Control of protein synthesis and memory by GluN3A-NMDA receptors through inhibition of GIT1/mTORC1 assembly
- lnstituto de Neurociencias (UMH-CSIC), Spain
- Centro de Investigación Médica Aplicada (CIMA), University of Navarra, Spain
- Centre for Developmental Neurobiology, Institute of Psychiatry, King’s College London, United Kingdom
- National Eye Institute, National Institutes of Health, United States
- Institute of Science and Technology Austria, Austria
- Institut de Biologie de l’Ecole Normale Supérieure/CNRS/INSERM, France
- Centro de Biología Molecular Severo Ochoa (UAM-CSIC), Spain
- Institut de Neurociències, Universitat Autònoma de Barcelona, Spain
- Institut de Neurociències, Departament de Psicobiologia i de Metodologia de les Ciències de la Salut, Unitat de Neurociència Traslacional, Parc Taulí Hospital Universitari, Institut d’Investigació i Innovació Parc Taulí (I3PT), Universitat Autònoma de Barcelona, Spain
- Centro de Investigación Biomédica en Red de Salud Mental (CIBERSAM), Instituto de Salud Carlos III, Spain
- ICREA, Spain
- Department of Pharmacological and Biomolecular Sciences, University of Milan, Italy
- Department of Pharmacology, Addiction Science, and Toxicology, University of Tennessee Health Science Center, United States
Figures
Figure 1 with 2 supplements
GluN3A inhibits the activity-dependent induction of a subset of immediate-early genes (IEGs).
(A) Timeline of endogenous GluN3A expression and downregulation and of lentiviral infections. Rat cortical neurons in primary culture were infected on days in vitro (DIV) 9 with lentiviruses where …
-
Figure 1—source data 1
Western blots for immediate-early gene (IEG) induction in GFP and GFP-GluN3A-infected neurons after bicuculline treatment.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig1-data1-v2.zip
-
Figure 1—source data 2
Western blots for bicuculline induction of immediate-early genes (IEGs) in GFP and GFP-GluN3A-infected neurons in the presence of MG132.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig1-data2-v2.zip
Figure 1—figure supplement 1
Selective versus global effects of GluN3A expression and general NMDAR blockade on activity-dependent signaling.
(A) Immunoblot (IB) analysis of the time-course of expression of NMDAR subunits and a repertoire of synaptic proteins in cultured cortical neurons. (B) Immunoblot analysis of extracellular …
-
Figure 1—figure supplement 1—source data 1
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig1-figsupp1-data2-v2.zip
-
Figure 1—figure supplement 1—source data 3
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig1-figsupp1-data3-v2.zip
-
Figure 1—figure supplement 1—source data 4
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig1-figsupp1-data4-v2.zip
Figure 1—figure supplement 2
RNAseq analysis of activity-dependent gene expression.
(A) Principal component analysis plot representing all RNAseq samples. (B) Volcano plot from RNAseq analysisof gene expression in untreated days in vitro (DIV) 14 neurons infected with GFP or …
Figure 2 with 1 supplement
GluN3A inhibits the activation of mTORC1 signaling by synaptic stimuli.
(A) Schematic of the mTORC1 signaling pathway. (B) Left, representative western blots of primary rat cortical neurons infected with GFP and GFP-GluN3A (days in vitro [DIV] 9) and treated with …
-
Figure 2—source data 1
Western blots for mTOR and downstream effector phosphorylation in GFP and GFP-GluN3A-infected cortical neurons after bicuculline treatment.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig2-data1-v2.zip
-
Figure 2—source data 2
Western blots for rapamycin dependence of immediate-early gene (IEG) induction in DIV14 cortical neurons by bicuculline treatment.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig2-data2-v2.zip
-
Figure 2—source data 3
Western blots for S6 phosphorylation and Arc induction by bicuculline in GFP and GFP-GluN3A-infected cortical neurons in the presence of caRheb.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig2-data3-v2.zip
Figure 2—figure supplement 1
General inhibition of the activity induction of immediate-early genes (IEGs) by anisomycin.
(A) Immunoblot analysis of the phosphorylation status of the mTOR downstream effector S6 in lysates from days in vitro (DIV) 14 cortical neurons stimulated with bicuculline in the absence (Ctrl) or …
-
Figure 2—figure supplement 1—source data 1
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Annotated western blots and original scan.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig2-figsupp1-data2-v2.zip
Figure 3
GluN3A deletion potentiates synaptic mTORC1 signaling.
(A) Primary rat cortical neurons were infected on days in vitro (DIV) 3 with lentiviruses expressing GFP alone or along with a small hairpin RNA (shRNA) against GluN3A (GFP-sh3A) and collected at …
-
Figure 3—source data 1
Western blots for S6 kinase (S6K) and S6 phosphorylation in control and sh3A-infected days in vitro (DIV) 7 cortical neurons.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig3-data1-v2.zip
-
Figure 3—source data 2
Western blots for Arc and Fos induction by bicuculline and BDNF in control and sh3A-infected days in vitro (DIV) 7 cortical neurons.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig3-data2-v2.zip
-
Figure 3—source data 3
Western blots for S6 kinase (S6K) and S6 phosphorylation in lysates from P8 and P16 wild-type and Grin3a−/− hippocampi.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig3-data3-v2.zip
Figure 4 with 1 supplement
mTORC1 inhibition is mediated by GluN3A C-terminal domain interactions.
(A) Cortical neurons from Grin3a−/− mice were infected on days in vitro (DIV) 6 with lentiviruses expressing GFP, GFP-GluN3A, or GFP-GluN3A1082∆, and stimulated with bicuculline or BDNF at DIV12. (B,…
-
Figure 4—source data 1
Western blots for mechanistic target of rapamycin (mTOR) effector phosphorylation and Arc and Fos induction in GFP, GFP-GluN3A, and GFP-GluN3A1082Δ-infected cortical neurons after bicuculline treatment.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig4-data1-v2.zip
-
Figure 4—source data 2
Western blots for mechanistic target of rapamycin (mTOR) effector phosphorylation and Arc and Fos induction in GFP, GFP-GluN3A, and GFP-GluN3A1082Δ-infected cortical neurons after BDNF treatment.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig4-data2-v2.zip
Figure 4—figure supplement 1
Electrophysiological properties of recombinant NMDA and excitatory glycine receptors containing full-length or truncated GluN3A.
(A) Left, representative steady-state glutamate-evoked ramp currents obtained with 2 mM (black) and 10 mM (red) extracellular Ca2+ for HEK293 cells expressing GluN1A/GluN2A alone, or with either …
Figure 5
GIT1/mechanistic target of rapamycin (mTOR)/Raptor complexes couple synaptic activation to mTORC1-dependent protein synthesis.
(A, B) Protein extracts from P16 mouse hippocampus were solubilized with 0.3 % CHAPS buffer, incubated with antibodies against mTOR or GIT1 (IP), and immunoprecipitated proteins analysed by …
-
Figure 5—source data 1
Coimmunoprecipitation assays of GIT1 with mechanistic target of rapamycin (mTOR), Raptor, and Rictor in P16 mouse hippocampus.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig5-data1-v2.zip
-
Figure 5—source data 2
Coimmunoprecipitation of GIT1 with phosphorylated mechanistic target of rapamycin (mTOR) in Ser2448 in P16 mouse hippocampus.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig5-data2-v2.zip
-
Figure 5—source data 3
Coimmunoprecipitaion of GIT1 and phosphorylated mechanistic target of rapamycin (mTOR) in days in vitro (DIV) 17 hippocampal neurons after bicuculline and BDNF treatment.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig5-data3-v2.zip
-
Figure 5—source data 4
Western blots of mechanistic target of rapamycin (mTOR) effectors and immediate-early gene (IEG) induction by BDNF in the presence or absence of rapamycin in days in vitro (DIV) 14 cortical neurons infected with control or shGIT1-expressing lentiviruses.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig5-data4-v2.zip
-
Figure 5—source data 5
Western blots of puromycin incorporation in days in vitro (DIV) 14 cortical neurons infected with control or shGIT1-expressing lentiviruses.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig5-data5-v2.zip
Figure 6 with 2 supplements
GluN3A/GIT1 interactions control the age-dependent onset of mTORC1-dependent protein synthesis.
(A) Hippocampi from P7, P10, and P16 wild-type mice were lysed, immunoprecipitated with GIT1 antibody and probed for the indicated antibodies. Input: 10 % of the lysate used for immunoprecipitation. …
-
Figure 6—source data 1
Coimmunoprecipitation of GIT1 and mechanistic target of rapamycin (mTOR) in lysates from P7, P10, and P16 mouse hippocampus.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-data1-v2.zip
-
Figure 6—source data 2
Coimmunoprecipitation of GIT1 with mechanistic target of rapamycin (mTOR) and Raptor in hippocampal lysates from P10 wild-type and Grin3a−/− mice.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-data2-v2.zip
-
Figure 6—source data 3
Coimmunoprecipitation of GIT1 with mechanistic target of rapamycin (mTOR) in Grin3a−/− cortical neurons infected with GFP, GFP-GluN3A, and GFP-GluN3A1082Δ lentiviruses.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-data3-v2.zip
-
Figure 6—source data 4
Western blots of puromycin incorporation in neurons infected with control or sh3A-expressing lentiviruses.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-data4-v2.zip
-
Figure 6—source data 5
Western blots of puromycin incorporation in the presence or absence of rapamycin in Grin3a−/− cortical neurons infected with GFP, GFP-GluN3A, and GFP-GluN3A1082Δ.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-data5-v2.zip
Figure 6—figure supplement 1
Postnatal regulation of GIT1/mTORC1 complexes in mouse somatosensory cortex.
Somatosensory cortices from P7, P10, and P16 wild-type mice were lysed, immunoprecipitated with GIT1 antibody and probed for the indicated antibodies. Input: 10 % of the lysate used for …
-
Figure 6—figure supplement 1—source data 1
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-figsupp1-data1-v2.zip
Figure 6—figure supplement 2
Age-dependent emergence of mTORC1-dependent protein synthesis in cultured rat cortical neurons.
Representative blots and quantification of puromycin incorporation in the presence or absence of 100 nM rapamycin in wild-type days in vitro (DIV) 7 and DIV14 neurons. Puromycin levels were …
-
Figure 6—figure supplement 2—source data 1
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig6-figsupp2-data1-v2.zip
Figure 7 with 2 supplements
GluN3A deletion facilitates spatial and associative learning.
(A) Escape latencies of male wild-type (WT) and Grin3a−/− mice on a weak version of the Morris water maze (two trials per day) during 7-day training and after platform reversal on day 8. (B) Probe …
Figure 7—figure supplement 1
Behavior of male and female Grin3a−/− mice in the Morris water maze.
(A) Escape latencies of male wild-type (WT) and Grin3a−/− mice over the time-course of training on a standard hidden platform version of the Morris water maze (7 days, four trials per day). (B) …
Figure 7—figure supplement 2
Controls for conditioned taste aversion (CTA) experiments.
(A) Double transgenic GluN3A (dtGluN3A) and wild-type (WT) mice showed similar ‘lying on belly’ latencies after a 0.15 M LiCl injection (n = 4–5 mice per group; unpaired two-tailed t-test, ***p < …
Figure 8 with 1 supplement
GluN3A deletion from excitatory neurons in adult mice is sufficient for memory enhancement.
(A) Contextual fear conditioning test. (B) Enhanced contextual fear conditioning in Grin3a−/− mice 24 hr but not 1 hr after training (n = 9–13 mice per group; left: repeated measures two-way …
Figure 8—figure supplement 1
Expression of GluN3A and other synaptic proteins in conditional Grin3a knockout mice.
(A) Top, tamoxifen (TMX) administration regime to Grin3af/f × CamK2a-CreERT2 mice. Hippocampal lysates of P90 mice were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis …
-
Figure 8—figure supplement 1—source data 1
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig8-figsupp1-data1-v2.zip
-
Figure 8—figure supplement 1—source data 2
Annotated western blots and original scans.
- https://cdn.elifesciences.org/articles/71575/elife-71575-fig8-figsupp1-data2-v2.zip
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | GIT-1 (mouse monoclonal, clone A-1) | Santa Cruz Biotechnology | Cat# sc-365084; RRID: AB_10850059 | PLA 1:150 |
| Antibody | Arc (mouse monoclonal, clone C-7) | Santa Cruz Biotechnology | Cat# sc-17839; RRID: AB_626696 | WB 1:100 |
| Antibody | beta-Tubulin III (mouse monoclonal) | Sigma-Aldrich | Cat# T8660; RRID: AB_477590 | WB 1:20,000 |
| Antibody | NMDAR1, all splice variants (mouse monoclonal, clone R1JHL) | Millipore | Cat# MAB1586; RRID: AB_11213180 | WB 1:1000 |
| Antibody | NR2B (mouse monoclonal, clone BWJHL) | Millipore | Cat# 05–920; RRID: AB_417391 | WB 1:1000 |
| Antibody | NR3A (mouse monoclonal) | Kindly provided by Jim Trimmer | N/A | WB 1:100 |
| Antibody | PSD-95 (mouse monoclonal, clone K28/43) | Antibodies Incorporated | Cat# 75–028RRID: AB_10698024 | WB 1:1000 |
| Antibody | Puromycin (mouse monoclonal, clone 12D10) | Millipore | Cat# MABE343; RRID: AB_2566826 | WB 1:2000 |
| Antibody | Synapsin I (mouse monoclonal, clone 46.1) | Synaptic Systems | Cat# 106 011RRID: AB_2619772 | WB 1:5000 |
| Antibody | Synaptophysin (mouse monoclonal, clone SY38) | Millipore | Cat# MAB5258-20UG; RRID: AB_11214133 | WB 1:2000 |
| Antibody | CREB (rabbit monoclonal, clone 48H2) | Cell Signaling Technology | Cat# 9197; RRID: AB_331277 | WB 1:1000 |
| Antibody | NR2A (rabbit monoclonal, clone A12W) | Millipore | Cat# 05–901 R; RRID: AB_10805961 | WB 1:1000 |
| Antibody | Phospho-CamKinase II alpha (CaMKIIα) Thr286 (rabbit monoclonal, clone D21E4) | Cell Signaling Technology | Cat# 12716; RRID: AB_2713889 | WB 1:1000 |
| Antibody | Phospho-p70 S6 kinase Thr389 (rabbit monoclonal, clone 108D2) | Cell Signaling Technology | Cat# 9234; RRID: AB_2269803 | WB 1:1000 |
| Antibody | Raptor (rabbit monoclonal, clone 24C12) | Cell Signaling Technology | Cat# 2280; RRID: AB_561245 | WB 1:1000 |
| Antibody | Rheb (rabbit monoclonal, clone E1G1R) | Cell Signaling Technology | Cat# 13879; RRID: AB_2721022 | WB 1:1000 |
| Antibody | Rictor (rabbit monoclonal, clone 53A2) | Cell Signaling Technology | Cat# 2114; RRID: AB_2179963 | WB 1:500 |
| Antibody | S6 ribosomal protein (rabbit monoclonal, clone 5G10) | Cell Signaling Technology | Cat# 2217; RRID: AB_331355 | WB 1:1000 |
| Antibody | GIT1 (rabbit polyclonal) | Cell Signaling Technology | Cat# 2919; RRID: AB_2109982 | IP 1:200, WB 1:1000 |
| Antibody | Egr-1/Zif268 (rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc-110; RRID: AB_2097174 | WB 1:500 |
| Antibody | beta-Pix, SH3 domain (rabbit polyclonal) | Millipore | Cat# 07–1450; RRID: AB_1586904 | WB 1:1000 |
| Antibody | c-Fos (rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc-52; RRID: AB_2106783 | WB 1:500 |
| Antibody | CaMKIIα (rabbit polyclonal) | Sigma-Aldrich | Cat# C6974; RRID: AB_258984 | WB 1:1000 |
| Antibody | mTOR (rabbit polyclonal) | Cell Signaling Technology | Cat# 2972; RRID: AB_330978 | IP 1:100, PLA 1:150, WB 1:1000 |
| Antibody | NMDAR2A&B, pan antibody (rabbit polyclonal) | Millipore | Cat# AB1548; RRID: AB_11212156 | WB 1:1000 |
| Antibody | NR3A (rabbit polyclonal) | Millipore | Cat# 07–356; RRID: AB_2112620 | WB 1:1000 |
| Antibody | p30alpha (rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc-535; RRID: AB_632138 | WB 1:1000 |
| Antibody | p44/42 MAPK (Erk1/2) (rabbit polyclonal) | Cell Signaling Technology | Cat# 9102; RRID: AB_330744 | WB 1:1000 |
| Antibody | p70 S6 kinase (rabbit polyclonal) | Cell Signaling Technology | Cat# 9202; RRID: AB_331676 | WB 1:1000 |
| Antibody | Phospho-CREB Ser133 (rabbit polyclonal) | Millipore | Cat# 06–519; RRID: AB_310153 | WB 1:1000 |
| Antibody | Phospho-mTOR Ser2448 (rabbit polyclonal) | Cell Signaling Technology | Cat# 2971; RRID: AB_330970 | WB 1:1000 |
| Antibody | Phospho-p38 MAPK Thr180/Tyr182 (rabbit polyclonal) | Cell Signaling Technology | Cat# 9911; RRID: AB_10695905 | WB 1:1000 |
| Antibody | Phospho-p44/42 MAPK (Erk1/2) Thr202/Tyr204 (rabbit polyclonal) | Cell Signaling Technology | Cat# 9101; RRID: AB_331646 | WB 1:1000 |
| Antibody | Phospho-S6 ribosomal protein Ser240/244 (rabbit polyclonal) | Cell Signaling Technology | Cat# 2215; RRID: AB_331682 | WB 1:1000 |
| Cell line (Homo sapiens) | HEK293 | ATCC | Cat# CRL-1573; RRID: CVCL_0045 | |
| Chemical compound, drug | (−)-Bicuculline methiodide | Abcam | Cat# Ab120108; CAS: 55950-07-7 | |
| Chemical compound, drug | (D,L)-APV sodium salt | Tocris | Cat# 3693; CAS: 1303993-72-7 | |
| Chemical compound, drug | Anisomycin | Sigma-Aldrich | Cat# A5892; CAS: 22862-76-6 | |
| Chemical compound, drug | B27 supplement | Thermo Fisher Scientific | Cat# 17504044 | |
| Chemical compound, drug | BDNF | PeproTech | Cat# 450-02; AN: P23560 | |
| Chemical compound, drug | CGP-78608 | Tocris | Cat# 1493; CAS: 1135278-54-4 | |
| Chemical compound, drug | cOmplete Protease Inhibitor Cocktail | Sigma-Aldrich | Cat# 04693116001 | |
| Chemical compound, drug | Cycloheximide | Sigma-Aldrich | Cat# C7698; CAS: 66-81-9 | |
| Chemical compound, drug | MK-801 | Tocris | Cat# 0924; CAS: 77086-22-7 | |
| Chemical compound, drug | Puromycin dihydrochloride | Sigma-Aldrich | Cat# P8833; CAS: 58-58-2 | |
| Chemical compound, drug | Rapamycin | Alfa Aesar | Cat# J62473; CAS: 53123-88-9 | |
| Chemical compound, drug | Tamoxifen | Sigma-Aldrich | Cat# T5648 | |
| Chemical compound, drug | Tetrodotoxin citrate | Alomone Labs | Cat# T-550; CAS: 18660-81-6 | |
| Commercial assay, kit | Duolink In Situ Red Starter Kit Mouse/Rabbit | Sigma-Aldrich | Cat# DUO92101 | |
| Commercial assay, kit | MasterMix qPCR ROx PyroTaq EvaGreen | cmb | Cat# 87H24 | |
| Commercial assay, kit | Nucleospin RNA | Macherey-Nagel | Cat# 740955.50 | |
| Commercial assay, kit | Pierce BCA Protein Assay kit | Thermo Fisher Scientific | Cat# 23,227 | |
| Commercial assay, kit | SuperScript IV First-Strand cDNA Synthesis System | Invitrogen | Cat# 18-091-050 | |
| Genetic reagent (Mus musculus) | Mouse: B6;129 × 1-Grin3atm1Nnk/J | The Jackson Laboratory | Cat# JAX:029974; RRID: IMSR_JAX:029974 | |
| Genetic reagent (Mus musculus) | Mouse: CaMKIIα-CreERT2+/- | Erdmann et al., 2007 | ||
| Genetic reagent (Mus musculus) | Mouse: Grin3atm1a(EUCOMM)Hmgu/H | EUCOMM | | |
| Genetic reagent (Mus musculus) | Mouse: Sst-IRES-Cre | The Jackson Laboratory | Stock: 018973 | |
| Genetic reagent (virus) | LV-hSYN-WPRE-hSYN-GFP-WPRE | Gascón et al., 2008 | ||
| Genetic reagent (virus) | LV-hSYN-GluN3A-WPRE-hSYN-GFP-WPRE | This paper | See Materials and methods; generated/stored in Perez-Otano’s lab. | |
| Genetic reagent (virus) | LV-hSYN-GluN3A1082Δ-WPRE-hSYN-GFP-WPRE | This paper | See Materials and methods; generated/stored in Perez-Otano’s lab. | |
| Genetic reagent (virus) | pLentiLox3.7-GFP (pLL3.7-GFP) | Kindly provided by Dr. Michael Ehlers | Addgene plasmid #11795; RRID: Addgene_11795 | |
| Genetic reagent (virus) | pLL3.7-shGluN3A1185-GFP (Target sequence: CTACAGCTGAGTTTAGAAA) | Yuan et al., 2013 | ||
| Genetic reagent (virus) | pLL3.7-shGIT1-GFP (Target sequence: TGATCACAAGAATGGGCATTA) | This paper | See Materials and methods; generated/stored in Perez-Otano’s lab. | |
| Recombinant DNA reagent (plasmid) | pcDNA1-Amp-GluN1-1A | Perez-Otano et al., 2001 | ||
| Recombinant DNA reagent (plasmid) | pcDNA1-Amp-GluN2A | Perez-Otano et al., 2001 | ||
| Recombinant DNA reagent (plasmid) | pCIneo-GFPGluN3A | Perez-Otano et al., 2001 | ||
| Recombinant DNA reagent (plasmid) | pCIneo-GFPGluN3A1082Δ | This paper | See Materials and methods; generated/stored in Perez-Otano’s lab. | |
| Recombinant DNA reagent (plasmid) | pRK5-GFP | Kindly provided by Dr. Michael Ehlers | ||
| Sequence-based reagent (oligonucleotide) | Arc_fwd (mouse) | This paper | GAGCCTACAGAGCCAGGAGA | |
| Sequence-based reagent (oligonucleotide) | Arc_rv (mouse) | This paper | TGCCTTGAAAGTGTCTTGGA | |
| Sequence-based reagent (oligonucleotide) | c-Fos_fwd (mouse/rat) | Chen et al., 2020 | CTGCTCTACTTTGCCCCTTCT | |
| Sequence-based reagent (oligonucleotide) | c-Fos_rv (mouse/rat) | Chen et al., 2020; | TTTATCCCCACGGTGACAGC | |
| Sequence-based reagent (oligonucleotide) | GAPDH_fwd (mouse/rat) | This paper | CATGGCCTTCCGTGTTCCT | |
| Sequence-based reagent (oligonucleotide) | GAPDH_rv (mouse/ rat) | This paper | TGATGTCATCATACTTGGCAGGTT | |
| Software, algorithm | ImageJ | Schneider, Rasband and Eliceiri, 2012 | https://imagej.nih.gov/ij/ | |
| Software, algorithm | ImageQuant software version 5.2 | GE Healthcare | ||
| Software, algorithm | Prism software version 7.00 | Graphpad | ||
| Software, algorithm | QuantStudio 3 Design and Analysis software v1.5.1 | Thermo Fisher Scientific | ||
| Software, algorithm | SMART software for video-tracking | PanLab S.L. |
