Rab8a-positive puncta co-migrate with Bopidy-C12-labeled lipid droplets.
GFP:Rab8a, BFP:PexRD54 are co-expressed three via agroinfiltration in N. benthamiana leaf epidermal cells stained with the lipid droplet dye Bodipy-C12. Confocal laser scanning microscopy was used …
Video 4
Rab8a localizes to small mobile vesicles at haustoria during P. infestans infection.
GFP:Rab8a, RFP:ATG8CL, and BFP:PexRD54 are co-expressed via agroinfiltration in N. benthamiana leaf epidermal cells infected with P. infestans. Confocal laser scanning microscopy was used to monitor …
Video 5
Rab8a localizes to large vacuole-like structures at haustoria during P. infestans infection.
GFP:Rab8a is co-expressed with the EHM marker RFP:REM1.3 via agroinfiltration in N. benthamiana leaf epidermal cells infected with P. infestans. Confocal laser scanning microscopy was used to …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Solanum Tuberosum) | StRab8a (Rab8a) | Sol Genomics Network | Sotub04g010260.1 | |
| Gene (Nicotiana benthamiana) | NbRab8a-1 | Sol Genomics Network | Niben101Scf07650g01021 | |
| Gene (Nicotiana benthamiana) | NbRab8a-2 | Sol Genomics Network | Niben101Scf09596g00001 | |
| Gene (Nicotiana benthamiana) | NbRab8a-3 | Sol Genomics Network | Niben101Scf00684g00002 | |
| Gene (Nicotiana benthamiana) | NbRab8a-4 | Sol Genomics Network | Niben101Scf03277g02014 | |
| Gene (Nicotiana benthamiana) | NbSeipin-A | Sol Genomics Network | Niben101Scf01983g13002 | |
| Gene (Nicotiana benthamiana) | NbSeipin-B | Sol Genomics Network | Niben101Scf03695g01004 | |
| Biological sample (Nicotiana benthamiana) | Nb-GFP-StRab8a seeds | This paper | Seeds are maintained at Bozkurt lab (ICL) | |
| Antibody | Anti-GFP (Rabbit polyclonal) | Chromotek | Cat# PABG1-100 RRID:AB_2749857 | WB: 1:1000 |
| Antibody | Anti-HA (Rat monoclonal) | Chromotek | Cat# 7c9-100 RRID:AB_2827568 | WB: 1:1000 |
| Antibody | Anti-RFP (Rat monoclonal) | Chromotek | Cat# 6g6-100 RRID:AB_2631395 | WB: 1:1000 |
| Antibody | Anti-FLAG (Mouse monoclonal) | Sigma-Aldrich | Cat# F3165 RRID:AB_259529 | WB: 1 µg/mL |
| Antibody | Anti-tRFP (Mouse monoclonal) | Evrogen | Cat# AB233, RRID:AB_2571743 | WB: 1:1000 |
| Peptide, recombinant protein | AIMpSyn | This paper | Peptide Sequence | RKKRRRESRKKRRRESKPLDFDWEIV |
| Peptide, recombinant protein | mAIMpSynAA | This paper | Peptide Sequence | RKKRRRESRKKRRRESKPLDFDAEIA |
| Sequence-based reagent | GA_RD54_F | This paper | PCR Primers | CTGGATCTGGAGAATTTGATGTTGGTCCCTCTTGGCT |
| Sequence-based reagent | GA_RD54_R | This paper | PCR Primers | TAGCATGGCCGCGGGATTTACACAATTTCCCAGTCG |
| Sequence-based reagent | GA_LIR2_R | This paper | PCR Primers | TAGCATGGCCGCGGGATTTAAGCAATTTCCGCGTCG |
| Sequence-based reagent | GA_AIMp_F | This paper | PCR Primers | CTGGATCTGGAGAATTTGATCGGGACAAAATTGACAAGA |
| Sequence-based reagent | GA_ATG8C_F | This paper | PCR Primers | CTGGATCTGGAGAATTTGATGCCAAAAGCTCCTTCAAA |
| Sequence-based reagent | GA_ATG8C_R | This paper | PCR Primers | TAGCATGGCCGCGGGATTCAAAAGGATCCGAAGGTAT |
| Sequence-based reagent | GAJoka2BFP_F | This paper | PCR Primers | CAGGCGGCCGCACTAGTGATATGGCTATGGAGTCATCTATTGTGATCAAGG |
| Sequence-based reagent | GAJoka2BFP_R | This paper | PCR Primers | GCAGATCCAGCAGATCCGATCTGCTCTCCAGCAATAAGATCCATCACAAC |
| Sequence-based reagent | NbRab8A_silF1 | This paper | PCR Primers | ACCAGGTCTCAGGAGGGCTTATATAAATGAAGCGAC |
| Sequence-based reagent | NbRab8A_silR1 | This paper | PCR Primers | ACCAGGTCTCATCGTACTTCTGCAATCGCGTGCGT CCGAAGGTAT |
| Sequence-based reagent | GW_StRab8a-1_F | This paper | PCR Primers | CACCATGGCCGCTCCACCCGCTAGAGCTCGAGCT |
| Sequence-based reagent | GW_StRab8a-1_R | This paper | PCR Primers | TTAAGAACCACAGCAAGCTGATTTTTGGGCG |
| Sequence-based reagent | Rab8aS29N_F | This paper | PCR Primers | GTTCTTACCCACACCGCTGTCGCCG |
| Sequence-based reagent | Rab8aS29N R | This paper | PCR Primers | TGCCTTCTTTTACGTTTCTCAGATG |
| Sequence-based reagent | Rab8aQ74L_F | This paper | PCR Primers | AAACCGGCGGTATCCCAGATTTGCAG |
| Sequence-based reagent | Rab8aQ74L_R | This paper | PCR Primers | GGAGCGGTTCCGAACAATTACAACT |
| Sequence-based reagent | Rab8aN128I_F | This paper | PCR Primers | ATGCCGACCAGAATTTTGTTGACATTG |
| Sequence-based reagent | Rab8aN128I_R | This paper | PCR Primers | CAAGGCTGACATGGATGAAAGCAAAAGG |
| Sequence-based reagent | Rab8a1-4-RNAi_F1 | This paper | PCR Primers | ACCAGGTCTCAGGAGGCAGCTCCACCAGCTAGG |
| Sequence-based reagent | Rab8a1-4-RNAi_R1 | This paper | PCR Primers | ACCAGGTCTCAGTGAAGGAACCATCTGAGAAC |
| Sequence-based reagent | Rab8a1-4-RNAi_F2 | This paper | PCR Primers | ACCAGGTCTCATCACACCACTATTGGTATTGAT |
| Sequence-based reagent | Rab8a1-4-RNAi_R2 | This paper | PCR Primers | ACCAGGTCTCAATTGTTCGGAAACGCTCCTGG |
| Sequence-based reagent | Rab8a1-4-RNAi_F3 | This paper | PCR Primers | ACCAGGTCTCACAATCAAGATAAGGACCATTGAGT |
| Sequence-based reagent | Rab8a1-4-RNAi_R3 | This paper | PCR Primers | ACCAGGTCTCATCGTCATGTCAGCCTTGTTGCCG |
| Sequence-based reagent | NYFP-Oleosin F | This paper | PCR Primers | GCAGAAGGTTATGAACCACGATGCAGATTACTATGGGCAGCAACATAC |
| Sequence-based reagent | Oleosin-CYFP R | This paper | PCR Primers | TCTGCTTAACCATGTTGTGGATACTCTGCTGGGTTCCAGTGACATG |
| Sequence-based reagent | GA_35S_HA_F | This paper | PCR Primers | GCCGCACTAGTGATATGTACCCA |
| Sequence-based reagent | GA_Term_R | This paper | PCR Primers | ATTTTTGCGGACTCTAGCATGG |
| Sequence-based reagent | GAPDH_F | This paper | PCR Primers | ATGGCTTCTCATGCAGCTTT |
| Sequence-based reagent | GAPDH_R | This paper | PCR Primers | ATCCTGTGGTCTTGGGAGTG |
| Sequence-based reagent | RFP F: | This paper | PCR Primers | CTGGACATCACCTCCCACAACGAGG |
| Sequence-based reagent | Term R: | This paper | PCR Primers | CACATGAGCGAAACCCTATAAGAACCCTA |
| Sequence-based reagent | GLOX- F | This paper | PCR Primers | CACCATGGCGGAGACGGTCACCAATGTAT |
| Sequence-based reagent | GLOX- R | This paper | PCR Primers | TTACATCCTCGGCAGGGG |
Additional files
-
Source data 1
Statistical_Summary for all figures.
- https://cdn.elifesciences.org/articles/65285/elife-65285-data1-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/65285/elife-65285-transrepform-v2.docx
