Prolonging the integrated stress response enhances CNS remyelination in an inflammatory environment
- Department of Neurology, Division of Multiple Sclerosis and Neuroimmunology, Northwestern University Feinberg School of Medicine, United States
- Weill Institute for Neuroscience, Department of Neurology, University of California, San Francisco, United States
Figures
Figure 1
Sephin1 treatment enhances remyelination after inflammatory demyelination.
(A) Cumulative clinical scores of C57BL/6J female mice immunized with MOG35-55/CFA to induce chronic EAE, treated with vehicle (n = 7) and 8 mg/kg Sephin1 (n = 7) from the peak disease. *p<0.05. …
-
Figure 1—source data 1
Disease scores and axon measurement of late stage of EAE.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig1-data1-v1.xlsx
Figure 2 with 1 supplement
Schematics of GFAP-tTA;TRE-IFN-γ double-transgenic mouse model of cuprizone demyelination/remyelination.
(A) GFAP-tTA mice are mated with TRE-IFN-γ mice to produce double-positive animals. When these mice are maintained on doxycycline (Dox), the expression of the IFN-γ is repressed. When they are …
Figure 2—figure supplement 1
GFAP-tTA;TRE-IFN-γ mice express IFN-γ after release from doxycycline.
Real-time qPCR analyses for detection of mRNA levels of ectopically expressed IFN-γ in the brains of GFAP-tTA;TRE-IFN-γ mice. (A) The expression of IFN-γ in the GFAP-tTA;TRE-IFN-γ/GADD34 KO or WT …
Figure 3
GADD34 deficiency protects remyelinating oligodendrocytes in the presence of IFN-γ.
The corpora callosa of GFAP-tTA;TRE-IFN-γ/GADD34 KO or WT were taken at W0, W5, and W8. (A) Immunofluorescent staining for ASPA (a mature oligodendrocyte marker) and DAPI (nuclei). Scale bar = 100 …
-
Figure 3—source data 1
The number of ASAP+ cells in WT and KO.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig3-data1-v1.xlsx
Figure 4
GADD34 deficiency enhances remyelination in the presence of IFN-γ.
The corpora callosa of GFAP-tTA;TRE-IFN-γ/GADD34 KO or WT were harvested for EM processing. (A) Representative EM images of axons in the corpus callosum at W0 and W5. Scale bar = 1 µm. (B) …
-
Figure 4—source data 1
The number of myelinated axons in WT and KO.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig4-data1-v1.xlsx
Figure 5
Sephin1 protects remyelinating oligodendrocytes in the presence of IFN-γ.
The corpora callosa of GFAP-tTA;TRE-IFN-γ were taken at W0 and W3 prior to any treatment as well as after either vehicle or Sephin1 treatment at W5 and W8. (A) Immunofluorescent staining for ASPA (a …
-
Figure 5—source data 1
The number of ASAP+ cells in Veh and Seph groups.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig5-data1-v1.xlsx
Figure 6
Sephin1 enhances remyelination in the presence of IFN-γ.
The corpora callosa of GFAP-tTA;TRE-IFN-γ were harvested for EM processing. (A) Representative EM images of axons in the corpus callosum at W5. Scale bar = 1 µm. (B) Representative EM images of …
-
Figure 6—source data 1
The number of myelinated axons in Veh and Seph groups.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig6-data1-v1.xlsx
Figure 7 with 2 supplements
GADD34 deficiency or Sephin1 does not affect OPC proliferation during remyelination.
(A) Immunofluorescent staining for PDGFRα (an OPC marker), Ki67 and DAPI (nuclei) from the corpus callosum of GFAP-tTA;TRE-IFN-γ/GADD34 KO or WT was taken at W5 and W8. Scale bar = 50 µm. …
-
Figure 7—source data 1
The number of total OPCs and proliferating OPCs.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig7-data1-v1.xlsx
Figure 7—figure supplement 1
GADD34 deficiency does not affect microglial activation during remyelination in the presence of IFN-γ.
The corpus callosum of GFAP-tTA;TRE-IFN-γ/GADD34 KO or WT was taken at W0, W5 and W8. (A) Immunofluorescent staining for IBA1 (a microglia marker), MBP (a myelin marker) and DAPI. Scale bar = 50 µm. …
Figure 7—figure supplement 2
Sephin1 treatment does not affect microglial activation during remyelination in the presence of IFN-γ.
The corpus callosum of GFAP-tTA;TRE-IFN-γ was taken at W0, W5, and W8 with vehicle or Sephin1 treatment. (A) Immunofluorescent staining for IBA1, MBP, and DAPI. Scale bar = 50 µm. (B) Quantification …
Figure 8
Combined treatment of Sephin1 and BZA accelerates remyelination.
GFAP-tTA;TRE-IFN-γ mice were released from Dox at W0 and given cuprizone chow for 5 weeks. Treatment with vehicle, Sephin1, BZA or combined BZA and Sephin1 was started at W3, and the corpus callosum …
-
Figure 8—source data 1
The number of ASAP+ cells, myelinated axons and g-ratio of various treatments.
- https://cdn.elifesciences.org/articles/65469/elife-65469-fig8-data1-v1.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus) | C57Bl/6J | Jackson lab | RRID:IMSR_JAX:000664 | |
| Strain, strain background (M. musculus) | GFAP-tTA mice | Lin et al., 2004 | RRID:IMSR_JAX:005964 | |
| Strain, strain background (M. musculus) | TRE-IFN-γ mice | Lin et al., 2004 | RRID:IMSR_JAX:009344 | |
| Strain, strain background (M. musculus) | Ppp1r15a-/-(GADD34 KO) mice | Gift from David Ron | RRID:MGI:3040935 | |
| Chemical compound, drug | doxycycline | Sigma-Aldrich | Cat # D9891 | |
| Chemical compound, drug | 0.2% cuprizone | Envigo | Cat # TD.160049 | |
| Chemical compound, drug | Sephin1 | Apexbio | Cat # A8708 | |
| Chemical compound, drug | bazedoxifene acetate | Sigma-Aldrich | Cat # PZ0018 | |
| Chemical compound, drug | MOG 35-55peptide | Genemed synthesis | Cat # MOG3555-P-5 | |
| Chemical compound, drug | pertussis toxin | List Biological Laboratories | Cat # 179 | |
| Sequence-based reagent | Gapdh-f | This paper | qPCR primer | TGTGTCCGTCGTGGATCTGA |
| Sequence-based reagent | Gapdh-r | This paper | qPCR primer | TTGCTGTTGAAGTCGCAGGAG |
| Sequence-based reagent | Ifng-f | This paper | qPCR primer | GATATCTGGAGGAACTGGCAAAA |
| Sequence-based reagent | Ifng-r | This paper | qPCR primer | CTTCAAAGAGTCTGAGGTAGAAAGAGATAAT |
| Antibody | Anti-MBP (mouse monoclonal) | Abcam | Cat # ab24567 RRID:AB_448144 | (1:700) |
| Antibody | Anti-ASPA (rabbit polyclonal) | Genetex | Cat # GTX113389 RRID:AB_2036283 | (1:500) |
| Antibody | Anti-Ki67 (rabbit polyclonal) | Abcam | Cat # AB15580 RRID:AB_443209 | (1:100) |
| Antibody | Anti-PDGFR-alpha (mouse monoclonal) | BD Biosciences | Cat # 558774 RRID:AB_397117 | (1:100) |
| Antibody | Anti-Iba1 (rabbit polyclonal) | Wako Pure Chemical | Cat # 019–19741 RRID:AB_839504 | (1:500) |
| Software, algorithm | ImageJ | National Institutes of Health | RRID:SCR_003070 | |
| Software, algorithm | Prism 6.0 | Graphpad | RRID:SCR_002798 |
