The oxygen sensor prolyl hydroxylase domain 2 regulates the in vivo suppressive capacity of regulatory T cells
- U-CRI (ULB Center for Research in Immunology), Université Libre de Bruxelles (ULB), Belgium
- Immunobiology Laboratory, Université Libre de Bruxelles (ULB), Belgium
- Institute for Medical Immunology, Université Libre de Bruxelles (ULB), Belgium
- Department of Radiation Oncology, Institut Jules Bordet, Université Libre de Bruxelles, Belgium
- Laboratory of Clinical and Experimental Oncology (LOCE), Institut Jules Bordet, Université Libre de Bruxelles, Belgium
Figures
Figure 1 with 4 supplements
PHD2ΔTreg mice display a spontaneous Th1-like inflammatory syndrome.
(a) Body weight of naive mice was determined weekly. (b) At 12 weeks of age, male and female mice were examined for rectal prolapse. (c) Splenomegaly and colon length summarized in (d). (e) …
-
Figure 1—source data 1
PHD2ΔTreg mice display a spontaneous Th1-like inflammatory syndrome.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Treg-restricted loss of Egln1 gene expression in PHD2ΔTreg mice.
(a) Treg cells from Foxp3cre male and female mice were purified by cell sorting from spleen (n = 10), mesenteric (mLN) (n = 8), peripheral (pLN) lymph nodes (n = 4), or the small intestine lamina …
-
Figure 1—figure supplement 1—source data 1
Treg-restricted loss of Egln1 gene expression in PHD2ΔTreg mice.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Increased blood cells counts and elevated hematocrit in PHD2ΔTreg mice associated with an increase in vascular permeability.
(a) White blood cell (WBC) counts, (b) red blood cell (RBC) counts, (c) platelet (PLT) counts, and (d) hematocrit (HCT) from Foxp3cre, PHD2ΔTreg, and PHD2-HIF2αΔTreg male mouse blood. To assess …
-
Figure 1—figure supplement 2—source data 1
Increased blood cells counts and elevated hematocrit in PHD2ΔTreg mice associated with an increase in vascular permeability.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig1-figsupp2-data1-v2.xlsx
Figure 1—figure supplement 3
Gating strategy for flow cytometry data analysis.
Figure 1—figure supplement 4
Absolute cell counts.
Absolute cell counts of (a) CD4+ T cells, (b) CD8+ T cells, (c) regulatory T cells, and (d) activated conventional T cells in the spleen, mesenteric (mLN), peripheral (pLN) lymph nodes, and the …
-
Figure 1—figure supplement 4—source data 1
Absolute cell counts.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig1-figsupp4-data1-v2.xlsx
Figure 2
Increased number, but altered phenotype of PHD2-deficient Treg cells.
Lymphoid cells from the thymus, spleen, mesenteric (mLN), and peripheral (pLN) lymph nodes were collected at 12 weeks of age from Foxp3cre and PHD2ΔTreg male and female mice, and the relative …
-
Figure 2—source data 1
Increased number, but altered phenotype of PHD2-deficient Treg cells.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig2-data1-v2.xlsx
Figure 3
Cell-autonomous role of PHD2 in determining Treg cells phenotype.
Spleen, thymus, mesenteric (mLN), and peripheral (pLN) lymph nodes were collected at 8 weeks of age from Foxp3cre/+Egln1f/f heterozygous female mice, and the relative frequency and phenotype of …
-
Figure 3—source data 1
Cell-autonomous role of PHD2 in determining Treg cells phenotype.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig3-data1-v2.xlsx
Figure 4
Reduced in vivo but not in vitro suppressive capacity of PHD2-deficient Treg.
(a) Treg function was assayed following adoptive co-transfer of CD45.2 Foxp3-expressing cells with naive, CFSE-labeled congenic CD45.1 CD4+ lymphocytes (Treg: Tconv ratio 1:3) into syngeneic …
-
Figure 4—source data 1
Reduced in vivo but not in vitro suppressive capacity of PHD2-deficient Treg.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig4-data1-v2.xlsx
Figure 5 with 2 supplements
Increased sensitivity of PHD2ΔTreg mice to dextran sodium sulfate (DSS)-induced colitis and toxoplasmosis.
Foxp3cre and PHD2ΔTreg male mice were provided with 2% DSS in tap water for 5 days. On day 5, the 2% DSS water was replaced with normal drinking water and mice were followed during 14 days for (a) …
-
Figure 5—source data 1
Increased sensitivity of PHD2ΔTreg mice to dextran sodium sulfate (DSS)-induced colitis and toxoplasmosis.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
PHD2ΔTreg mice display a near-normal response to anti-CD3-induced enteritis.
Foxp3cre and PHD2ΔTreg female mice were injected twice i.p. with anti-CD3 mAbs (20 µg) at 2 days interval and weighted daily. (a) Weight loss was found similar in both mouse strains tested. (b) …
-
Figure 5—figure supplement 1—source data 1
PHD2ΔTreg mice display a near-normal response to anti-CD3-induced enteritis.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig5-figsupp1-data1-v2.xlsx
Figure 5—figure supplement 2
Loss of Ifng gene expression attenuates the proinflammatory phenotype of PHD2ΔTreg mice.
PHD2ΔTreg mice were crossed with IFN-γKO mice (PHD2ΔTreg IFN-γKO mice) and were compared to Foxp3cre and PHD2ΔTreg male and female mice and analyzed for (a) colon length, (b) frequency of …
-
Figure 5—figure supplement 2—source data 1
Loss of Ifng gene expression attenuates the proinflammatory phenotype of PHD2ΔTreg mice.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig5-figsupp2-data1-v2.xlsx
Figure 6 with 1 supplement
Concomitant loss of HIF2α but not HIF1α expression attenuates the proinflammatory phenotype of PHD2ΔTreg mice.
(a) Representative gross autopsy of spleens and colon length summarized in (b) of Foxp3cre, PHD2ΔTreg, PHD2-HIF1αΔTreg, PHD2-HIF2αΔTreg, and PHD2-HIF1α-HIF2αΔTreg (TKO) mice. (c) Representative …
-
Figure 6—source data 1
Concomitant loss of HIF2α but not HIF1α expression attenuates the proinflammatory phenotype of PHD2ΔTreg mice.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Treg-selective HIF1α or HIF2α deficiency does not affect immune homeostasis in naive mice.
(a) Splenic Treg cells were purified by cell sorting from Foxp3cre (n = 3), PHD2ΔTreg (n = 2), PHD2-HIF1αΔTreg (n = 2), PHD2-HIF2αΔTreg (n = 3), PHD2-HIF1α-HIF2αΔTreg (TKO) (n = 3), HIF1αΔTreg (n = …
-
Figure 6—figure supplement 1—source data 1
Treg-selective HIF1α or HIF2α deficiency does not affect immune homeostasis in naive mice.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig6-figsupp1-data1-v2.xlsx
Figure 7 with 1 supplement
Anti-inflammatory response, response to chemokines, and cell survival pathways represent targets of the PHD2-HIF2α axis in Tregs.
Splenic Treg cells were purified by cell sorting from Foxp3cre (n = 3), PHD2ΔTreg (n = 2), PHD2-HIF1αΔTreg (n = 2), PHD2-HIF2αΔTreg (n = 3), and PHD2-HIF1α-HIF2αΔTreg (TKO) (n = 3) male mice, and …
-
Figure 7—source data 1
Anti-inflammatory response, response to chemokines, and cell survival pathways represent targets of the PHD2-HIF2α axis in Tregs.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Signaling pathways affected by loss of PHD2 expression in Treg.
(a) Top: significantly downregulated pathways in PHD2-deficient Tregs compared to Tregs from Foxp3cre mice. (b) Top: significantly upregulated pathways in PHD2-deficient Tregs compared to Tregs from …
-
Figure 7—figure supplement 1—source data 1
Signaling pathways affected by loss of PHD2 expression in Treg.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig7-figsupp1-data1-v2.xlsx
Figure 8 with 1 supplement
Identification of STAT1-mediated signaling as a target of the PHD2-HIF2α axis in Tregs.
(a) Upregulated and downregulated genes (clusters 10 and 11 in Figure 6c and d) were imported into the Ingenuity Pathway Analysis (IPA) software and were subjected to Upstream Regulator Analysis …
-
Figure 8—source data 1
Identification of STAT1-mediated signaling as a target of the PHD2-HIF2α axis in Tregs.
- https://cdn.elifesciences.org/articles/70555/elife-70555-fig8-data1-v2.xlsx
Figure 8—figure supplement 1
Gating strategy for identification of YFP+ cells.
Representative flow cytometry dot plots displaying the gating strategy for the identification of YFP-positive populations in the (a) spleen, (b) mesenteric lymph node (mLN), (c) thymus, and (d) …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | C57BL/6 | Envigo | RRID:MGI:5658455 | Horst, The Netherlands |
| Genetic reagent (M. musculus) | Egln1f/f | The Jackson Laboratory | RRID:IMSR_NM-CKO-2100497 | P. Carmeliet (VIB-KULeuven) |
| Genetic reagent (M. musculus) | Foxp3-Cre-YFP | PMID:18387831 | RRID:IMSR_JAX:016959 | A. Liston (KULeuven) |
| Genetic reagent (M. musculus) | Hif1af/f (Hif1atm3Rsjo/J) | The Jackson Laboratory | RRID:IMSR_JAX:007561 | F. Bureau (Liege University) |
| Genetic reagent (M. musculus) | Epasf/f (Epas1tm1Mcs/J) | The Jackson Laboratory | RRID:IMSR_JAX:008407 | J.A. Lopez (Madrid University) |
| Genetic reagent (M. musculus) | Ifng-/- | The Jackson Laboratory | RRID:IMSR_CARD:178 | Bar Harbor, ME |
| Genetic reagent (M. musculus) | CD45.1 (B6.SJL-Ptprca Pepcb/BoyJ) | The Jackson Laboratory | RRID:IMSR_JAX:002014 | Bar Harbor, ME |
| Genetic reagent (M. musculus) | Rag2-/- | The Jackson Laboratory | RRID:IMSR_JAX:008449 | Bar Harbor, ME |
| Antibody | Anti-mouse CD278 (Icos)-biotin (C398.4A, mouse monoclonal) | eBioscience | 13-9949-82 | (1:100) |
| Antibody | Anti-mouse CD27-PeCy7 (LG.7F9, mouse monoclonal) | eBioscience | 25-0271-82 | (1:250) |
| Antibody | Anti-mouse Foxp3-FITC (FJK-16s, mouse monoclonal) | eBioscience | 71-5775-40 | (1:100) |
| Antibody | Anti-mouse RORγt-PE (B2D, mouse monoclonal) | eBioscience | 12-6981-82 | (1:100) |
| Antibody | Anti-mouse T-bet-PE (4B10, mouse monoclonal) | eBioscience | 12-5825-82 | (1:100) |
| Antibody | Anti-mouse PD1-PECF594 (J43, mouse monoclonal) | BD Biosciences | 562523;RRID:AB_2737634 | (1:100) |
| Antibody | Anti-mouse CXCR3-APC (CXCR3-173, mouse monoclonal) | BD Biosciences | 562266;RRID:AB_11153500 | (3:500) |
| Antibody | Anti-mouse CD24-PECF594 (M1/69, mouse monoclonal) | BD Biosciences | 562477;RRID:AB_11151917 | (1:100) |
| Antibody | Anti-mouse CD25-BB515 (PC61, mouse monoclonal) | BD Biosciences | 564424;RRID:AB_2738803 | (1:100) |
| Antibody | Anti-mouse CD44-PECy7 (IM7, mouse monoclonal) | BD Biosciences | 560569;RRID:AB_1727484 | (1:100) |
| Antibody | Anti-mouse CD4-A700 (RM4-5, mouse monoclonal) | BD Biosciences | 557956;RRID:AB_396956 | (3:500) |
| Antibody | Anti-mouse CD8-A700 (53-6.7, mouse monoclonal) | BD Biosciences | 557959;RRID:AB_396959 | (3:500) |
| Antibody | Anti-mouse CD4-PB (RM4-5, mouse monoclonal) | BD Biosciences | 558107;RRID:AB_397030 | (1:100) |
| Antibody | Anti-mouse CD62L-A700 (MEL-14, mouse monoclonal) | BD Biosciences | 560517;RRID:AB_1645210 | (1:100) |
| Antibody | Anti-mouse GATA3-PE (L50-823, mouse monoclonal) | BD Biosciences | 560074;RRID:AB_1645330 | (1:10) |
| Antibody | Anti-mouse RORγt-PECF594 (Q31-378, mouse monoclonal) | BD Biosciences | 562684;RRID:AB_2651150 | (1:200) |
| Antibody | Anti-mouse STAT1 (pY701)-A488(4a, mouse monoclonal) | BD Biosciences | 612596;RRID:AB_399879 | (1:10) |
| Antibody | Anti-mouse IFNγ-PE (XMG1.2, mouse monoclonal) | BD Biosciences | 554412;RRID:AB_395376 | (1:100) |
| Antibody | Anti-mouse IL-10-APC (JES5-16E3, mouse monoclonal) | BD Biosciences | 554468;RRID:AB_398558 | (1:100) |
| Antibody | Anti-mouse IL-17-PerCP-Cy5.5 (N49-653, mouse monoclonal) | BD Biosciences | 560799;RRID:AB_2033981 | (1:100) |
| Antibody | Anti-CD3 antibody (2c11, mouse monoclonal) | BioXCell | 145-2c11 | 20 μg/mouse |
| peptide, recombinant protein | Streptavidin-PECy7. | BD Biosciences | 557598;RRID:AB_10049577 | (1:100) |
| peptide, recombinant protein | IFN-γ protein | PeproTech | 315-05 | 50 ng/ml |
| Chemical compound, drug | Evans blue | Sigma | 314-13-6 | 0.5% |
| Chemical compound, drug | Brefeldin-A | eBioscience | 00-4506-51 | (1:1000) |
| Chemical compound, drug | Dextran sodium sulfate, colitis grade (36,000–50,000 Da) | MP Biomedical | 160110 | 2% |
| Commercial assay or kit | LIVE/DEAD kit | Invitrogen | L10119 | (1:1000) |
| Commercial assay or kit | Anti-CD90.2 beads MACS | Miltenyi | 130-121-278 | (1:5) |
| Commercial assay or kit | Anti-CD4 beads MACS | Miltenyi | 130-117-043 | (1:3) |
| Sequence-based reagent | Egln1 (PHD2)_F | This paper | PCR primers | AGGCTATGTCCGTCACGTTG |
| Sequence-based reagent | Egln1 (PHD2)_R | This paper | PCR primers | TACCTCCACTTACCTTGGCG |
| Sequence-based reagent | Egln2 (PHD1)_F | This paper | PCR primers | TCACGTGGACGCAGTAATCC |
| Sequence-based reagent | Egln2 (PHD1)_R | This paper | PCR primers | CGCCATGCACCTTAACATCC |
| Sequence-based reagent | Egln3 (PHD3)_F | This paper | PCR primers | AGGCAATGGTGGCTTGCTAT |
| Sequence-based reagent | Egln3 (PHD3)_R | This paper | PCR primers | GACCCCTCCGTGTAACTTGG |
| Sequence-based reagent | Hif1a_F | This paper | PCR primers | CATCAGTTGCCACTTCCCCA |
| Sequence-based reagent | Hif1a_R | This paper | PCR primers | GGCATCCAGAAGTTTTCTCACAC |
| Sequence-based reagent | Epas1 (HIF2a)_F | This paper | PCR primers | ACGGAGGTCTTCTATGAGTTGGC |
| Sequence-based reagent | Epas1 (HIF2a)_R | This paper | PCR primers | GTTATCCATTTGCTGGTCGGC |
| Sequence-based reagent | Ifng_F | This paper | PCR primers | TGCCAAGTTTGAGGTCAACA |
| Sequence-based reagent | Ifng_R | This paper | PCR primers | GAATCAGCAGCGACTCCTTT |
| Sequence-based reagent | Il12a_F | This paper | PCR primers | CCTCAGTTTGGCCAGGGTC |
| Sequence-based reagent | Il12a_R | This paper | PCR primers | CAGGTTTCGGGACTGGCTAAG |
| Sequence-based reagent | Il10_F | This paper | PCR primers | CCTGGGTGAGAAGCTGAAGA |
| Sequence-based reagent | Il10_R | This paper | PCR primers | GCTCCACTGCCTTGCTCTTA |
| Sequence-based reagent | Il17a_F | This paper | PCR primers | ATCCCTCAAAGCTCAGCGTGTC |
| Sequence-based reagent | Il17a_R | This paper | PCR primers | GGGTCTTCATTGCGGTGGAGAG |
| Sequence-based reagent | Il1b_F | This paper | PCR primers | CAAGCTTCCTTGTGCAAGTG |
| Sequence-based reagent | Il1b_R | This paper | PCR primers | AGGTGGCATTTCACAGTTGA |
| Sequence-based reagent | Il4_F | This paper | PCR primers | ATGCACGGAGATGGATGTG |
| Sequence-based reagent | Il4_R | This paper | PCR primers | AATATGCGAAGCACCTTGGA |
| Sequence-based reagent | Il6_F | This paper | PCR primers | GTTCTCTGGGAAATCGTGGA |
| Sequence-based reagent | Il6_R | This paper | PCR primers | GCAAGTGCATCATCGTTGTT |
| Sequence-based reagent | Rpl32_F | This paper | PCR primers | ACATCGGTTATGGGAGCAAC |
| Sequence-based reagent | Rpl32_R | This paper | PCR primers | TCCAGCTCCTTGACATTGT |
| Sequence-based reagent | Tnfa_F | This paper | PCR primers | GCCTCCCTCTCATCAGTTCTA |
| Sequence-based reagent | Tnfa_R | This paper | PCR primers | GCTACGACGTGGGCTACAG |
| Sequence-based reagent | Il12b_F | This paper | PCR primers | ATGTGTCCTCAGAAGCTAACC |
| Sequence-based reagent | Il12b_R | This paper | PCR primers | CTAGGATCGGACCCTGCAGGGAAC |
| Software, algorithm | Prism 6 | GraphPad | RRID:SCR_002798 | Version 6.0 |
