Figures and data in Activation of transient receptor potential vanilloid 4 is involved in pressure overload-induced cardiac hypertrophy

Figures
Tables
Additional files

11 figures, 4 tables and 4 additional files

Figures

Figure 1

Download asset Open asset

TRPV4 expression is upregulated in pathological cardiac hypertrophy.

Representative immunoblot image (A) and statistics (B) of TRPV4 protein level in the LV from sham or TAC mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. (C) Statistical data of *Trpv4* mRNA level in the LV from sham or TAC mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. Representative immunoblot image (D) and statistical data (E) of TRPV4 protein level in human non-failing hearts (n=3) and failing hearts (n=5). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. LV, left ventricle; TAC, transverse aortic constriction.

Figure 1—source data 1 Source data file (Excel) for Figure 1B.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig1-data1-v1.xlsx
Download elife-74519-fig1-data1-v1.xlsx
Figure 1—source data 2 Source data file (Excel) for Figure 1C.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig1-data2-v1.xlsx
Download elife-74519-fig1-data2-v1.xlsx
Figure 1—source data 3 Source data file (Excel) for Figure 1E.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig1-data3-v1.xlsx
Download elife-74519-fig1-data3-v1.xlsx

Figure 2

Download asset Open asset

TRPV4 deficiency attenuates pressure overload-induced cardiac hypertrophy.

(A) Representative images of the heart and statistical results for the ratios of HW/BW and HW/TL of WT and *Trpv4* KO mice 1 or 4 weeks after sham or TAC operation (n=7 per group in WT mice, n=5 per group at 1 week in TRPV4^−/− mice, n=7 per group at 4 weeks in *Trpv4* KO mice) (B) Hematoxylin & eosin staining, wheat germ agglutinin staining, and cross-section area in WT and *Trpv4* KO mice 1 or 4 weeks after sham or TAC operation (n=3 per group at 1 week, n=7 per group at 4 weeks). (C) Statistics of hypertrophy-related genes ANP (*Nppa*) (E) and BNP (*Nppb*) (F) mRNA levels in mouse hearts from WT or *Trpv4* KO 1 or 4 weeks after sham or TAC operation (n=6 per group at 1 week, n=7 per group at 4 weeks). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. BW, body weight; HW, heart weight; TAC, transverse aortic constriction; TL, tibial length; WT, wild-type.

Figure 2—source data 1 Source data file (Excel) for Figure 2A, B and C.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig2-data1-v1.xlsx
Download elife-74519-fig2-data1-v1.xlsx

Figure 3

Download asset Open asset

TRPV4 deficiency improves cardiac function and attenuates cardiac fibrosis induced by pressure overload.

Representative images of M-mode echocardiography of WT and *Trpv4* KO mice 4 weeks after sham or TAC operation (A). Statistics of EF (B), FS (C), LV mass (D), and LVIDs (E) in mice 4 weeks after sham or TAC operation (n=6 per group). Representative images (F) and statistics (G) of Masson’s trichrome-stained hearts from mice 4 weeks after sham or TAC operation. The statistics were from the panoramic scanning pictures (n=4 per group). Statistics of fibrosis-related genes collagenase-1 (*Col1a1*) (H), collagenase-3 (*Col1a1*) (I), and galectin-3 (*LGALS3*) (J) mRNA levels in mouse hearts 4 weeks after sham or TAC operation (n=7 per group). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. EF, ejection fraction; FS, fractional shortening; LV, left ventricle; TAC, transverse aortic constriction.

Figure 3—source data 1 Source data file (Excel) for Figure 3B, C, D, E, G, H, I.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig3-data1-v1.xlsx
Download elife-74519-fig3-data1-v1.xlsx

Figure 4

Download asset Open asset

TRPV4 deficiency attenuates cardiac fibrosis induced by pressure overload.

Representative immunoblot image (A) and statistics of IL-1β (B), IL-6 (C), and TNF-α (D) protein levels in WT and *Trpv4* KO mice 4 weeks after sham or TAC operation (n=6 per group). Statistical data of IL-1β (*Il1b*) (E), IL-6 (*Il6*) (F), TNF-α (*Tnfa*) (G), MCP-1 (*Mcp1p*) (H), and MIP-2 (*Mip2*) (I) mRNA levels in mouse hearts 4 weeks after sham or TAC operation (n=7 per group). Representative immunoblot image (J) and statistics of ASC (K), NLRP3 (L), Caspase 1-p20 (M), and p-NFκB p65 (N) protein levels in WT and TRPV4^−/− mice at 4 weeks after sham or TAC operation (n=6 per group). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. TAC, transverse aortic constriction; WT, wild-type.

Figure 4—source data 1 Source data file (Excel) for Figure 4B, C and D.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig4-data1-v1.xlsx
Download elife-74519-fig4-data1-v1.xlsx
Figure 4—source data 2 Source data file (Excel) for Figure 4E-I.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig4-data2-v1.xlsx
Download elife-74519-fig4-data2-v1.xlsx
Figure 4—source data 3 Source data file (Excel) for Figure 4K, L, M and N.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig4-data3-v1.xlsx
Download elife-74519-fig4-data3-v1.xlsx

Figure 5

Download asset Open asset

Treatment with TRPV4 antagonist prevents TAC-induced cardiac hypertrophy and dysfunction in mice.

(A) Representative images of heart photo and WGA staining 4 weeks after TAC. Statistical results for HW/BW ratio (n=6 per group) (B), HW/TL ratio (n=6 per group) (C), cross-section area (n=4 per group) (J), ANP *(Nppa)* (n=6 per group) (E), BNP *(Nppb)* (n=6 per group) (F), EF (n=6 per group) (G), FS (n=6 per group) (H), LV mass (n=6 per group) (I), and LVIDs (n=6 per group) (J). All results represent mean± SD, an unpaired two-tailed Student’s t-test. Representative images and statistics (K) of Masson’s trichrome-stained hearts 4 weeks after TAC (n=3 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. EF, ejection fraction; FS, fractional shortening; LV, left ventricle; TAC, transverse aortic constriction; WGA, wheat germ agglutinin.

Figure 5—source data 1 Source data file (Excel) for Figure 5C–K.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig5-data1-v1.xlsx
Download elife-74519-fig5-data1-v1.xlsx

Figure 6

Download asset Open asset

TRPV4 blockade attenuates AngII/PE-induced hypertrophy in NRVMs in vitro.

Representative images (A) and statistics of the cell-surface areas (B) in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=20 cells from three animals). Statistics of ANP *(Nppa)* (C) and BNP *(Nppb)* (D) mRNA levels in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). Representative images (E) and statistics of the cell-surface areas (F) in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=20 cells from three animals). Statistics of ANP *(Nppa)* (G) and BNP *(Nppb)* (H) mRNA levels in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. NRVM, neonatal rat ventricular myocyte.

Figure 6—source data 1 Source data file (Excel) for Figure 6B, C, D, F, G and H.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig6-data1-v1.xlsx
Download elife-74519-fig6-data1-v1.xlsx

Figure 7

Download asset Open asset

TRPV4 blockade attenuates AngII/PE-induced Ca²⁺ overload in NRVMs.

Representative immunoblot image (A) and statistics (B) of TRPV4 protein level in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). (C). Statistical data of *Trpv4* mRNA level in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). Representative recording of changes in intracellular Ca²⁺ induced by 500 nM GSK 790A and 1 μM A23187 in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (D). Quantification of [Ca²⁺]_i response induced by GSK790A (E) and A23187 (F) -induced in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=18 per group). Representative recording of changes in intracellular Ca²⁺ induced by 500 nM GSK 790A and 1 μM A23187 in NRVMs treated with DMSO, PE, and PE plus GSK3874 (G). Quantification of [Ca²⁺]_i response induced by GSK790A (H) and A23187 (I)-induced in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=12 per group). The arrow indicates the time of addition of GSK1016790A and A21387. F0 represents the average fluorescence intensity before GSK1016790A stimulation. All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. NRVM, neonatal rat ventricular myocyte.

Figure 7—source data 1 Source data file (Excel) for Figure 7B.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig7-data1-v1.xlsx
Download elife-74519-fig7-data1-v1.xlsx
Figure 7—source data 2 Source data file (Excel) for Figure 7C-I.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig7-data2-v1.xlsx
Download elife-74519-fig7-data2-v1.xlsx

Figure 8

Download asset Open asset

TRPV4 activation induces CaMKII phosphorylation.

Representative immunoblot image (A) and statistics (B) of p-CaMKII/CaMKII in NRVMs treated with DMSO, GSK790A, and GSK790A plus GSK3874 (n=4 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (C) and statistics (D) of p-CaMKII/CaMKII in NRVMs treated with GSK790A in the absence and presence of Ca²⁺ medium (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. Representative immunoblot image (E) and statistics (F) of p-CaMKII/CaMKII in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=4 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (G) and statistics (H) of p-CaMKII/CaMKII in the LV from sham or TAC WT mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. Representative immunoblot image (I) and statistics (J) of p-CaMKII/CaMKII in *Trpv4* KO mice 1 week or 4 weeks after sham or TAC operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. NRVM, neonatal rat ventricular myocyte.

Figure 8—source data 1 Source data file (Excel) for Figure 8B, D, F, H and J.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig8-data1-v1.xlsx
Download elife-74519-fig8-data1-v1.xlsx

Figure 9

Download asset Open asset

TRPV4 activation induces NFκB phosphorylation via a CaMKII signaling pathway.

Representative immunoblot image (A) and statistics (B) of p-p65 /p65 in NRVMs treated with DMSO, GSK790A, and GSK790A plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (C) and statistics (D) of p-p65 /p65 in NRVMs treated DMSO, AngII, and AngII plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (E) and statistics (F) of p-p65 /p65 in NRVMs treated with DMSO, GSK790A, GSK790A plus KN92, and GSK790A plus KN93 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test.

Figure 9—source data 1 Source data file (Excel) for Figure 9B, D and F.: https://cdn.elifesciences.org/articles/74519/elife-74519-fig9-data1-v1.xlsx
Download elife-74519-fig9-data1-v1.xlsx

Figure 10

Download asset Open asset

Schematic illustration of potential mechanisms through which TRPV4 activation promotes pathological cardiac hypertrophy.

Appendix 1—figure 1

Download asset Open asset

Genotyping of TRPV4 wild-type and Trpv4 KO mice and TRPV4 depletion in the heart of Trpv4 KO mice.

A. Representative RT-PCR genotyping gel image of the WT, Trpv4+/-, and Trpv4-/-. B. RT-PCR of total RNA from heart showing Trpv4 mRNA was present in WT mice but absent in Trpv4 KO mice.

Appendix 1—figure 1—source data 1: https://cdn.elifesciences.org/articles/74519/elife-74519-app1-fig1-data1-v1.zip
Download elife-74519-app1-fig1-data1-v1.zip

Tables

Table 1

Echocardiographic measurements 4 weeks after TAC.

	WT		Trpv4 KO
	Sham	TAC	Sham	TAC
Heart rate (bpm)	457.61±11.77	463.11±16.96	463.11±18.86	443.78±10.38
LVAW,s (mm)	1.29±0.14	1.41±0.18	1.21±0.2	1.48±0.17
LVID,d (mm)	3.32±0.12	3.81±0.59	2.92±0.38	3.11±0.47
LVPW,d (mm)	0.70±0.08	1.08±0.46	0.92±0.39	1.02±0.37
LVPW,s (mm)	1.17±0.11	1.41±0.57	1.33±0.34	1.59±0.31
Diameter,s (mm)	2.05±0.13	2.67±0.57	1.69±0.32	1.80±0.37^##
Diameter,d (mm)	3.29±0.12	3.62±0.48	2.87±0.42	3.04±0.45
Volume,s (μl)	13.73±2.17	28.01±14.43^*	8.79±4.00	10.36±5.41^##
Volume,d (μl)	43.88±3.84	56.39±17.41	32.23±11.02	37.38±12.30
Stroke volume (μl)	30.14±2.43	28.39±4.67	23.44±7.19	27.02±7.52

LVAW,s: systolic left ventricular anterior wall, LVID,s: systolic left ventricular internal diameter, LVPW,d: diastolic left ventricular posterior wall, LVPW,s.: systolic left ventricular posterior wall, Data represent means ± SD, n=6 per group, ^⁎P<0.05 WT TAC vs WT sham group. ^## P<0.01 Trpv4 KO TAC vs WT TAC group

Table 1—source data 1 Source data file (Excel) for Table 1.: https://cdn.elifesciences.org/articles/74519/elife-74519-table1-data1-v1.xlsx
Download elife-74519-table1-data1-v1.xlsx

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Chemical compound, drug	Ang II	MCE	Cat# HY-13948
Chemical compound, drug	PE	MACKLIN	Cat# I822933
Chemical compound, drug	GSK790A	Sigma-Aldrich	Cat# G0798
Chemical compound, drug	GSK3874	Sigma-Aldrich	Cat# SML0942
Chemical compound, drug	A21387	Sigma-Aldrich	Cat# G0798
Chemical compound, drug	KN92	Selleck	Cat# S6507
Chemical compound, drug	KN93	Selleck	Cat# S6787
Chemical compound, drug	Pentobarbital sodium	Sigma-Aldrich	Cat# 76-74-4
Chemical compound, drug	Collagenase II	Worthington	Cat# ls004176
Chemical compound, drug	Fluo-4/AM	AAT Bioquest	Cat# AAT-B20401
Chemical compound, drug	Pluronic F‐127	Solarbio	Cat# P679
Sequence-based reagent	BNP (Nppb)_R (mice)	This paper	PCR primers	CAACTTCAGTGCGTTACAGC
Sequence-based reagent	Collagenase-1 (Col1a1) _F (mice)	This paper	PCR primers	GAAACCCGAGGTATGCTTGA
Sequence-based reagent	Collagenase1 (Col1a1) _R (mice)	This paper	PCR primers	GGGTCCCTCGACTCCTACAT
Sequence-based reagent	Collagenase-3 (Col3a1) _F (mice)	This paper	PCR primers	AGCCACCTTGGTCAGTCCTA
Sequence-based reagent	Collagenase-3 (Col3a1) _R (mice)	This paper	PCR primers	GTGTAGAAGGCTGTGGGCAT
Sequence-based reagent	Galectin-3 (LGALS3)_F (mice)	This paper	PCR primers	CAGGAAAATGGCAGACAGCTT
Sequence-based reagent	Galectin-3 (LGALS3)_R(mice)	This paper	PCR primers	CCCATGCACCCGGATATC
Sequence-based reagent	IL-1β (Il1b) _F (mice)	This paper	PCR primers	TGCCACCTTTTGACAGTGATG
Sequence-based reagent	IL-1β(Il1b)_R (mice)	This paper	PCR primers	TGATGTGCTGCTGCGAGATT
Sequence-based reagent	IL-6(Il6)_F (mice)	This paper	PCR primers	GATAAGCTGGAGTCACAGAAGG
Sequence-based reagent	IL-6(Il6)_R (mice)	This paper	PCR primers	TTGCCGAGTAGATCTCAAAGT
Sequence-based reagent	TNF-α(Tnfa)_F (mice)	This paper	PCR primers	CCCCAAAGGGATGAGAAGTT
Sequence-based reagent	TNF-α(Tnfa)_R (mice)	This paper	PCR primers	ACTTGGTGGTTTGCTACGA
Sequence-based reagent	MIP-2(Mip2)_F (mice)	This paper	PCR primers	CGCCCAGACAGAAGTCATAG
Sequence-based reagent	MIP-2(Mip2)_R (mice)	This paper	PCR primers	TCCTCCTTTCCAGGTCAGTTA
Sequence-based reagent	MCP-1(Mcp1p)_F (mice)	This paper	PCR primers	TTTTTGTCACCAAGCTCAAGAG
Sequence-based reagent	MCP-1(Mcp1p)_R (mice)	This paper	PCR primers	TTCTGATCCTCATTTGGTTCCGA
Sequence-based reagent	Gapdh_F(mice)	This paper	PCR primers	AAGAAGGTGGTGAAGCAGGCAT
Sequence-based reagent	Gapdh_F (mice)	This paper	PCR primers	CGGCATCGAAGGTGGAAGAGTG
Sequence-based reagent	Trpv4_F (rat)	This paper	PCR primers	CGTCCAAACCTGCGAATGAAGTTC
Sequence-based reagent	Trpv4_F (rat)	This paper	PCR primers	CCTCCATCTCTTGTTGTCACTGG
Sequence-based reagent	ANP (Nppa)_F (rat)	This paper	PCR primers	ATCTGATGGATTTCAAGAACC
Sequence-based reagent	ANP (Nppa)_R (rat)	This paper	PCR primers	CTCTGAGACGGGTTGACTTC
Sequence-based reagent	BNP (Nppb)_F (rat)	This paper	PCR primers	CAATCCACGATGCAGAAGCT
Sequence-based reagent	BNP (Nppb)_R (rat)	This paper	PCR primers	GGGCCTTGGTCCTTTGAGA
Sequence-based reagent	Gapdh_ F (rat)	This paper	PCR primers	ATGGGAAGCTGGTCATCAAC
Sequence-based reagent	Gapdh_ R (rat)	This paper	PCR primers	GTGGTTCACACCCATCACAA
Antibody	Anti-GAPDH HRP (mouse monoclonal)	Bioworlde	Cat# MB001H RRID: AB_2857326	Western blot (1:10,000)
Antibody	Anti-TRPV4 (rabbit polyclonal)	Alomone labs	Cat# ACC-034 RRID: AB_2040264	Western blot (1:500)
Antibody	Anti-p-CaMKII(Thr287) (rabbit polyclonal)	Thermo Fisher Scientific	Cat# PA5-37833 RRID: AB_2554441	Western blot (1:500)
Antibody	Anti-CaMKII (rabbit monoclonal)	Abcam	Cat# ab52476 RRID: AB_868641	Western blot (1:1000)
Antibody	Anti-p-P65 (Ser536) (rabbit polyclonal)	Affinity	Cat# AF2006 RRID: AB_2834435	Western blot (1:500)
Antibody	Anti-P65 (rabbit polyclonal)	Affinity	Cat# AF5006 RRID: AB_2834847	Western blot (1:500)
Antibody	Anti-NLRP3 (rabbit monoclonal)	Abcam	Cat# ab263899 RRID: AB_2889890	Western blot (1:500)
Antibody	Anti-ASC/TMS1 (rabbit monoclonal)	CST	Cat# 67824 RRID: AB_2799736	Western blot (1:1000)
Antibody	Anti-Cleaved-Caspase 1, p20 (rabbit polyclonal)	Affinity	Cat# AF4005 RRID: AB_2845463	Western blot (1:500)
Antibody	Anti-IL 1β (rabbit monoclonal)	Abcam	Cat# ab234437	Western blot (1:1000)
Antibody	Anti-IL-6 (rabbit monoclonal)	CST	Cat# 12912 RRID: AB_2798059	Western blot (1:500)
Antibody	Anti-TNF-α (rabbit monoclonal)	CST	Cat# 11948 RRID: AB_2687962	Western blot (1:1000)
Antibody	Goat Anti-Rabbit IgG HRP (goat polyclonal)	Affinity	Cat# S0001 RRID: AB_2839429	Western blot (1:3000)
Antibody	Anti-α-actinin (rabbit polyclonal)	Abcam	Cat# Ab137346 RRID: AB_2909405	ICC (1:500)
Commercial assay or kit	cDNA reverse transcription kit	Vazyme	Cat# R211-01
Commercial assay or kit	SYBR Green PCR Master Mix Kit	CWbio	Cat# cw3008h
Others	Percoll	Cytiva	Cat# 17089109	A low-viscosity, non-toxic medium suitable for density gradient centrifugation of cells, viruses and subcellular particles

Appendix 1—table 1

Anatomical parameters, early markers of cardiac hypertrophy and fibrosis, and echocardiographic parameters were measured in wild-type (WT) mice after subjected to TAC versus sham-operated controls (n=6–7/group).

	2 d		1 w		2 w		4 w
	Sham	TAC	Sham	TAC	Sham	TAC	Sham	TAC
Anatomical parameter
n	7	7	7	7	7	7	6	6
HW/BW	4.4±0.1	4.5±0.1	5.1±0.2	7.3±0.7***	4.5±0.3	7.1±1.1***	4.5±0.3	7.1±0.8**
HW/TL	6.0±0.2	6.0±0.1	6.7±0.6	8.4±0.6***	6.0±0.3	9.3±1.4***	6.3±0.5	9.7±1.6***
Early markers of cardiac hypertrophy and fibrosis
n	6	6	6	6	6	6	7	7
ANP	1.0±0.3	1.1±0.2	1.0±0.5	9.1±3.9***	1.0±0.4	28.1±11.5***	1.0±0.2	7.3±1.9***
BNP	1.0±0.2	0.7±0.1	1.0±0.4	11.5±2.0***	1.0±0.3	5.2±1.1***	1.0±0.4	2.7±0.4**
Collagenase-1	1.0±0.4	1.4±0.7	1.0±0.4	1.1±0.3	1.0±1.3	1.0±0.7	1.0±0.2	6.8±2.5**
Collagenase-3	1.0±0.2	1.0±0.5	1.0±0.4	1.30±0.25	1.0±1.1	2.5±2.1	1.0±0.3	3.8±1.2**
Echocardiographic parameters
n	7	7	7	7	7	7	6	6
EF (%)	66.4±7.2	65.0±8.9	71.0±5.9	68.7±3.5	75.7±4.4	60.2±3.9***	68.8±3.3	52.8±10.6**
FS (%)	36.0±5.1	34.2±6.7	39.8±6.6	36.1±3.5	43.4±4.0	31.3±2.6***	37.6±2.7	26.9±6.5**

HW/BW: heart weight to body weight ratio, HW/TL: heart weight to tibia length ratio, EF: ejection fraction, FS: fractional shortening, Data represent means ± SD, **P<0.01, ***P<0.001, compared between sham- and TAC operated groups.