Environmental enrichment enhances patterning and remodeling of synaptic nanoarchitecture as revealed by STED nanoscopy
- Optical Nanoscopy in Neuroscience, Center for Nanoscale Microscopy and Molecular Physiology of the Brain, University Medical Center Göttingen, Germany
- Max Planck Institute for Multidisciplinary Sciences, City Campus, Germany
- Department of NanoBiophotonics, Max Planck Institute for Multidisciplinary Sciences, Germany
- Department of Optical Nanoscopy, Institut für Nanophotonik Göttingen e.V., Germany
- Cluster of Excellence "Multiscale Bioimaging: from Molecular Machines to Networks of Excitable Cells" (MBExC), University of Göttingen, Germany
- Max Planck Institute for Dynamics and Self-Organization, Germany
- Göttingen Campus Institute for Dynamics of Biological Networks, Germany
Figures
Figure 1 with 1 supplement
Virtually crosstalk-free two-color in vivo stimulated emission depletion (STED) microscopy.
(A) Custom-designed in vivo STED microscope with pulsed 483 nm (Exc1) and 520 nm (Exc2) excitation and 595 nm STED laser. APD: avalanche photon detector, BP: bandpass filter, Det: detection, DM: …
Figure 1—figure supplement 1
Resolving capability of the custom-built two-color in vivo stimulated emission depletion (STED) microscope.
(A) In vivo measurement of PSD95.FingR-Citrine. Fields of view (FOV) represent a selection of magnified PSD95 assemblies (green) from different STED image stacks. The resolving power was determined …
Figure 2 with 2 supplements
Size distributions of spine head and PSD95 area are sharper and show larger heads for mice housed in environmentally enriched (EE) than in standard (control [Ctr]) cages.
(A) Stimulated emission depletion (STED) images of dendritic spines (magenta) and associated PSD95 assemblies (green). Images are smoothed; maximum intensity projection (MIP) (left), contrast …
-
Figure 2—source data 1
Spine head and PSD95 assembly sizes.
- https://cdn.elifesciences.org/articles/73603/elife-73603-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Housing conditions for enriched environment (EE) and control (Ctr) mice.
(A–C) Standardized environmental enrichment cage design in the commercially available Marlau cage; dimension: 570 × 370 × 320 mm3, 2 floors connected by a ladder and a tube. The cage contains three …
Figure 2—figure supplement 2
Correlation between PSD95 area and brightness; spine density.
(A) Analysis of PSD95 brightness. Correlation of all environmental enrichment (EE) and control (Ctr) PSD95 areas in µm2 and corresponding PSD95 brightness in arbitrary units (a.u.). The red dashed …
Figure 3 with 1 supplement
Temporal changes of spine head and PSD95 area are weakly positively correlated with a larger variability for control (Ctr) than environmental enrichment (EE) housed mice.
(A, B) Representative sections of spine heads and corresponding PSD95 of time-lapse in vivo two-color stimulated emission depletion (STED) microscopy images for EE (A) and Ctr (B) housed mice at …
-
Figure 3—source data 1
Spine head and PSD95 assembly sizes for each time point.
- https://cdn.elifesciences.org/articles/73603/elife-73603-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Temporal changes in spine head and PSD95 area over time course.
(A–C) Scatter plot of percentage changes over time intervals of 30, 60, and 120 min. Regression lines are dashed and Pearson’s correlation coefficient r is displayed (deviation from zero: p < …
Figure 4 with 1 supplement
Environmental enrichment (EE) housed mice show an increase in multiplicative downscaling of PSD95 area over control (Ctr).
(A–F) Spine head and PSD95 area after different time intervals Δt of 30, 60, and 120 min as function of their initial area at time t (A, B, D, E). Solid lines show linear regression fits of the …
Figure 4—figure supplement 1
Size changes of environmental enrichment (EE) and control (Ctr) housed mice.
(A–D) Changes in area after time intervals Δt of 30, 60, and 120 min plotted as a function of their area at time point t for spine head area of Ctr housed mice (A), spine head area of EE housed mice …
Figure 5
PSD95 nanopattern is different between environmental enrichment (EE) and control (Ctr) and changes faster for EE housed mice.
(A) Sections of two-color stimulated emission depletion (STED) images (smoothed, maximum intensity projection [MIP]) of EE and Ctr housed mice at the indicated time points showing the spine membrane …
-
Figure 5—source data 1
Images of all analyzed perforated PSD95 assemblies.
- https://cdn.elifesciences.org/articles/73603/elife-73603-fig5-data1-v2.pdf
Author response image 1
Double labelling of PSD95 with two different intrabodies, PSD95.Fing and PF11.
PF11 recognizes palmitoylated PSD95 (Fukata et al., 2013) and was cloned with the hSyn promoter and the orthogonal transcriptional regulation IL2RGTC (Gross et al., 2013) in the same pAAV backbone …
Author response image 2
Side-by-side comparison of two different labelling schemata of PSD95 imaged by in vivo STED microscopy.
(A) Selection of PSD95 assemblies showing a nanopattern of PSD95-EGFP knock-in mouse as published in the supplementary material of (Wegner et al., 2018). (B) PSD95.FingR-Citrine (green) and membrane …
Author response image 3
Transcriptional regulation of PSD95.FingR.
(A) PSD95.FingR expression is controlled by a negative feedback regulation so that once endogenous PSD95 binding sites are saturated, unbound PSD95.FingR moves to the nucleus due to a nuclear …
Author response image 4
PSD95 assembly size from in vivo STED measurements in layer 1 mouse visual cortex for different cell types.
(A) Size/length measurement of ubiquitous PSD95 assemblies of a PSD95-EGFP knock-in mouse as published in Wegner et al., 2018. (B) Average of length and width of PSD95 assemblies of layer 5 …
Author response image 5
Slope of the linear regression as shown in the manuscript Fig.4C, F for pooled data and first time interval only.
The pooled data includes 0–30 min and 30–60 min data for Δt = 30 min. Δt = 60 min includes 0–60 min and 60–120 min of the hourly measurement interval and 0–60 min of the half hour measurement …
Tables
Table 1
Overview of the primers and endonucleases.
a: produced by PCR, b: generated by hybridization, P: phosphorylated; underlined nucleotides: restriction sites or part of them.
| Target construct | Primer | Restriction sites | DNA-insert |
|---|---|---|---|
| pAAV-hSyn-DIO-myrEGFP-LDLR(Ct) | 5´- agttatgctagcatgggctgtgtgcaatgtaaggataaag aagcaacaaaactgacgatggtgagcaagggcgaggag –3´ | NheI | Myristol (myr)-EGFPa |
| 5´- cgcaccggtcttgtacagctcgtccatg-3´ | AgeI | ||
| P-5´-ccggtcggaactggcgcctgaagaatatcaacagc atcaatttcgataaccccgtgtaccagaagaccacagaggat –3´ | AgeI | LDLR(Ct)-part1b | |
| P-5´-cagctcatcctctgtggtcttctggtacacggggttatcgaaa ttgatgctgttgatattcttcaggcgccagttccga –3´ | AgeI | LDLR(Ct)-part1b | |
| P-5´-gagctgcacatttgcaggtcccaagacgggtacacctatcc aagtcggcagatggtcagcctcgaggacgatgtggcctgagg –3´ | AscI | LDLR(Ct)-part2b | |
| P-5´- cgcgcctcaggccacatcgtcctcgaggctgaccatctgcc gacttggataggtgtacccgtcttgggacctgcaaatgtg –3´ | AscI | LDLR(Ct)-part2b |
