Chitinase 3-like-1 contributes to acetaminophen-induced liver injury by promoting hepatic platelet recruitment
- Department of Anesthesiology, UTHealth McGovern Medical School, United States
- Center for Life Sciences, School of Life Sciences, Yunnan University, China
- Texas Therapeutics Institute, UTHealth McGovern Medical School, United States
- Laboratory of Liver Disease, National Institute on Alcohol Abuse and Alcoholism, NIH, United States
- Molecular Microbiology and Immunology, Brown University, United States
- Division of Medicine and Biological Sciences, Warren Alpert School of Medicine, Brown University, United States
- Division of Digestive and Liver Diseases, Department of Internal Medicine, University of Texas Southwestern Med School, United States
- Division of Pediatric Critical Care Medicine, Baylor College of Medicine, United States
- Center for Translation Research on Inflammatory Diseases, Michael E. DeBakey Veterans Affairs Medical Center, United States
Figures
Figure 1
Chitinase 3-like-1 (Chi3l1) is upregulated and plays a critical role in acetaminophen-induced liver injury (AILI).
(A) Immunohistochemical (IHC) staining for Chi3l1 in normal liver biopsies (Normal) and those from patients with AILI (Patient). Images shown are representative of 10 samples/group. Scale bar, 250 …
Figure 2 with 1 supplement
Chitinase 3-like-1 (Chi3l1) contributes to acetaminophen-induced liver injury (AILI) by promoting hepatic platelet recruitment.
(A) Immunohistochemical (IHC) staining to detect platelets (CD41+) in healthy liver biopsies (Normal) and those from patients with AILI (Patient). Scale bar, 250 μm (n = 10/group). (B) Male C57B/6 …
Figure 2—figure supplement 1
Depletion of platelets by anti-CD41 antibody reduces hepatic platelets recruitment.
Male C57B/6 mice were treated with control IgG (Ctrl IgG) or an anti-CD41 antibody (α-CD41 Ab) either 3 hr before (pre-) or 3 hr after (post-) APAP administration. Immunofluorescence (IF) staining …
Figure 3 with 3 supplements
Chitinase 3-like-1 (Chi3l1) functions through its receptor CD44.
(A) Immunoprecipitation with anti-CD44 antibody was performed using liver homogenates obtained from wild-type (WT) and Cd44-/- mice treated with acetaminophen (APAP) for 2 hr. Input proteins and …
Figure 3—figure supplement 1
Chitinase 3-like-1 (Chi3l1) promotes hepatic platelet recruitment and acetaminophen-induced liver injury (AILI) through CD44 expressing on Mɸs.
(A–C) Chil1-/- mice reconstituted with recombinant mouse Chi3l1 (rmChi3l1) were treated with either Ctrl IgG or α-CD44 Ab 30 min prior to acetaminophen (APAP) challenge. (A) Serum levels of ALT and …
Figure 3—figure supplement 2
Deletion of neither chitinase 3-like-1 (Chi3l1) nor CD44 affects acetaminophen (APAP) bio-activation.
Male wild-type (WT), Chil1-/-, Cd44-/- mice were treated with APAP (n = 3 mice/group). (A) glutathione (GSH) levels in the liver were measured at indicated time points by HPLC. (B) Hepatic protein …
Figure 3—figure supplement 3
Female Chil1-/- and Cd44-/- mice develop reduced liver injury compared to female wild-type (WT) mice.
Female WT, Chil1-/- and Cd44-/- mice were treated with acetaminophen (APAP). Serum ALT levels were measured at 6 and 24 hr after APAP treatment (n = 6–8 mice/group). One-way ANOVA was performed.
Figure 4
Hepatic Mɸs promote platelet recruitment.
(A) Immunohistochemical (IHC) staining for macrophages (CD68+) and platelets (CD41+) in normal liver biopsies (Normal) and those from patients with AILI (Patient) (n = 10/group). Scale bar, 25 μm. (B…
Figure 5 with 1 supplement
Chitinase 3-like-1 (Chi3l1)/CD44 signaling in Mɸs upregulates podoplanin expression and platelet adhesion.
(A) Male WT, Chil1-/-, Cd44-/- mice were treated with acetaminophen (APAP) (n = 4 mice/group). After 3 hr, mice were sacrificed and Mɸs were isolated to measure mRNA levels of various adhesion …
Figure 5—figure supplement 1
Podolanin expressing on Mɸs mediates interactions with platelets.
Mɸs were isolated from wild-type (WT) mice treated with acetaminophen (APAP) for 3 hr. The cells were treated in vitro with either control IgG (Ctrl IgG) or an anti-podoplanin antibody (α-podoplanin …
Figure 6
Evaluation of the therapeutic potential of targeting chitinase 3-like-1 (Chi3l1) in the treatment of acetaminophen-induced liver injury (AILI).
(A–C) Male C57B/6 mice were treated with acetaminophen (APAP) for 3 hr, followed by intraperitoneally (i.p.) injection of either a control IgG (Ctrl IgG) or an anti-mouse Chi3l1 Ab (α-mChi3l1 Ab, …
Figure 7
Schematic summary of the main findings.
Acetaminophen (APAP) overdose induces chitinase 3-like-1 (Chi3l1) expression, which binds CD44 on Mɸs and promotes Mɸs-mediated platelets recruitment through podoplanin/Clec-2 (C-type lectin-like …
Author response image 1
Deletion of Chi3l1- or CD44 does not affect liver recovery after APAP-induced injury.
Male WT, Chil1-/- and Cd44-/- mice were treated with APAP. Serum ALT levels were measured at 6hrs, 24hrs, 48hrs and 72hrs after APAP treatment (n=5-8 mice/group). One-way ANOVA was performed.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | C57BL/6J | Jackson Laboratory, PMID:14759567 | Stock #:000664 MGI Cat# 3849035, RRID:MGI:3849035 | |
| Genetic reagent (Mus musculus) | Cd44-/- mice (also called Cd44tm1Hbg/Cd44tm1Hbg) | Jackson Laboratory | Stock #:005878 MGI Cat# 4941902, RRID:MGI:4941902 | |
| Genetic reagent (Mus musculus) | Chil1-/-mice | PMID:19414556 | MGI #:3846223 RRID:MGI:3846223 | Dr Jack A. Elias (Brown University) |
| Chemical compound, drug | Acetaminophen | Sigma-Aldrich | A7085 | 210 mg/kg for male mice, 325 mg/kg for female mice |
| Peptide, recombinant protein | Recombinant mouse Chi3l1 | Sino Biological | 50929-M08H | 500 ng/mouse in 100 μl PBS |
| Commercial assay or kit | ALT diagnostic assay kit | Teco Diagnostics, | A526-120 | |
| Antibody | Syrian hamster polyclonal IgG Ctrl IgG for anti-podoplanin antibody | Bioxcell InvivoMab | BE0087, RRID:AB_1107782 | 100 μg/mouse |
| Antibody | Syrian hamster monoclonal anti-mouse podoplanin antibody | Bioxcell InvivoMab | BE0236, RRID:AB_2687718 | 100 μg/mouse |
| Antibody | Rat monoclonal Ctrl IgG for anti-mouse CD41 antibody | BD Biosciences | 553922, Clone R334, RRID:AB_479672 | 2 mg/kg |
| Antibody | Rat monoclonal anti-mouse CD41 antibody | BD Biosciences | 553847, Clone MWReg 30, RRID:AB_395084 | 2 mg/kg, 1:200 for IF |
| Peptide, recombinant protein | Recombinant human Chi3l1 | Sino Biological | 11227-H08H | 1 μg/mouse in 100 μl |
| Antibody | Rabbit polyclonal anti-human CD41 | Proteintech | 24552–1-AP, RRID:AB_2879604 | 1:200 for IHC |
| Antibody | Mouse monoclonal anti-human CD68 | Thermo Fisher | MA5-13324, RRID:AB_10987212 | 1:100 for IHC |
| Antibody | Rabbit polyclonal anti-human Chi3l1 | Proteintech | 12036–1-AP, RRID:AB_2877819 | 1:100 for IHC |
| Antibody | Rat monoclonal anti-mouse F4/80, Alexa 647 conjugated | Biolegend | 123122, RRID:AB_893480 | 1:100 for IF |
| Antibody | Rat monoclonal anti-mouse CD44 | abcam | ab112178, clone KM81, RRID:AB_10864553 | 1:200 for IF |
| Antibody | Golden Syrian Hamster monoclonal anti-mouse podoplanin | Novus, biological | NB600-1015, RRID:AB_2161937 | 1:100 for IF |
| Antibody | Rabbit polyclonal anti-mouse Clec-2 | Biorbyt | orb312182, RRID:AB_2891123 | 1:100 for IF |
| Antibody | Donkey anti-rat polyclonal immunoglobulin, Alexa 488-conjugated | Invitrogen | A-21208, RRID:AB_141709 | 1:1000 for IF |
| Antibody | Goat anti-rabbit polyclonal immunoglobulin, Alexa 488-conjugated | Invitrogen | A-11034, RRID:AB_141709 | 1:1000 for IF |
| Antibody | Goat anti-rabbit polyclonal immunoglobulin, Alexa 594-conjugated | Invitrogen | A-11012, RRID:AB_141359 | 1:1000 for IF |
| Antibody | Goat anti-hamster polyclonal immunoglobulin, Alexa 594-conjugated | Invitrogen | A-21113, RRID:AB_2535762 | 1:1000 for IF |
| Antibody | Hoechst | Invitrogen | H3570, RRID:AB_10626776 | 1:10000 for IF |
| Peptide, recombinant protein | TRITC-labeled Albumin | Sigma-Aldrich | A2289-10MG RRID:AB_2891111 | 10 μl/mouse for intravital microscopy |
| Antibody | Rat monoclonal anti-mouse anti-F4/80 antibody, BV421-labeled | Biolegend | 123132, RRID:AB_11203717 | 15 μl/mouse for intravital microscopy |
| Antibody | Rat monoclonal anti-mouse CD41 antibody, DyLight 649-labeled | emfret ANALYTICS | X649, RRID:AB_2861336 | 30 μl/mouse for intravital microscopy |
Table 1
Real-time PCR primers used.
| Gene | Forward (F)/reverse (R) primer | Primer sequences |
|---|---|---|
| Pdpn | F | ACCGTGCCAGTGTTGTTCTG |
| R | AGCACCTGTGGTTGTTATTTTGT | |
| Psgl-1 | F | GAAAGGGCTGATTGTGACCCC |
| R | AGTAGTTCCGCACTGGGTACA | |
| Cd40 | F | TGTCATCTGTGAAAAGGTGGTC |
| R | ACTGGAGCAGCGGTGTTATG | |
| Mcam | F | GTGGCGTTGACATCGTTGG |
| R | CTATGTACTTCGTATGCAGGTCG | |
| Icam-1 | F | GTGATGCTCAGGTATCCATCCA |
| R | CACAGTTCTCAAAGCACAGCG | |
| Fcr | F | AGGGCCTCCATCTGGACTG |
| R | GTGGTTCTGGTAATCATGCTCTG | |
| Lfa1 | F | CCAGACTTTTGCTACTGGGAC |
| R | GCTTGTTCGGCAGTGATAGAG | |
| Vwf | F | CTCTTTGGGGACGACTTCATC |
| R | TCCCGAGAATGGAGAAGGAAC |
Additional files
-
Source data 1
Source data for all numerical bar graph shown in the manuscript including figure supplements.
- https://cdn.elifesciences.org/articles/68571/elife-68571-data1-v2.xlsx
-
Supplementary file 1
Representative list of potential chitinase 3-like-1 (Chi3l1)-interacting proteins detected by mass spectrometry.
Non-parenchymal cells were isolated from C57B/6 mice treated with acetaminophen (APAP) for 3 hr and the cell lysate was incubated with rmChi3l1 overnight. Proteins potentially bound to rmChi3l1 were immune-precipitated with an anti-His antibody and subjected to mass spectrometry analyses.
- https://cdn.elifesciences.org/articles/68571/elife-68571-supp1-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/68571/elife-68571-transrepform-v2.docx
