Live imaging of the co-translational recruitment of XBP1 mRNA to the ER and its processing by diffuse, non-polarized IRE1α
- Department of Gene Therapy and Regulation of Gene Expression, Center for Applied Medical Research (CIMA), University of Navarra, Spain
- Friedrich Miescher Institute for Biomedical Research, Switzerland
- University of Basel, Switzerland
Figures
Figure 1 with 2 supplements
Live imaging of XBP1 mRNA recruitment to the endoplasmic reticulum (ER).
(A) Reporter construct design: XBP1 wild-type (WT; red) features the mouse XBP1 opening reading frame (ORF) and 3' untranslated region (UTR) and contains a 24 × MS2 stem loop array for mRNA …
-
Figure 1—source data 1
Raw gel images for Figure 1.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig1-data1-v1.zip
Figure 1—figure supplement 1
Characterization of XBP1 splicing and unfolded protein response (UPR) activation in XBP1 wild-type (WT) reporter expressing cells.
HeLa cells stably expressing XBP1-MS2 wild-type (WT) reporters were treated with 0.2 ug/ml doxycycline (Dox) for 15 hours before addition of 100 nM thapsigargin (TG) or 5 mg/ml tunicamycin (TM) for …
-
Figure 1—figure supplement 1—source data 1
Raw gel images for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig1-figsupp1-data1-v1.zip
Figure 1—figure supplement 2
Flotation assays to investigate HR2-mediated recruitment of XBP1 reporter transcripts to endoplasmic reticulum (ER) membranes.
(A) HEK293 cells were subjected to hypotonic lysis and cytosolic extracts were subjected to flotation in discontinuous sucrose gradients. Fractions 2–3 include floating membranes (as indicated by …
-
Figure 1—figure supplement 2—source data 1
Raw gel images for Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig1-figsupp2-data1-v1.zip
Figure 2 with 2 supplements
Association of XBP1u mRNA with the endoplasmic reticulum (ER) is translation dependent.
(A) Reporter construct design and illustration of the method: XBP1u translation reporters feature a 9× GCN4 array (green) inserted into the opening reading frame downstream of the ER intron and in …
-
Figure 2—source data 1
Source data containing raw gel images for Figure 2.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig2-data1-v1.zip
Figure 2—figure supplement 1
Live imaging of XBP1u translation sites.
(A) Correlated diffusion and endoplasmic reticulum (ER) colocalization analysis for individual XBP1u translation site tracks (green) and Gaussia mRNA transcripts (gray). Dots are single particles …
Figure 2—figure supplement 2
Colocalization control experiment shows no unspecific association of XBP1 mRNA and scAB-GFP spots.
(A) Schematic illustration of experimental design: GCN4-SM translation reporters either encoding Renilla luciferase (left) or XBP1u (right) were stably expressed in the HeLa imaging cell lines …
Figure 3 with 1 supplement
Inositol-requiring enzyme 1 alpha (IRE1α)-dependent processing and endoplasmic reticulum (ER) association of XBP1u transcripts during stress.
(A) Reporter construct design: Unspliceable (dark blue) and spliced (light blue) reporter transcripts are identical to XBP1 wild-type (WT; red) except for point mutations in the intron (unsplicable) …
Figure 3—figure supplement 1
Validation of splice site mutants.
(A) Western blot analysis of production of spliced XBP1s protein in response to induction of endoplasmic reticulum (ER) stress with 100 nM thapsigargin (TG) as introduced in Figure 1. Only the …
-
Figure 3—figure supplement 1—source data 1
Raw gel images for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig3-figsupp1-data1-v1.zip
Figure 4 with 1 supplement
Inositol-requiring enzyme 1 alpha (IRE1α) is able to splice XBP1u mRNA in the absence of foci formation.
(A) Schematic representation of IRE1α-GFP construct design analogous to Belyy et al., 2020. To reduce expression of IRE1α-GFP to match endogenous levels, part of the Emi1 5’ untranslated region …
-
Figure 4—source data 1
Raw gel images for Figure 4.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig4-data1-v1.zip
Figure 4—figure supplement 1
Characterization of unfolded protein response (UPR) activation in Emi1-IRE1α-GFP expressing cells.
HeLa cells, wild-type (WT) or inositol-requiring enzyme 1 alpha (IRE1α) KO (knock out) expressing either no IRE1α (Neg) or reconstituted (Emi1-) IRE1α-GFP at low levels were kept untreated or …
-
Figure 4—figure supplement 1—source data 1
Raw gel images for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/75580/elife-75580-fig4-figsupp1-data1-v1.zip
Videos
Video 1
XBP1 wild-type (WT) mRNA colocalization with the endoplasmic reticulum (ER).
HeLa cell line stably expressing XBP1 WT reporter transcripts, NLS-stdMCP-stdHalo, and an ER marker. Simultaneous image acquisition for both channels (XBP1 WT, red, and ER, gray) using 50 ms …
Video 2
Recruitment of a single XBP1 wild-type mRNA transcript to the endoplasmic reticulum (ER).
Close-up from the same image series as shown in Video 1 but highlighting an example for a single particle that is recruited to the ER surface.
Video 3
Stable association of a single XBP1 wild-type mRNA transcript with an endoplasmic reticulum (ER) sheet.
Close-up from the same image series as shown in Video 1 but highlighting an example for a single particle that is stably associated with the ER surface.
Video 4
Lack of colocalization with the endoplasmic reticulum (ER) exhibited by XBP1 HR2 mutant transcripts.
HeLa cell line stably expressing XBP1 HR2 mutant reporter transcripts, NLS-stdMCP-stdHalo and an ER marker. Simultaneous image acquisition for both channels (HR2 mutant, yellow and ER, gray) using …
Video 5
Live imaging of XBP1u translation on the endoplasmic reticulum (ER).
HeLa cell line stably expressing XBP1u translation reporter transcripts, scAB-GFP, and Sec61b-SNAP as ER marker. Simultaneous image acquisition for both channels (XBP1u translation sites, green, and …
Video 6
Colocalization of XBP1 unspliceable mutant reporter transcripts with the endoplasmic reticulum (ER).
HeLa cell line stably expressing XBP1 splice site mutant transcripts, NLS-stdMCP-stdHalo and an ER marker. Simultaneous image acquisition for both channels (XBP1 Unspliceable, blue and ER, gray) …
Video 7
Lack of colocalization with the endoplasmic reticulum (ER) exhibited by XBP1 spliced reporter transcripts.
HeLa cell line stably expressing spliced XBP1 transcripts, NLS-stdMCP-stdHalo, and an ER marker. Simultaneous image acquisition for both channels (XBP1 spliced, light blue and ER, gray) using 50 ms …
Video 8
Lack of colocalization with the endoplasmic reticulum (ER) exhibited by XBP1 WT transcripts in response to ER stress.
HeLa cell line stably expressing XBP1 wild-type (WT) reporter transcripts, NLS-stdMCP-stdHalo, and an ER marker. Cells were treated with 5 µg/ml tunicamycin (TM) for 3–4 hours prior to image …
Video 9
XBP1 WT mRNA colocalization with the endoplasmic reticulum (ER) during ER stress and inhibition of inositol-requiring enzyme 1 alpha RNase activity.
HeLa cell line stably expressing XBP1 wild-type (WT) reporter transcripts, NLS-stdMCP-stdHalo, and an ER-marker. Cells were treated with 5 µg/ml tunicamycin and 50 µM 4µ8C for 3–4 hours prior to …
Video 10
No accumulation of XBP1 wild-type (WT) transcripts in inositol-requiring enzyme 1 alpha (IRE1α)-GFP foci during IRE1α inhibition.
HeLa cell line stably expressing XBP1 WT reporter transcripts, NLS-stdMCP-stdHalo and IRE1α-GFP. Cells were treated with 5 µg/ml tunicamycin and 50 µM 4µ8C for 2–3 hours prior to image acquisition. …
Video 11
Detection of single XBP1 wild-type (WT) transcripts in inositol-requiring enzyme 1 alpha (IRE1α)-GFP foci is possible but extremely rare.
HeLa cell line stably expressing XBP1 WT reporter transcripts, NLS-stdMCP-stdHalo, and IRE1α-GFP. Cells were treated with 5 µg/ml tunicamycin and 50 µM 4µ8C for 2–3 hours prior to image acquisition. …
Video 12
No accumulation of XBP1 splice site mutant transcripts in inositol-requiring enzyme 1 alpha (IRE1α)-GFP foci.
HeLa cell line stably expressing XBP1 splice site mutant reporter transcripts, NLS-stdMCP-stdHalo, and IRE1α-GFP. Cells were treated with 5 µg/ml tunicamycin for 3–4 hours prior to image …
Tables
Table 1
List of antibodies used for western blotting.
| Protein | Provider | Cat. # | Notes |
|---|---|---|---|
| XBP1 | Santa Cruz Biotechnology | sc-7160 (M-186) | Detects murine XBP1 much better than endogenous, human XBP1 |
| XBP1 | Cell Signaling | #12,782 | Used to detect both human and murine XBP1 proteins |
| IRE1α | Cell Signaling | #3294 | |
| Calnexin | Novus Biologicals | NBP1-97485 | |
| Alpha-tubulin | Sigma | T6074 | |
| GAPDH | Cell Signaling | #2118 |
Table 2
List of primers used for RT-PCR analysis.
| Oligonucleotides used in this study (1st Fwd; 2nd Rev.) |
|---|
| H.s. Histone |
| AAAGCCGCTCGCAAGAGTGCG |
| ACTTGCCTCCTGCAAAGCAC |
| H.s. GRP78 |
| GAGCTGTGCAGAAACTCCGGCG |
| ACCAACTGCTGAATCTTTGGAATTCGAGT |
| H.s. XBP1u |
| CACTCAGACTACGTGCACCTC |
| CAGGGTGATCATTCTCTGAGGGGCTG |
| H.s. XBP1s |
| CGGGTCTGCTGAGTCCGCAGCAG |
| CAGGGTGATCATTCTCTGAGGGGCTG |
| M.m. XBP1u |
| CACTCAGACTACGTGCACCTC |
| CAGGGTGATCATTCTCTGAGGGGCTG |
| M.m XBP1s |
| CGGGTCTGCTGAGTCCGCAGCAG |
| CAGGGTGATCATTCTCTGAGGGGCTG |
| PCR to analyze M.m splicing by agarose electrophoresis |
| ACGCTGGATCCTGACGAGGTTCC |
| GAGAAAGGGAGGCTGGTAAGGAACTA |
Table 3
List of smFISH probes to detect mouse XBP1 mRNA.
| 1 | taagagtagcactttggggg |
|---|---|
| 2 | gctactctgtttttcagttt |
| 3 | ctttctttctatctcgagca |
| 4 | ctgatttcctagctggagtt |
| 5 | cgtgagttttctcccgtaaa |
| 6 | tctggaacctcgtcaggatc |
| 7 | agaggtgcacatagtctgag |
| 8 | ttctggggaggtgacaactg |
| 9 | tgtcagagtccatgggaaga |
| 10 | actcagaatctgaagaggca |
| 11 | ccagaatgcccaaaaggata |
| 12 | aacatgacagggtccaactt |
| 13 | actctggggaaggacatttg |
| 14 | tggtaaggaactaggtcctt |
| 15 | gagttcattaatggcttcca |
| 16 | gcttggtgtatacatggtca |
| 17 | cagaggggatctctaaaact |
| 18 | acgttagtttgactctctgt |
| 19 | tgcttcctcaattttcacta |
| 20 | cctcttctgaagagcttaga |
| 21 | gagacaatgaattcagggtg |
| 22 | ttccaaaggctctttcttca |
| 23 | ccagctctgggatgaagtca |
| 24 | gctggatgaaagcaggtttg |
| 25 | caagaaggtggtctcagaca |
| 26 | atatccacagtcactgtgag |
| 27 | gtctgtaccaagtggagaag |
| 28 | cattggcaaaagtatcctcc |
| 29 | cactaatcagctgggggaaa |
| 30 | cagtgttatgtggctcttta |
| 31 | ctaggcaatgtgatggtcag |
| 32 | aagagacaggcctatgctat |
| 33 | cctctactttggcttttaac |
| 34 | ggaattcttctaaggccaga |
| 35 | cttggaagtcatctatgaga |
| 36 | ataccttagacagctgagtg |
| 37 | agctgtagtactggaatacc |
| 38 | tttagagtatactaccacct |
| 39 | aaactgtcaaatgaccctcc |
| 40 | catgtccacctgacatgtcg |
| 41 | gaaatgctaagggccattca |
| 42 | cgaaacctgggaagcagaga |
| 43 | cataagggaaaacaagcccc |
| 44 | agatccatcaagcatttaca |
Table 4
Imaging data statistics.
| Data statistics for live imaging experiments | ||||||||
|---|---|---|---|---|---|---|---|---|
| Reporter | Experiment | Independent replicates | ID experiments | Cells | Mean tracks (≥3 frames) per cell | Tracks ≥3 frames | Tracks ≥10 frames | Tracks ≥30 frames |
| Gaussia | Ctrl | 2 | 20200323, 20200420 | 19 | 149 | 2822 | 1480 | 864 |
| XBP1 wt | Ctrl | 4 | 20191023, 20191108, 20200313,20210702 | 37 | 141 | 5200 | 2588 | 997 |
| XBP1u translation reporter | Ctrl | 3 | 20211018, 20211022, 20211023 | 50 | 36 | 1815 | 923 | 519 |
| XBP1 HR2 mutant | Ctrl | 3 | 20191023, 20191108, 20200313 | 25 | 206 | 5144 | 2454 | 653 |
| Spliced | Ctrl | 3 | 20200313, 20210226, 20211022 | 36 | 193 | 6943 | 3261 | 955 |
| Unspliceable | Ctrl | 3 | 20200313, 20210226, 20211025 | 34 | 194 | 6612 | 2997 | 1120 |
| XBP1 wt | TM | 3 | 20210218, 20210322, 20210702 | 37 | 117 | 4326 | 2183 | 741 |
| Spliced | TM | 3 | 20210218, 20210322, 20211022 | 35 | 152 | 5309 | 2571 | 817 |
| Unspliceable | TM | 3 | 20210218, 20210322, 20211025 | 43 | 120 | 5143 | 2491 | 1001 |
| XBP1 wt | TM +4µ8C | 3 | 20210219, 20210702, 20211017 | 41 | 119 | 4896 | 2509 | 1046 |
| Spliced | TM +4µ8C | 3 | 20210219, 20211017, 20211022 | 35 | 173 | 6,044 | 2,792 | 793 |
| Unspliceable | TM +4µ8C | 3 | 20210219, 20211017, 20211025 | 48 | 120 | 5750 | 2766 | 1031 |
| Data statistics for smFISH experiments | ||||||||
| Experiment | Colocalization control | |||||||
| Condition | Ctrl | TM | XBP1 wt +Renilla Luciferase | XBP1u only | ||||
| Cells | 278 | 170 | 208 | 114 | ||||
| Replicates | 2 | 2 | 1 | 1 | ||||
| scAB-GFP spots | 4172 | 1928 | 4086 | 1928 | ||||
| XBP1 mRNA spots | 6704 | 4186 | 5230 | 2313 | ||||
| Mean fraction of transl. mRNAs | 0.47 | 0.18 | 0.011 | 0.498 | ||||
| Data statistics for IRE1a-GFP foci quantification | ||||||||
| Experiment | Construct name | Replicate 1 | Replicate 2 | Replicate 3 | Replicate 4 | |||
| TM | Emi1-IRE1α-GFP | 20220510_577 | 20220510_630 | 20220513_630 | ||||
| Cells total | 233 | 115 | 167 | |||||
| Cells w/o foci | 233 | 115 | 167 | |||||
| Cells with foci | 0 | 0 | 0 | |||||
| Mean(Fraction in foci) | 0 | 0 | 0 | |||||
| SD (Fraction in foci) | 0 | 0 | 0 | |||||
| Fraction(Cells with foci) | 0 | 0 | 0 | |||||
| Image series | 10 | 10 | 10 | |||||
| IRE1α-GFP | 20200826_631 | 20220510_630 | 20220513_630 | |||||
| Cells total | 55 | 178 | 301 | |||||
| Cells w/o foci | 43 | 152 | 213 | |||||
| Cells with foci | 12 | 26 | 88 | |||||
| Mean(Fraction in foci) | 0.01920605 | 0.02054973 | 0.02550403 | |||||
| SD (Fraction in foci) | 0.00850352 | 0.01393375 | 0.01711448 | |||||
| Fraction(Cells with foci) | 0.21818182 | 0.14606742 | 0.2923588 | |||||
| Image series | 8 | 10 | 15 | |||||
| Ctrl | Emi1-IRE1α-GFP | 20220427_630 | 20220428_577 | 20220428_630 | 20220513_630 | |||
| Cells total | 76 | 107 | 53 | 136 | ||||
| Cells w/o foci | 76 | 107 | 53 | 136 | ||||
| Cells with foci | 0 | 0 | 0 | 0 | ||||
| Mean(Fraction in foci) | 0 | 0 | 0 | 0 | ||||
| SD (Fraction in foci) | 0 | 0 | 0 | 0 | ||||
| Fraction(Cells with foci) | 0 | 0 | 0 | 0 | ||||
| Image series | 5 | 5 | 5 | 10 | ||||
| IRE1α-GFP | 20220427_577 | 20220428_577 | 20220428_630 | 20220513_630 | ||||
| Cells total | 52 | 46 | 123 | 105 | ||||
| Cells w/o foci | 52 | 46 | 123 | 105 | ||||
| Cells with foci | 0 | 0 | 0 | 0 | ||||
| Mean(Fraction in foci) | 0 | 0 | 0 | 0 | ||||
| SD (Fraction in foci) | 0 | 0 | 0 | 0 | ||||
| Fraction(Cells with foci) | 0 | 0 | 0 | 0 | ||||
| Image series | 5 | 4 | 5 | 5 | ||||
