ACE2 pathway regulates thermogenesis and energy metabolism
- Beijing Key Laboratory of Diabetes Research and Care, Department of Endocrinology, Beijing Diabetes Institute, Beijing Tongren Hospital, Capital Medical University, China
- Department of Physiology, UT Southwestern Medical Center at Dallas, United States
- Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, and State Key Laboratory of Brain and Cognitive Sciences, Institute of Biophysics, Chinese Academy of Sciences, China
- Center for Research on Genomics and Global Health, National Human Genome Research Institute, National Institutes of Health, United States
- State Key Laboratory of Pharmaceutical Biotechnology, Department of Medicine, University of Hong Kong, China
Figures
Figure 1
ACE2 pathway is activated by cold exposure.
Eight-week-old male C57BL/6 J mice were housed at room temperature (RT) for 2 weeks before cold exposure at 4 °C for various time periods as indicated. (A) Levels of ACE2 and Mas1 protein from …
Figure 2 with 1 supplement
Ace2 deficiency impairs thermogenesis, BAT activity, and energy metabolism.
Eight-week-old male Ace2-/y mice and their wild-type (WT) mice (controls) had a high-fat diet (HFD) for 8 weeks. (A) Body weight of Ace2-/y and WT mice fed a HFD for 8 weeks (n = 4–5/each group). (B)…
Figure 2—figure supplement 1
Ace2 deficiency impairs adaptative thermogenesis by cold stimulation.
Eight-week-old male Ace2-/y mice and their WT (control) mice had an HFD for 8 weeks (Ace2-/y vs WT). (A–C) Intraperitoneal glucose tolerance test (IPGTT), serum triglyceride and cholesterol levels …
Figure 3 with 1 supplement
ACE2 enhances thermogenesis, BAT activity, and energy metabolism in Leprdb/db obese mice.
Ace2 over-expression adenovirus (Ad-Ace2) and Ad-GFP (control) were introduced into the Leprdb/db obese mice by tail vein injection. The ad-Ace2 and Ad-GFP treated Leprdb/db mice were used at the 6th…
Figure 3—figure supplement 1
ACE2 enhance BAT activity and whole-body energy metabolism in Leprdb/db mice.
The ad-Ace2 and Ad-GFP-treated Leprdb/db mice were used at the 6th day post-virus injection (Leprdb/db+ Ace2 vs Leprdb/db+ GFP). (A) Ace2 overexpression was verified in BAT of Ad-Ace2-treated Leprdb/…
Figure 4 with 1 supplement
Ang-(1-7) promotes thermogenesis, BAT activity, and energy metabolism in the Leprdb/db and the HFD-induced obese mice.
Ang-(1-7) administration by subcutaneous implanted micro-osmotic pumps in the Leprdb/db obese mice and the high-fat diet (HFD)-induced obese mice were used. The Leprdb/db mice were treated with …
Figure 4—figure supplement 1
Ang-(1-7) promoted thermogenesis and energetic metabolism in BAT of Leprdb/db mice during cold challenge.
Leprdb/db mice were treated with Ang-(1-7) by subcutaneous infusion of Ang-(1-7) or saline using osmotic mini-pumps for 4 weeks (Leprdb/db+ Ang-(1-7) vs Leprdb/db+ Vehicle). (A) Serum levels of …
Figure 5 with 1 supplement
Ablation of Mas1 impairs thermogenesis, BAT activity, and energetic metabolism.
(A–I) Eight-week-old male Mas1-/- mice and their WT (control) mice had a high-fat diet (HFD) for 8 weeks (Mas1-/- vs WT). (J–O) BAT of C57B/L6 recipient mice was removed from the interscapular …
Figure 5—figure supplement 1
Ablation of Mas1 impairs thermogenesis, BAT activity, and energetic metabolism.
(A–C) Eight-week-old male Mas1-/- mice and their WT (control) mice had a high-fat diet (HFD) for 8 weeks (Mas1-/- vs WT). (D–F) BAT of C57B/L6 recipient mice was removed from the interscapular …
Figure 6
ACE2 pathway induced white adipose tissue browning in the Leprdb/db obese mice.
(A) Representative H&E staining from subcutaneous white adipose tissue (scWAT) sections of Leprdb/db+ Ace2 and Leprdb/db+ GFP mice exposure at 4 °C (n = 6–7/each group). (B) Relative mRNA levels of …
Figure 7 with 2 supplements
ACE2 pathway induces a thermogenesis program through the Akt signaling and the PKA signaling.
Primary brown adipocytes were isolated, cultured, and treated with Ang-(1-7) (10–6 M) for 24 hr, Akt inhibitor MK2206 (20 μM) for 24 hr, PKA inhibitor H89 (30 μM) for 24 hr, or adenylylcyclase …
Figure 7—figure supplement 1
RNA-Seq analysis of primary brown adipocytes from Ace2-/y and WT mice.
(A) 3D-PCA analysis represent the deviation of 4 replication within Ace2-/y (Ace2 1–4) and WT mice (WT_BS 1–4). (B) Heat map representation of the differentially expressed genes in Ace2-/y and WT …
Figure 7—figure supplement 2
Ang-(1-7) regulates thermogenesis through Akt and PKA signaling in BAT.
Primary brown adipocytes were isolated, cultured, infected with Ace2 adenovirus, treated with Ang-(1-7) (10–6 M) for 24 hr, Akt inhibitor MK2206 (20 μM) for 24 hr, PKA inhibitor H89 (30μ M) for 24 …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | WT C57BL/6 J | GemPharmatech. Co., Ltd | JAX 000664 RRID: IMSR_JAX:000664 | |
| Genetic reagent (Mus musculus) | BKS-db (Leprdb/db) | GemPharmatech. Co., Ltd | ||
| Genetic reagent (Mus musculus) | Ace2 KO | Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences | ||
| Genetic reagent (Mus musculus) | Mas1 KO | GemPharmatech. Co., Ltd | ||
| Transfected construct (Mus musculus) | Ad-Ace2-eGFP | SinoGenoMax | ||
| Chemical compound, drug | Ang-(1-7) | MCE | 51833-78-4 | |
| Chemical compound, drug | A779 | Selleck | 159432-28-7 | |
| Chemical compound, drug | FCCP | Sigma-Aldrich | C2920 | |
| Chemical compound, drug | Oligomycin A | Sigma-Aldrich | 75351–5 MG | |
| Chemical compound, drug | Rotenone | Sigma-Aldrich | R8875-1G | |
| Chemical compound, drug | MK2206 | Selleck | 1032350-13-2 | |
| Chemical compound, drug | H89 | Selleck | 130964-39-5 | |
| Chemical compound, drug | SQ-22536 | Selleck | 17318-31-9 | |
| Other | Chow, 60% HFD | Research Diets | D12492 | |
| Antibody | Anti-UCP1(rabbit polyclonal) | Abcam | #10983 RRID: AB_2241462 | (1:1000) |
| Antibody | Anti-PGC1ɑ(rabbit polyclonal) | Abcam | #54,481RRID: AB_881987 | (1:1000) |
| Antibody | Anti-OXPHOS | Abcam | #110413 RRID: AB_2629281 | (1:1000) |
| Antibody | Anti-Mas1(rabbit polyclonal) | Alomone | #AAR-013 RRID: AB_2039972 | (1:1000) |
| Antibody | Anti-Akt(rabbit polyclonal) | Cell signaling | #9272 RRID: AB_329827 | (1:1000) |
| Antibody | Anti-p-Akt308 (rabbit monoclonal) | Cell signaling | #13038 RRID: AB_2629447 | (1:1000) |
| Antibody | Anti-PKA(rabbit polyclonal) | Cell signaling | #4782 RRID: AB_2170170 | (1:1000) |
| Antibody | Anti-p-PKA(rabbit polyclonal) | Cell signaling | #9,621RRID: AB_330304 | (1:1000) |
| Antibody | Anti-ACE2(rabbit monoclonal) | Cell signaling | #92,485 | (1:1000) |
| Antibody | Actin(rabbit monoclonal) | Cell signaling | #4,970RRID: AB_2223172 | (1:1000) |
| Sequence-based reagent | Cidea_F | Invitrogen | RT-qPCR primer | TCCTATGCTGCACAGATGACG |
| Sequence-based reagent | Cidea_R | This paper | RT-qPCR primer | TGCTCTTCTGTATCGCCCAGT |
| Sequence-based reagent | Ppargc1a_F | This paper | RT-qPCR primer | GCACCAGAAAACAGCTCCAAG |
| Sequence-based reagent | Ppargc1a_R | This paper | RT-qPCR primer | CGTCAAACACAGCTTGACAGC |
| Sequence-based reagent | Ucp1_F | This paper | RT-qPCR primer | TCTCAGCCGGCTTAATGACTG |
| Sequence-based reagent | Ucp1_R | This paper | RT-qPCR primer | GGCTTGCATTCTGACCTTCAC |
| Sequence-based reagent | Prdm16_F | This paper | RT-qPCR primer | ACACGCCAGTTCTCCAACCTGT |
| Sequence-based reagent | Prdm16_R | This paper | RT-qPCR primer | TGCTTGTTGAGGGAGGAGGTA |
| Software, algorithm | GraphPad Prism Software | GraphPad Software,La Jolla, CA, USA | Version 8.0.0 for WindowsRRID: SCR_002798 | |
| Software, algorithm | ANCOVA | PMID:30017358 | https://calrapp.org/ |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/72266/elife-72266-transrepform1-v3.docx
-
Source data 1
An Excel sheet with numerical quantification data.
- https://cdn.elifesciences.org/articles/72266/elife-72266-supp1-v3.zip
