Distinct expression requirements and rescue strategies for BEST1 loss- and gain-of-function mutations
- Eye Center, Renmin Hospital of Wuhan University, China
- Department of Pharmacology and Physiology, University of Rochester, School of Medicine and Dentistry, United States
- Department of Ophthalmology, Vagelos College of Physicians & Surgeons, Columbia University, United States
- Department of Pharmacology, Columbia University, United States
- Eye Center, Medical Research Institute, Renmin Hospital, Wuhan University, China
- Jonas Children’s Vision Care, Departments of Ophthalmology and Pathology & Cell Biology, Edward S. Harkness Eye Institute, Institute of Human Nutrition and Columbia Stem Cell Initiative, New York Presbyterian Hospital/Columbia University Irving Medical Center, United States
Figures
Figure 1 with 2 supplements
Functional influence of BEST1 loss-of-function mutants in HEK293 cells.
(a) Population steady-state current density-voltage relationships in HEK293 cells expressing BEST1 WT-CFP only (black), WT-CFP: WT-YFP = 1:1 (gray), or WT-CFP: WT-YFP = 1:4 (light gray), in the …
Figure 1—figure supplement 1
Electrophysiological analysis of BEST1 loss-of-function mutations.
(a) Bar chart showing population steady-state current densities at +100 mV for 1:1 co-expressed BEST1 WT-CFP and WT/mutant-YFP in HEK293 cells at 1.2 μM [Ca2+]i; n = 5–6 for each point. (b) Bar …
Figure 1—figure supplement 2
Patient-derived BEST1 mutations in a homology model.
Ribbon diagram of two oppositely facing (144°) protomers of a BEST1 pentamer is shown with the extracellular side on the top. (a) The side chains are shown and highlighted for residues at the neck …
Figure 2 with 1 supplement
Functional influence of BEST1 gain-of-function mutants in HEK293 cells.
(a–c) Left, population steady-state current density-voltage relationships in HEK293 cells co-expressing WT-CFP: mutant-YFP = 1:1 (cyan) compared to WT only (WT-CFP: WT-YFP = 1:1, gray), in the …
-
Figure 2—source data 1
The uncropped blots in Figure 2d and Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/67622/elife-67622-fig2-data1-v1.docx
Figure 2—figure supplement 1
Electrophysiological analysis of BEST1 gain-of-function mutations.
(a) Bar chart showing population steady-state current densities at +100 mV for 1:1 co-expressed BEST1 WT-CFP and WT/mutant-YFP in HEK293 cells in the absence (open) or presence (solid) of 1.2 μM [Ca2…
Figure 3 with 3 supplements
BEST1 is responsible for conducting Ca2+-dependent Cl- currents in hPSC-RPE.
(a) Ca2+-dependent Cl- currents measured by whole-cell patch clamp in WT hPSC-RPE. Left, representative current traces recorded at 1.2 μM [Ca2+]i. Inset, voltage protocol used to elicit currents. Mid…
-
Figure 3—source data 1
gRNA sequences for CRISPR/Cas9.
- https://cdn.elifesciences.org/articles/67622/elife-67622-fig3-data1-v1.docx
Figure 3—figure supplement 1
Expression of RPE-specific marker proteins in hPSC-RPE and iPSC-RPE cells.
(a–b) Immunoblotting showing the expression of RPE-specific proteins BEST1, RPE65, CRALBP, and the loading control β-Actin in hPSC-RPE (a) and iPSC-RPE (b) cells. Two gels/blots in the same panel …
Figure 3—figure supplement 2
mRNA levels of Ca2+-activated Cl- channels (CaCCs) in hPSC-RPE cells.
(a) Reverse transcription polymerase chain reaction (RT-PCR) detecting BEST1 and control β-Actin mRNA in WT native RPE, iPSC-RPE and hPSC-RPE cells. Plasmids bearing the corresponding full-length …
Figure 3—figure supplement 3
Ca2+-dependent Cl- currents in iPSC-RPE and hPSC-RPE cells.
(a) Ca2+-dependent Cl- currents measured by whole-cell patch clamp in patient-derived BEST1 null iPSC-RPE. Representative current traces recorded at 1.2 μM [Ca2+]i. (b) Population steady-state …
Figure 4 with 1 supplement
Ca2+-dependent Cl- currents in hPSC-RPE cells bearing BEST1 gain-of-function mutations.
(a) Representative current traces of BEST1I205T/WT hPSC-RPE in the absence of Ca2+. (b) Population steady-state current density-voltage relationships in BEST1I205T/WT hPSC-RPE, in the absence (open …
Figure 4—figure supplement 1
CRISPR/Cas9-mediated gene silencing in combination with augmentation.
(a) Augmented BEST1-GFP and endogenous BEST1 were detected by immunoblotting in hPSC-RPE cells. (b) Schematic of the baculovirus-based silencing (BVSi) vector. (c) Immunoblotting showing the …
Figure 5
Knockdown and rescue of BEST1 gain-of-function mutations in hPSC-RPE cells.
(a) Population steady-state current density-voltage relationships in WT hPSC-RPE cells treated with BVSi-Ctrl (black) compared to those in BVSi 3–8 (red) or BVSi 5–4 (blue) treated cells, at 1.2 μM …
Tables
Table 1
Sequencing of BEST1 transcripts in retinal pigment epithelium (RPE) cells.
#1–6 are patient-derived iPSC-RPE cells carrying the same set of BEST1 mutations as those analyzed in transiently transfected HEK293 cells in Figure 1. #7 is native human RPE cells from a healthy …
| Donor # | Mutation | RPE type | Mutant/WT from clone #1 | Mutant/WT from clone #2 |
|---|---|---|---|---|
| 1 | A10T | iPSC-RPE | 72/23 | 51/12 |
| 2 | R218H | iPSC-RPE | 84/20 | 45/11 |
| 3 | L234P | iPSC-RPE | 77/19 | 42/20 |
| 4 | A243T | iPSC-RPE | 83/28 | 37/11 |
| 5 | Q293K | iPSC-RPE | 76/19 | 46/10 |
| 6 | D302A | iPSC-RPE | 78/18 | 35/14 |
| 7 | rs767552540 | Native | 74/23 | NA |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | HST08 (Stellar cells) | TaKaRa | 636766 | Chemical competent cells |
| Cell line (Spodoptera frugiperda) | Sf9 | Thermo Fisher Scientific | RRID:CVCL_0549 | Insect cell line for baculovirus production |
| Cell line (Homo sapiens) | HEK293 | ATCC | RRID:CVCL_0045 | Embryonic kidney cells |
| Cell line (Homo sapiens) | H1-iCas9 | Sloan Kettering Institute, González et al., 2014 | Embryonic stem cell line with an inducible CRISPR cassette | |
| Cell line (Homo sapiens) | H1-iCas9 BEST1-/- | This paper | BEST1-/- knockout generated from the H1-iCas9 line | |
| Cell line (Homo sapiens) | H1-iCas9 TMEM16A-/- | This paper | TMEM16A-/- knockout generated from the H1-iCas9 line | |
| Cell line (Homo sapiens) | H1-iCas9 TMEM16B-/- | This paper | TMEM16B-/- knockout generated from the H1-iCas9 line | |
| Cell line (Homo sapiens) | H1-iCas9 LRRC8A-/- | This paper | LRRC8A-/- knockout generated from the H1-iCas9 line | |
| Cell line (Homo sapiens) | H1-iCas9 BEST1I205T/WT | This paper | BEST1I205T/WT knock-in generated from the H1-iCas9 line | |
| Cell line (Homo sapiens) | H1-iCas9 BEST1Y236C/WT | This paper | BEST1Y236C/WT knock-in generated from the H1-iCas9 line | |
| Biological sample (Homo sapiens) | RPE cells | Li et al., 2017 | Human RPE cells from a post-mortem donor | |
| Biological sample (Homo sapiens) | iPSC-RPE cells | Ji et al., 2019a | iPSC-RPE cells derived from patient skin cells | |
| Antibody | Anti- RPE65 (Mouse monoclonal) | Novus Biologicals | Cat#: NB100-355, RRID:AB_10002148 | WB (1:1,000) |
| Antibody | Anti-CRALBP (mouse monoclonal) | Abcam | Cat#: ab15051, RRID:AB_2269474 | WB (1:500) |
| Antibody | Anti- BEST1 (mouse monoclonal) | Novus Biologicals | Cat#: NB300-164, RRID:AB_10003019 | WB (1:500) |
| Antibody | Anti-β-actin (rabbit polyclonal) | Abcam | Cat#: ab8227, RRID:AB_2305186 | WB (1:2,000) |
| Antibody | Anti- 6xHis (rabbit polyclonal) | Thermo Fisher Scientific | Cat#: PA1-983B, RRID:AB_1069891 | WB (1:1,000) |
| Antibody | Anti-Myc (rabbit polyclonal) | Thermo Fisher Scientific | Cat#: PA1-981, RRID:AB_325961 | WB (1:1,000) |
| Antibody | IRDye 680RD anti-mouse IgG (goat polyclonal) | LI-COR Biosciences | Cat#: 925–68070, RRID:AB_2651128 | WB (1:10,000) |
| Antibody | IRDye 800CW anti-rabbit IgG (donkey polyclonal) | LI-COR Biosciences | Cat#: 925–32213, RRID:AB_2715510 | WB (1:10,000) |
| Recombinant DNA reagent | pEG BacMam | Goehring et al., 2014 | Baculoviral vector for gene expression | |
| Recombinant DNA reagent | pBacMam-BEST1-GFP (plasmid) | Li et al., 2017 | To express exogenous BEST1 in HEK293 cells | |
| Recombinant DNA reagent | pBacMam-BEST1-mCherry (plasmid) | This paper | Made from pEG BacMam by inserting BEST1-mCherry | |
| Recombinant DNA reagent | dCas9-KRAB-MeCP2 (plasmid) | Addgene | RRID :Addgene_110821 | Improved dCas9 repressor-dCas9-KRAB-MeCP2 |
| Recombinant DNA reagent | pSpCas9(BB)−2A-GFP (PX458) (plasmid) | Addgene | RRID :Addgene_48138 | Cas9 from Streptococcus pyogenes with 2A-EGFP, and cloning backbone for sgRNA |
| Recombinant DNA reagent | BVSi 5–4-GFP (plasmid) | This paper | Made from pEG BacMam, dCas9-KRAB-MeCP2 and pSpCas9(BB)−2A-GFP, for BEST1 silencing | |
| Recombinant DNA reagent | BVSi 3–8-GFP (plasmid) | This paper | Made from pEG BacMam, dCas9-KRAB-MeCP2 and pSpCas9(BB)−2A-GFP, for BEST1 silencing | |
| Recombinant DNA reagent | BVSi ctrl-GFP (plasmid) | This paper | Made from pEG BacMam, dCas9-KRAB-MeCP2 and pSpCas9(BB)−2A-GFP, serving as a control for BEST1 silencing | |
| Sequence-based reagent | hBest1-I205T-ssDNA | This paper | Knock-in ssDNA template | GCCCTGGGTGTGGTTTGCCAACCTGTCAATGAAGGCGTGGCTTGGAGGTCGAATTCGGGACCCTACCCTGCTCCAGAGCCTGCTGAACGTGAGCCCACTGTACAGACAGGGCTGCCGCAG |
| Sequence-based reagent | hBest1-Y236C-ssDNA | This paper | Knock-in ssDNA template | TCAGTGTGGACACCTGTATGCCTACGACTGGATTAGTATCCCACTGGTGTGTACACAGGTGAGGACTAGTCTGGTGAGGCTGCCCTTTTGGGAAACTGAGGCTAGAAGGACCAAGGAAGC |
| Commercial assay or kit | CytoTune-iPS 2.0 Sendai reprogramming kit | Thermo Fisher Scientific | Cat#: A16517 | To generate iPSC |
| Commercial assay or kit | In-Fusion HD Cloning | Clontech | Clontech:639647 | For molecular cloning |
| Commercial assay or kit | PolyJet In Vitro DNA Transfection Reagent | SignaGen Laboratories | SL100688 | For cell transfection |
| Software, algorithm | Patchmaster | HEKA | RRID:SCR_000034 | Patch clamp data collection and analysis |
| Software, algorithm | PyMOL | PyMOL | RRID:SCR_000305 | Structural analysis |
