Reversing chemorefraction in colorectal cancer cells by controlling mucin secretion
- Renal Physiopathology Group, Vall d’Hebron Research Institute (VHIR), Spain
- Cancer Research Program, Institut Mar d'Investigacions Mèdiques, CIBERONC Hospital del Mar, Spain
- Department of Pathology, Institut Mar d'Investigacions Mèdiques, Universitat Autònoma de Barcelona, CIBERONC, Spain
- Centre for Genomic Regulation (CRG), The Barcelona Institute for Science and Technology, Spain
- Institució Catalana de Recerca i Estudis Avançats (ICREA), Spain
Figures
Figure 1 with 1 supplement
Mucins in colorectal cancer.
(A) Cell lysates from differentiated HT29-M6 cells treated with 5-fluorouracil + irinotecan (5-FU + iri.) (50 µg/mL 5-FU + 20 µg/mL iri.) for 24 hr were analysed by Western blot with an anti-MUC5AC …
-
Figure 1—source data 1
Uncropped gels for Figure 1.
- https://cdn.elifesciences.org/articles/73926/elife-73926-fig1-data1-v2.zip
Figure 1—figure supplement 1
Experimental design for measuring mucin production after treatment.
(A) Schematic diagram of the experimental set-up to measure mucin production after 5-fluorouracil + irinotecan (5-FU + iri.) treatment.
Figure 2 with 1 supplement
KChIP3 is a prognostic marker of colorectal cancer (CRC).
(A–C) Disease-free survival (DFS) according to KChIP3 levels of CRC patients (low KChIP3 levels, n = 120; high KChIP3 levels, n = 106) (A), CRC patients with high MUC5AC levels (low KChIP3 levels, n …
Figure 2—figure supplement 1
Expression of mucins in patients.
(A) Expression levels of secreted mucins MUC2, MUC5AC, MUC5B, MUC6, MUC7, and MUC19. Each dot represents a different patient. Patients GSM358532, GSM358535, and GSM358538 are highlighted in green, …
Figure 3
Inhibition of sodium/calcium exchangers (NCXs) enhances cell death by 5-fluorouracil + irinotecan (5-FU+ iri.).
(A) Comet assay of HT29-M6 cell line treated with 5-FU + iri. (25 µg/mL 5-FU + 10 µg/mL irinotecan) and 20 µM benzamil, alone or in combination. The tail moment was measured after 72 hr of treatment …
Figure 4 with 1 supplement
SN-6 treatment increases sensitivity of colorectal cancer (CRC)-derived cells and organoids to 5-fluorouracil + irinotecan (5-FU + iri.).
(A) Cell lysates and secreted medium of differentiated HT29-M6 cells pre-treated with a vehicle or 10 µM SN-6 inhibitor for 24 hr and then exposed to 5-FU + iri. (50 µg/mL 5-FU + 20 µg/mL iri.) for …
-
Figure 4—source data 1
Uncropped gels for Figure 4.
- https://cdn.elifesciences.org/articles/73926/elife-73926-fig4-data1-v2.zip
Figure 4—figure supplement 1
Mucins’ levels in HT29 cells and in a patient-derived organoid.
(A) Schematic diagram of the experimental set-up to measure mucin secretion and production. (B) Representative images of HT29-M6 differentiated cell (vehicle [control], 5-fluorouracil + irinotecan …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | MUC5AC | Ensembl | ENSG00000215182 | |
| Gene (H. sapiens) | MUC2 | Ensembl | ENSG00000198788 | |
| Gene (H. sapiens) | MUC6 | Ensembl | ENSG00000184956 | |
| Gene (H. sapiens) | MUC5B | Ensembl | ENSG00000117983 | |
| Gene (H. sapiens) | MUC19 | Ensembl | ENSG00000205592 | |
| Gene (H. sapiens) | KCNIP3 | Ensembl | ENSG00000115041 | |
| Cell line (H. sapiens) | HT29-M6 | ATCC | CVCL_G077 | Mycoplasma free |
| Cell line (H. sapiens) | HT29-18N2 | ATCC | CVCL_5942 | Mycoplasma free |
| Antibody | Anti-MUC5AC (mouse monoclonal) | Neomarkers,Waltham, MA | Clone 45M1 | (1:1000) |
| Antibody | Anti-γH2A.X (mouse monoclonal) | Cell Signaling | #2577 | (1:1000) |
| Commercial assay or kit | CometAssay Trevigen Kit | Trevigen | 250-050K | |
| Chemical compound, drug | SN-6 | Sigma-Aldrich | SML1937-5MG | (5 µM) |
| Chemical compound, drug | Benzamil | Sigma-Aldrich | B2417-10MG | 5 µM |
Table 1
Primer sequences used for detecting mRNA for the respective genes.
| Gene | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| MUC5AC | CTGGTGCTGAAGAGGGTCAT | CAACCCCTCCTACTGCTACG |
| TBP | TGCCCGAAACGCCGAATATAATC | GTCTGGACTGTTCTTCACTCTTGG |
| GAPDH | GTCATCCCTGAGCTGAACG | CTCCTTGGAGGCCATGTG |
