Rapid spread of a densovirus in a major crop pest following wide-scale adoption of Bt-cotton in China
- The State Key Laboratory for Biology of Plant Disease and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, China
- Shenzhen Branch, Guangdong Laboratory of Lingnan Modern Agriculture, Genome Analysis Laboratory of the Ministry of Agriculture and Rural Affairs, Agricultural Genomics Institute at Shenzhen, Chinese Academy of Agricultural Sciences, China
- Institute of Plant Protection and Soil Fertility, Hubei Academy of Agricultural Sciences, China
- Tobacco Research Institute, Chinese Academy of Agricultural Sciences, China
- Lancaster Environment Centre, Lancaster University, United Kingdom
- Instituto de Biotecnología, Universidad Nacional Autónoma de México, United States
Figures
Figure 1 with 1 supplement
Relationship of different Helicoverpaarmigera strains’ LC50 with or without HaDV2 infection.
The x-axis is the LC50 of different strains (LF, 96S, LF5, LF60, LF120, LF240, LFC2, 96CAD, and BtR) without HaDV2 infection (HaDV2-negative); the y-axis is the LC50 of different strains (LF, 96S, …
-
Figure 1—source data 1
Source data for Figure 1.
- https://cdn.elifesciences.org/articles/66913/elife-66913-fig1-data1-v2.docx
Figure 1—figure supplement 1
Quantification of HaDV2 in individuals feeding on diet with and without Bt.
(A) The body weight of larvae feeding on diet with and without Bt at 8th day after hatching (t=10.164, df=32, p<0.0001, n=17). (B) The logarithm of HaDV2 copy number to base 10 per larva feeding on …
-
Figure 1—figure supplement 1—source data 1
Quantification of HaDV2 in individuals feeding on diet with and without Bt toxin.
- https://cdn.elifesciences.org/articles/66913/elife-66913-fig1-figsupp1-data1-v2.docx
Figure 2
Relationship of different Helicoverpaarmigera strains’ larval (A), and pupal (B,C) with or without HaDV2 infection.
(A) The x-axis is the larval development rate (1/duration) of different strains (LF, LF5, LF60, and LF240) without HaDV2 infection (HaDV2-negative); the y-axis is the larval development rate …
-
Figure 2—source data 1
Source data for Figure 2.
- https://cdn.elifesciences.org/articles/66913/elife-66913-fig2-data1-v2.docx
Figure 3 with 1 supplement
Effects of HaDV2 infection on the net reproductive rate (R0) in four Helicoverpaarmigera strains differing in their tolerance to Bt and not exposed to Cry1Ac toxin.
Mean R0 is calculated as the number of female offspring per female that reaches adulthood. The bars are bootstrapped standard errors.
Figure 3—figure supplement 1
Predicted spread of HaDV2 on Bt-cotton for two strains of Helicoverpaarmigera (LF and LF240).
The model is based on that by Himler et al., 2011, where F=R0(HaDV2−)/R0(HaDV2+), which equals 0.7385 for LF and 0.6667 for LF240. The predicted prevalence of HaDV2 in generation t+1 (It+1) is …
Figure 4
Frequency distributions for RADR scores for HaDV2 positive and negative insects.
The data were collected from field-collected insects from Xiajin and Anci in 2015 and 2016. RADR, relative average development rate.
-
Figure 4—source data 1
Source data for Figure 4.
- https://cdn.elifesciences.org/articles/66913/elife-66913-fig4-data1-v2.xlsx
Figure 5
HaDV2 infection rate and RADR dynamics and their relationship for each year in the Xiajin and Anci populations during 2007–2016.
(A) Relation between HaDV2 infection rate of larvae in Xiajin populations and planting year of Bt-cotton. Logistic regression model of HaDV2 infection rate, logit (y) = 0.49473x−993.1444, R²=0.8591, …
-
Figure 5—source data 1
Source data for Figure 5.
- https://cdn.elifesciences.org/articles/66913/elife-66913-fig5-data1-v2.docx
Figure 6 with 2 supplements
Distribution of HaDV2 in Helicoverpaarmigera from different populations.
The red proportion of circles refers to infected individuals, and the blue refers to non-infected individuals. There are significant differences in HaDV2 infection rates between the 29 Bt-cotton …
Figure 6—figure supplement 1
The infection rate of HaDV2 in Bt-cotton and non-Bt-cotton planting areas from 2014 to 2016 (means± SE).
The detailed information is summarized in Supplementary file 1g.
Figure 6—figure supplement 2
The detection limit of HaDV2 with PCR method.
(a) DNA from HaDV2 positive individual as template. M=Marker, 1=1324.9 ng/µL, 2=132.49 ng/µL, 3=13.249 ng/µL, 4=1.3249 ng/µL, 5=0.13249 ng/µL, and 6=0.013249 ng/µL. (b) Plasmids as template. …
Figure 7
HaDV2 infection rate has increased significantly since Bt-cotton was first introduced and was positively related to the Bt adoption in all cotton areas.
(A) Temporal changes in the infection rate of HaDV2 since the introduction of Bt-cotton. (B) Changes in the infection rate of HaDV2 according to the proportion of Bt-cotton in all cotton. Each …
Figure 8 with 1 supplement
Transcriptome analysis of HaDV2-positive individuals compared to related HaDV2-negative individuals (HaDV2+ vs.HaDV2−) of Helicoverpaarmigera.
(A–C) PCA of global gene expression of DEGs at 24 (A), 48 (B), and 72 hr (C) after HaDV2 inoculation. Blue stands for HaDV2-positive samples and red stands for HaDV2-negative samples. (D–F) Heatmaps …
Figure 8—figure supplement 1
Heatmaps of DEGs related to the expression of significantly enriched pathways of Helicoverpa armigera at 24, 48, and 72 hr.
The quantity of DEGs with log2(FPKM) related to the expression of the Jak-STAT signaling pathway at 24 hr (A) and 48 hr (i); the insect hormone biosynthesis pathway at 24 hr (B); the insulin …
Figure 9
Transcriptome analysis of Helicoverpa armigera after HaDV2 infection and Cry1Ac exposure.
The quantity of DEGs with log2(FPKM) related to the expression of (A) the ABC transporters; (B) trypsin; (C) Bt receptors and carboxylesterase genes; (D) the MAPK signaling pathway; (E) the drug …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Helicoverpa armigera) | LF | Collected from Langfang, Hebei Province, in 1998 | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | 96S | Collected from Xinxiang, Henan Province, in 1996, | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | BtR | Cry1Ac-resistant strains selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | 96CAD | Cry1Ac-resistant strains (with a cadherin mutation) selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | LFC2 | Cry1Ac-resistant strains (with an ABCC2 mutation) selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | LF5 | Cry1Ac-resistant strains selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | LF30 | Cry1Ac-resistant strains selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | LF60 | Cry1Ac-resistant strains selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | LF120 | Cry1Ac-resistant strains selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | LF240 | Cry1Ac-resistant strains selected from the susceptible strain on artificial diets | See Materials and methods, Laboratory strains | |
| Strain, strain background (H. armigera) | Adult female bollworm moths | Collected from field | See Materials and methods, Collection of field strains | |
| Biological sample (Helicoverpa armigera densovirus-1) | HaDV2 | (Xu et al., 2014) DOI: 10.1371/journal.ppat.1004490 | See Materials and methods, HaDV2 preparation | |
| Recombinant DNA reagent | pEASY-T1 cloning vector | TransGen, Beijing, China | See Materials and methods, Detection of HaDV2 in wild populations of H. armigera | |
| Sequence-based reagent | HaDV-F | (Xu et al., 2014) DOI: 10.1371/journal.ppat.1004490 | GGATTGGCCTGGGAAATGAC | |
| Sequence-based reagent | HaDV-R | (Xu et al., 2014) DOI: 10.1371/journal.ppat.1004490 | CGTTGTTTTTATATCCGAGG | |
| Chemical compound, drug | Cry1Ac | Dow AgroSciences (Indianapolis, IN) | See Materials and methods, Bt toxins | |
| Software, algorithm | POLO Plus LeOra Software | POLO Plus LeOra Software, Berkeley | Probit analysis | |
| Software, algorithm | BLASTx | BLASTx | RRID:SCR_004870 | |
| Software, algorithm | Bowtie | Bowtie – 0.12.7 | RRID:SCR_005476 | |
| Software, algorithm | RSEM | RSEM – v1.1.17 | RRID:SCR_013027 | |
| Software, algorithm | DEseq2 | DEseq2 | RRID:SCR_015687 | |
| Software, algorithm | SPSS | SPSS | RRID:SCR_002865 | |
| Software, algorithm | RADR | (An et al., 2015) Doi: org/10.1002/ps.3807 | The relative average development rates |
Additional files
-
Supplementary file 1
Supplementary tables.
(a) Bt toxin sensitivity test of different Helicoverpa armigera strains with or without HaDV2 infection. (b) Mortality changes with Bt toxin concentration test of different H. armigera strains with or without HaDV2 infection. (c) Comparing the effects of HaDV2 on fitness components of LF, LF5, LF60, and LF240. LF is susceptible strain; LF5, LF60, and LF240 are Bt resistant strains selected with LF strain. Significant differences (ANOVA followed by Tukey’s HSD test) between each strain with or without HaDV2 infestation are indicated by different letters (p<0.05). Insects were reared on artificial non-Bt-diet. D+ stand for infected by HaDV2, D− stand for non-infected by HaDV2. (1–5) means the survival rate from the first star to the 5th star; 5 p: from the 5th star to pupa; Proportion FA: the rate of female divided male. (d) Analysis of variance for fitness parameters of 4 cotton bollworm strains (LF, LF5, LF60, and LF240). (e) Fitness of the susceptible and resistant strains on Bt- and non-Bt-cotton infected with or without HaDV2. (f) Analysis of variance for weight of cotton bollworm larvae. (g) Sample information and infection rates of HaDV2 in the field populations of H. armigera. See Figure 6 for a map of locations. X: east longitude, Y: northern latitude. (h) Host information and accessions for samples.
- https://cdn.elifesciences.org/articles/66913/elife-66913-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/66913/elife-66913-transrepform-v2.docx
