Chromatin structure-dependent histone incorporation revealed by a genome-wide deposition assay
- Division of Cancer Biology, The Cancer Institute of Japanese Foundation for Cancer Research, Japan
- Laboratory of Chromatin Structure and Function, Institute for Quantitative Biosciences, The University of Tokyo, Japan
- Division of Transcriptomics, Medical Institute of Bioregulation, Kyushu University, Japan
- Division of Experimental Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Japan
- Cell Biology Center, Institute of Innovative Research, Tokyo Institute of Technology, Japan
Figures
Figure 1 with 4 supplements
RhIP (Reconstituted histone complex Incorporation into chromatin of Permeabilized cells) assay recapitulates the replication-coupled H3.1-H4 and -dependent H3.3-H4 depositions.
(A) Schematic representation of the RhIP assay, using reconstituted H3.1-H4 and H3.3-H4 complexes. Permeabilized cells were prepared from HeLa cells treated with non-ionic detergent, to perforate …
Figure 1—figure supplement 1
H3.3 is enriched in active genes in the RhIP assay.
(A) An aggregate plot of reads occupancy surrounding the TSS of active or inactive genes from the RhIP-ChIP-seq of H3.3. (B) The results of RhIP-ChIP-qPCR of H3.3. ChIP enrichments (fold enrichment …
Figure 1—figure supplement 2
CAF-1 and HIRA in permeabilized cells are essential for H3.1 and H3.3 incorporations in the RhIP assay.
(A) Scheme of cell fractionation (left). HeLa cells were treated with non-ionic detergent and the supernatant (soluble fraction), which is removed from permeabilized cells, and the pellet, which …
Figure 1—figure supplement 3
The exogenously added H3.1 and H3.3 are mostly incorporated into the chromatin in the RhIP assay.
(A) Scheme of the RhIP-immunostaining with harsh washing conditions. The RhIP assay was performed with H3.1-H4 and H3.3-H4, and then the cells were washed with PBST or PBST containing 300 mM NaCl …
Figure 1—figure supplement 4
Replication-coupled H3.1 deposition in the RhIP assay requires the cellular extract.
(A) Schematic representation of the RhIP assay. The RhIP assay was performed with H3.1-H4, in the presence of either the cellular extract or the histone chaperones NAP1 or ASF1. (B) Purified human …
Figure 2 with 2 supplements
The H2A.Z and H2A deposition patterns are different in the RhIP assay.
(A) Schematic representation of the RhIP assay, using the reconstituted H2A-H2B and H2A.Z-H2B complexes. (B) The reconstituted H2A-H2B and H2A.Z-H2B complexes were analyzed by SDS-16% PAGE with …
Figure 2—figure supplement 1
H2A.X shows the same deposition patterns as H2A in the RhIP assay.
(A) Schematic representation of the RhIP assay, using the reconstituted H2A-H2B and H2A.X-H2B complexes. (B) Reconstituted H2A-H2B and H2A.X-H2B complexes were analyzed by SDS-16% PAGE with …
Figure 2—figure supplement 2
Replication-coupled H2A.Z deposition does not change during S phase progression.
(A) Cells were synchronized in early or late S phase by a double thymidine block. The experimental scheme is shown above the image panels. Cell synchronization was confirmed by the homogeneous …
Figure 3 with 2 supplements
The incorporation of histones H2A and H2A.
Z mainly occurs at less condensed chromatin and H2A incorporation into condensed chromatin requires a replication-coupled deposition mechanism. (A) RhIP-ChIP-seq and DNaseI-seq profiles using …
Figure 3—figure supplement 1
Biological replicates of RhIP-ChIP-seq analyses of H2A and H2A.Z.
(A) Biological replicate of Figure 3B. (B) RhIP-ChIP-seq profiles using asynchronous and late S phase cells were visualized with the Integrative Genomics Viewer. From top to bottom, profiles of H2A …
Figure 3—figure supplement 2
Quality check of RhIP-ChIP-seq analysis of H2A.Z.
(A) Scatter plot analyses of the H2A.Z RhIP-ChIP-seq replicates (left), and the H2A.Z and H2A RhIP-ChIP-seq (right) at known H2A.Z sites. (B) The plotFingerprints of RhIP-ChIP-seq (left and right) …
Figure 4 with 1 supplement
H2A.Z is specifically enriched around transcription start sites in the RhIP assay.
(A) Representative profiles of RhIP-ChIP-seq using asynchronous cells and ChIP-seq (GEO:GSM1003483) at chr10: 73,079,443–73,805,171. (B) Aggregation plots of the H2A (RhIP-ChIP, left), H2A.Z …
Figure 4—figure supplement 1
The biological replicate of the distribution analysis of incorporated H2A.Z in the RhIP-ChIP.
Figure 5 with 1 supplement
H2A.Z deposition requires both ANP32E and ATP in the RhIP assay.
(A) Scheme of cell fractionation (left). HeLa cells were treated with non-ionic detergent and the supernatant (soluble fraction), which is removed from permeabilized cells, and the pellet, which …
Figure 5—figure supplement 1
The biological replicate of RhIP-ChIP-seq analysis of H2A.Z using ANP32E- or ATP-depleted cellular extract.
Figure 6
Identification of responsible residues for H2A- and H2A.Z-specific incorporations.
(A) Amino acid alignments of the H2A.Z M6 region and its counterpart in H2A (upper). The structural models of the H2A.Z-H2B and H2A-H2B dimers (PDB IDs: 3WA9 and 3AFA, respectively). The specific …
Figure 7
Model of differential histone incorporations into open and closed chromatin.
In open chromatin, the H2A-H2B and H2A.X-H2B complexes are incorporated in replication-independent (RI) and replication-coupled (RC) manners, respectively, while H2A.Z-H2B is incorporated only in a …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-HA (mouse, monoclonal) | Santa Cruz | sc-7392 RRID:AB_627809 | IF(1:1,000) |
| Antibody | Anti-HA (rabbit, monoclonal) | Cell Signaling Technology | 3724 RRID:AB_1549585 | IF(1:2,000) only used in Figure 1—figure supplements 1D and 3D |
| Antibody | Anti-DDDDK (anti-FLAG) (rabbit, polyclonal) | MBL | PM020 RRID:AB_591224 | IF(1:500) |
| Antibody | Anti-V5 (chicken, polyclonal) | Abcam | ab9113 RRID:AB_307022 | IF(1:1000) |
| Antibody | Anti-p60 (rabbit, monoclonal) | Abcam | ab109442 RRID:AB_10861771 | IF(1:400) |
| Antibody | Anti-HIRA (mouse, monoclonal) | Active Motif | WC119.2H11 RRID:AB_10715607 | IF(1:200) |
| Antibody | Anti-HIRA (rabbit, monoclonal) | Abcam | ab129169 RRID:AB_11140220 | WB(1:500) |
| Antibody | Anti-p60 (rabbit, monoclonal) | Abcam | ab109442 RRID:AB_10861771 | WB(1:400) |
| Antibody | Anti-H3 (mouse, monoclonal) | MBL | MABI0301 RRID:AB_11142498 | WB(1:1000) |
| Antibody | Anti-SRCAP (rabbit, polyclonal) | Kerafast | ESL103 | WB(1:1000) |
| Antibody | Anti-TIP60 (mouse, monoclonal) | Santa Cruz | sc-166323 RRID:AB_2296327 | WB(1:50) |
| Antibody | Anti-ANP32E (rabbit, polyclonal) | MyBioSource | MBS9214243 | WB(1:1000) |
| Antibody | Anti-GAPDH (mouse, monoclonal) | MBL | ML171-3 RRID:AB_10597731 | WB(3:1000) |
| Sequence-based reagent | GAPDH_F | This paper | PCR primers | AAAGGGTGCAGCTGAGCTAG |
| Sequence-based reagent | GAPDH_R | This paper | PCR primers | TACGAAGCCCTTCCAGGAGA |
| Sequence-based reagent | LINC02199_F | This paper | PCR primers | CCGGTGTCAAATGTCACAATGAA |
| Sequence-based reagent | LINC02199_R | Thermo Fisher | PCR primers | GGGGTTTTGAGGATTCCAAAGTG |
| Sequence-based reagent | si_p60 gene | This paper | siRNA | AAUGAUAACAAGGAGCCGGAGdTdT |
| Sequence-based reagent | si_p150 gene | This paper | siRNA | CUGUCAUGUGGGUUCUGACdTdT |
| Sequence-based reagent | ON-TARGET SMARTpool siRNA (HIRA gene) | Dharmacon | siRNA | L-013610-00-0005 |
| Cell line (Homo sapiens) | HeLa | Peter R Cook | N/A | A human cervical cancer cell line (female origin) |
| Cell line (Homo sapiens) | SF8628 | Merck | SCC127 RRID:CVCL_IT46 | Human DIPG H3.3-K27M Cell Line |
