Combining transgenesis with paratransgenesis to fight malaria
- Department of Molecular Microbiology and Immunology, Malaria Research Institute, Johns Hopkins Bloomberg School of Public Health, United States
- Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, United States
Figures
Figure 1
Tissue-specific expression of effector genes in An. stephensi transgenic mosquitoes.
(A) Diagram of the salivary gland (Sg) and midgut (Mg) driver constructs expressing the QF2 transcription factor and the effector (E) constructs expressing the MP2 and scorpine effector proteins …
-
Figure 1—source data 1
Source data of Figure 1B, C, D, E and F.
Pictures of ‘Figure 1B-WT-blue field.tif,’ ‘Figure 1B-WT-red field.tif,’ and ‘Figure 1B-WT-yellow field.tif’ are original images of WT mosquito eye through blue, red, and yellow fluorescent filter, respectively; pictures of ‘Figure 1B-Mg-blue field.jpg,’ ‘Figure 1B-Mg-red field.jpg,’ and ‘Figure 1B-Mg-yellow field.jpg’ are original images of Mg mosquito line eye through blue, red, and yellow fluorescent filter, respectively; pictures of ‘Figure 1B-Sg-blue field.jpg,’ ‘Figure 1B-Sg-red field.jpg,’ and ‘-Figure 1B-Sg-yellow field.jpg’ are original images of Sg mosquito line eye through blue, red, and yellow fluorescent filter, respectively; pictures of ‘Figure 1B-E-blue field.jpg,’ ‘Figure 1B-E-red field.jpg,’ and ‘Figure 1B-E-yellow field.jpg’ are original images of E mosquito line eye through blue, red, and yellow fluorescent filter, respectively; pictures of Figure 1B-Mg-E-blue field.jpg, Figure 1B-Mg-E-red field.jpg, and Figure 1B-Mg-E-yellow field.jpg are original images of Mg/E mosquito line eye through blue, red, and yellow fluorescent filter, respectively; pictures of ‘Figure 1B-Sg-E-blue field.jpg,’ ‘Figure 1B-Sg-E-red field.jpg,’ and ‘Figure 1B-Sg-E-yellow field.jpg’ are original images of Sg/E mosquito line eye through blue, red, and yellow fluorescent filter, respectively; pictures of ‘Figure 1B-Mg+Sg-E-blue field.jpg,’ ‘Figure 1B-Mg+Sg-E-red field,’ and ‘Figure 1B-Mg+Sg-E-yellow field’ are original images of Mg/Sg/E mosquito line eye through blue, red, and yellow fluorescent filter, respectively. ‘Figure 1C and D-source data-RT-PCR data.xlsx’ is the original data for Figure 1C and D; ‘Figure 1C and D-gene expression.pzf’ shows Figure 1C and D were generated with GraphPad Prism. Pictures of ‘Figure 1E-western blot-MP2 in midgut.tif,’ ‘Figure 1E-western blot-Scorpine in midgut.tif,’ and ‘Figure 1E-western blot-α-tubulin in midgut.tif’ are original image of Western blots detected with mouse anti-MP2, mouse anti-scorpine, and rabbit anti-α-tubulin antibody. Pictures of ‘Figure 1F-western blot-MP2 in salivary gland.tif,’ ‘Figure 1F-western blot-Scorpine in salivary gland.tif,’ and ‘Figure 1F-western blot-α-tubulin in salivary gland.tif’ are original images of Western blots detected with mouse anti-MP2, mouse anti-scorpine, and rabbit anti-α-tubulin antibody.
- https://cdn.elifesciences.org/articles/77584/elife-77584-fig1-data1-v1.zip
Figure 2
Serratia AS1-multi-effector bacteria persist through multiple mosquito generations.
A total of 100 wild-type (WT) or transgenic (Trans) virgin females that had been fed with AS1-multi-effector bacteria were placed in a cage with 100 WT or transgenic virgin males (not fed with …
-
Figure 2—source data 1
‘Figure 2ABCD-source data.xlsx’ is the original colony-forming unit (CFU) data for Figure 2A–D; ‘Figure 2ABCD-source data.pzf’ shows that Figure 2A–D were generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-fig2-data1-v1.zip
Figure 3
Transgenesis and paratransgenesis strongly impair Plasmodium development.
Two-day-old An. stephensi mosquitoes were fed (or not) overnight with wild-type or recombinant Serratia AS1-multi bacteria, as indicated. After 48 hr, all mosquito groups were fed on the same P. …
-
Figure 3—source data 1
Source data of Figure 3A and B.
‘Figure 3A and B-source data.xlsx’ is the original data of oocysts and sporozoites number for Figure 3A and B; ‘Figure 3A and B-Source data-PF infection blocking experiments Oocyst and sporozoite.pzf’ shows that Figure 3A and B were generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-fig3-data1-v1.zip
Figure 4
Transgenesis and paratransgenesis inhibit P. berghei transmission by mosquitoes from infected to naïve mice.
(A) Experimental design. Wild-type (WT), paratransgenic, transgenic, and (paratransgenic + transgenic) mosquitoes were fed on the same P. berghei-infected mouse, assuring that all mosquitoes …
-
Figure 4—source data 1
Source data of Figure 4B, C, D and E.
‘Figure 4BCDE-source data.xlsx’ is the original data of challenge experiment for Figure 4B–E; ‘Figure 4 BCDE-source data-Challenge experiment.pzf’ shows that Figure 4B–E were generated with GraphPad Prism; ‘Figure 4-source data-3 mosquito half infection time calculation by SPSS.spv’ and ‘Figure 4-source data-5 mosquito half infection time calculation by SPSS.spv’ show the calculation of p-value and half-infection time with IBM SPSS version 21 software; ‘Figure 4-source data-3 mosquito half infection time calculation by SPSS.docx’ and ‘Figure 4-source data-3 mosquitoes P value and half infection time.docx’ show the analysis of half-infection time with IBM SPSS, and summary of p-value and half-infection time; ‘Figure 4-source data-5 mosquito half infection time calculation by SPSS.docx’ and ‘Figure 4- source data-5 mosquitoes P value and half infection time.docx’ show the analysis of half-infection time with IBM SPSS, and summary of p-value and half-infection time.
- https://cdn.elifesciences.org/articles/77584/elife-77584-fig4-data1-v1.zip
Appendix 1—figure 1
PCR validation of plasmid insertion in mosquito lines.
Primer pairs used for PCR reactions are indicated on top of each lane (sequences provided in Appendix 1—table 5, Appendix 1—table 6, and Appendix 1—table 7; position of primers indicated in Figure 1A…
-
Appendix 1—figure 1—source data 1
‘Appendix 1-Figure 1-DNA gel of PCR verification 1.tif and Appendix 1-Figure 1-DNA gel of PCR verification 2.tif’ are the original DNA gel for Appendix 1—figure 1.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig1-data1-v1.zip
Appendix 1—figure 2
Fitness analysis of An. stephensi transgenic lines.
(A, B) Survival curves for wild-type (WT) and transgenic (see Figure 1A) females that received one blood meal on day 2 (A) and males (B), all maintained on sugar meal. No significant differences in …
-
Appendix 1—figure 2—source data 1
Source data of Appendix 1—figure 2A, B, C, D, E and F.
‘Appendix 1-Figure 2-source data.xlsx’ is the original data for Appendix 1—figure 2A–E; ‘Appendix 1-Figure 2-source data.pzf’ shows that Appendix 1—figure 2A–F were generated with GraphPad Prism; ‘Appendix 1-Figure 2-source data-Female Survival Curve P value.pzf’ and ‘Appendix 1-Figure 2-source data-Male survival curve P value.pzf’ shows the calculation of p-value with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig2-data1-v1.zip
Appendix 1—figure 3
Fitness analysis of An. stephensi transgenic lines in combination or not with paratransgenesis.
(A, B) Survival curves for wild-type (WT) and transgenic (see Figure 1A) females in combination or not with paratransgenesis that received one blood meal on day 2 (A), and males (B), all maintained …
-
Appendix 1—figure 3—source data 1
Source data of Appendix 1—figure 3B.
‘Appendix 1-Figure 3A and B-source data-life span.pzf’ shows that Appendix 1—figure 3A and B were generated with GraphPad Prism; ‘Appendix 1-Figure 3-source data-Female Survival Curve P value.pzf’ and ‘Appendix 1-Figure 3-source data-Male Survival Curve P value.pzf’ show the calculation of p-value for Appendix 1—figure 3A and B with GraphPad Prism, respectively; ‘Appendix 1-Figure 3C and D-source data-fecundity and fertility.pzf’ was generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig3-data1-v1.zip
Appendix 1—figure 4
Assay of bacteria released by mosquitoes during feeding.
(A) Two-day-old mosquitoes were fed overnight on 107 Serratia-GFP/ml of 5% sugar plus food dye. Mosquitoes carrying the food dye marker were maintained on sterile 5% sugar for 2 days. At this point, …
-
Appendix 1—figure 4—source data 1
‘Appendix 1-Figure 4B-source data-blood feeding in feeder.xlsx’ is the original colony-forming unit (CFU) data for Appendix 1—figure 4B; ‘Appendix 1-Figure 4B-source data-blood feeding in feeder.pzf’ shows that Appendix 1—figure 4B was generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig4-data1-v1.zip
Appendix 1—figure 5
Transgenesis and paratransgenesis strongly impair Plasmodium development in the mosquito midgut.
Two-day-old An. stephensi mosquitoes were fed (or not) overnight with wild-type or recombinant Serratia AS1-multi bacteria, as indicated. After 48 hr, all mosquito groups were fed on the same P. …
-
Appendix 1—figure 5—source data 1
‘Appendix 1-Figure 5-source data.pzf’ shows that Appendix 1—figure 5 was generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig5-data1-v1.zip
Appendix 1—figure 6
Immunoblotting showing the mosquito-expressed multiple-effector protein (detected with a scorpine antibody), and the bacteria-expressed MP2 peptide and scorpine, in midguts collected 1 day after an infected blood meal.
P: paratransgenesis; P+T: combination of paratransgenesis and transgenesis. Tubulin served as a loading control.
-
Appendix 1—figure 6—source data 1
Pictures of ‘Appendix 1-Figure 6-western blot-α-tubulin in midgut.tif,” ‘Appendix 1-Figure 6-western blot-multi-effectors (Scorpine antibody) in midgut.tif,’ ‘Appendix 1-Figure 6-western blot-scoprine in midgut.tif,’ and ‘Appendix 1-Figure 6-western blot-MP2 in midgut.tif’ are original images of Western blots detected with rabbit anti-α-tubulin antibody, mouse anti-scorpine, mouse anti-scorpine, and mouse anti-MP2.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig6-data1-v1.zip
Appendix 1—figure 7
Immunoblotting showing effector ingestion together with saliva during the probe.
WT and Sg/E female mosquitoes were fed with low melting agarose solution, and then MP2 and Scorpine peptides were detected in the mosquito midgut.
-
Appendix 1—figure 7—source data 1
Pictures of ‘Appendix 1-Figure 7-western blot-AAPP in midgut by digestion.tif,’ ‘Appendix 1-Figure 7-western blot-MP2 in midgut by digestion.tif,’ and ‘Appendix 1-Figure 7-western blot-Scorpine in midgut by digestion.tif’ are original images of Western blots detected with mouse anti-AAPP, mouse anti-MP2, and mouse anti-scorpine.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig7-data1-v1.zip
Appendix 1—figure 8
Sequences of the synthetic transgenes on the plasmid constructs for the transformation of Anopheles mosquito embryos.
Tables
Appendix 1—table 1
Transgene integration sites.
| Line | Integration site | Integration in gene |
|---|---|---|
| Mg1 | AsteS1:KB664810:1:1229869:1 | No |
| Mg2 | AsteS1:KB664721:1:1159608:1 | No |
| Sg1 | AsteS1:KB664422.1 | No |
| Sg2 | AsteS1:KB664506.1 | No |
| AsteS1: KB664514.1 | Gamma-glutamyltranspeptidase (ASTE010947) | |
| AsteS1: KB664921.1 | No | |
| E1 | AsteS1:KB664810:1:1229869:1 | No |
| E2 | AsteS1:KB664810:1:1229869:1 | No |
| AsteS1:KB664538:1:382792:1 | No |
-
Integration site: AsteS1; contig number: precision site.
Appendix 1—table 2
Verification of transgene homozygosity.
| Mosquito line | Larva numbers | Red | Yellow | Blue |
|---|---|---|---|---|
| Mg1 | 412 | 412 | ||
| Mg2 | 276 | 276 | ||
| Sg1 | 178 | 178 | ||
| Sg2 | 329 | 329 | ||
| E1 | 206 | 206 | ||
| E2 | 378 | 378 | ||
| Mg/E1 | 262 | 262 | 262 | |
| Mg/E2 | 198 | 198 | 198 | |
| Sg/E1 | 307 | 307 | 307 | |
| Sg/E2 | 345 | 345 | 345 | |
| Mg/Sg/E1 | 228 | 228 | 228 | 228 |
| Mg/Sg/E2 | 361 | 361 | 361 | 361 |
-
A total of 20 transgenic female mosquitoes from each line were mated with wild-type males and the progeny larvae assayed for expression of the dominant eye fluorescence marker. No non-fluorescent larvae were found, indicating that the females were homozygous for the transgenes.
Appendix 1—table 3
Expression of MP2 and scorpine mRNAs relative to the endogenous AsAper mRNA, quantified by qRT-PCR in the midgut of transgenic mosquitoes.
| Mosquito lines | Relative expression in midgut | ||
|---|---|---|---|
| AsAper | Scorpine | MP2 | |
| E | 1.0 ± 0.2 | N | N |
| Mg/E | 1.0 ± 0.3 | 44.3 ± 10.7 | 49.3 ± 16.7 |
| Mg/Sg/E | 1.0 ± 0.2 | 56.1 ± 8.7 | 35.6 ± 8.9 |
-
The rpS7 gene was used as reference, and WT mosquitoes were used as negative controls. Identification of mosquito lines provided in Figure 1A. N: transcript not detected. Data pooled from three independent biological experiments. Mean ± SD.
Appendix 1—table 4
Relative expression of MP2 and scorpine mRNAs relative to the endogenous AsAAPP mRNA quantified by qRT-PCR in the salivary glands of transgenic mosquitoes.
| Mosquito lines | Relative expression in salivary gland | ||
|---|---|---|---|
| AsAAPP | Scorpine | MP2 | |
| E | 1.0 ± 0.2 | N | N |
| Sg/E | 1.0 ± 0.1 | 27.3 ± 15.6 | 49.1 ± 7.6 |
| Mg/Sg/E | 1.0 ± 0.3 | 62.5 ± 9.3 | 140.2 ± 38.3 |
-
The rpS7 gene was used as reference, and WT mosquitoes were used as negative controls. Identification of mosquito lines provided in Figure 1A. Data pooled from three independent experiments. Mean ± SD.
-
N: transcript not detected.
Appendix 1—table 5
Serratia is horizontally (sexually) transmitted.
| Males carrying AS1-multi | Females(mated/virgin) | Female CFUs | ||
|---|---|---|---|---|
| Spermatheca | Midgut | Ovary | ||
| WT | WT mated | 0 | 0 | 0 |
| Transgenic | Transgenic mated | 0 | 0 | 0 |
| WT | WT virgin | 3.9 ± 4.7 | 115 ± 118 | 11 ± 7.7 |
| Transgenic | Transgenic virgin | 2.9 ± 4.7 | 104 ± 111 | 8.7 ± 7.8 |
-
Newly emerged virgin male adult mosquitoes were fed overnight on 5% sugar solution containing 107 AS1-multi bacteria/ml and placed with females. Three days later, 10 females were assayed for the presence of Serratia AS1 by plating midgut, ovary, and spermatheca homogenates on apramycin/ampicillin agar plates and colonies were counted. Transgenic mosquito: Mg/Sg/E. Mated females were used as controls as female mosquitoes mate only once in their lifetimes. Data pooled from three independent experiments. Mean ± SD.
-
CFU: colony-forming unit.
Appendix 1—table 6
Vectors used in this research.
| Vectors | Reference/notes |
|---|---|
| phsp-pBac | (Handler and Harrell, 1999) |
| pXL-BACII-DsRed-AAPP-QF2-hsp70 | (Potter et al., 2010b) |
| pXL-BACIIECFP-15XQUAS-TATA-PAI-SV40 | Potter et al., 2010b |
| pXL-BACII- DsRed-Aper-QF2-Hsp70 | Mg QF2 driver plasmid |
| pXL-BAC-YFP-AAPP promoter-QF2-Hsp70 | Sg QF2 driver plasmid 2575 |
| pXL-BACIIECFP-15XQUAS-TATA-MP2-SV40-15XQUAS-TATA-Scorpine-SV40 | QUAS-MP2-Scorpine effector plasmid |
| pBAM2-YFP | DNA template for YFP |
Appendix 1—table 7
Oligonucleotide primers used in this study.
| Primer | Sequence (5′–3′) | Notes |
|---|---|---|
| MgPF | ATCAATGTATCTCGAGTACCGGCAATACTGGTTGTTGAGG | MgPF and MgPR to amplify midgut promoter that was inserted to construct MG QF2 driver plasmid, restriction site XhoI |
| MgPR | GTTGGCCGGCCTCGAGGATGAGAATGTTAGATGCCGCGAGTTG | |
| YFPF | GGGCCCGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGA | YFPF and YFPR to amplify YFP that was inserted to ApaI and NotI sites, then SgPF and SgPR to amplify salivary gland promoter that was inserted to construct SG QF2 driver plasmid at site XhoI |
| YFPR | GCGGCCGCTACTTGTACAGCTCGTCCA | |
| SgPF | ATCAATGTATCTCGAGGGACTTCGCGTCGGTAGTAG | |
| SgPR | GTTGGCCGGCCTCGAGCGTTTATTCACCTGTGAGCTATGG | |
| MP2-ScopineF | GCGGCCGCGGCTCGAGATGGTGCGATTAAACAGTGCA | MP2-ScopineF and MP2-ScopineR to amplify effectors genes that were inserted to construct QUAS-E plasmid, restriction site XhoI |
| MP2-ScopineR | AGATCGACGTCTCGAGTTAGTAGGAGAGTGGAGTAC | |
| AAPPF | GTACGAAGAGTGCAGCAAGG | For RT-PCR: AsAAPP gene |
| AAPPR | TCGATGAGTCCCTCGTCAAG | |
| PorF | AATGACTCCCAGAAGCAGTG | For RT-PCR: AsAper1 gene |
| PorR | ACTTCACTCTTCACACTGCG | |
| SC1 | GCGGGTTGGATCAATGAG | For RT-PCR: scorpine gene |
| SC2 | AGTTAGTAGGAGAGTGGA | |
| MPF | GTCGAAGCGGCCTGCTAC | For RT-PCR: MP2 gene |
| MPR | AGATCGACGTTTAGGAGC | |
| S7F | CTAACGACACGAAGACCACAAGA | For RT-PCR: S7 gene |
| S7R | CAACCTGCAACGAAGCAAAA | |
| YS1 | AGGACCCTGAAGTTCATCTG | For verification of SG QF2 driver plasmid insertion |
| YS2 | CTTCGGGCATGGCGGACTTG | |
| DM1 | GTGAACTTCCCCTCCGACG | For verification of MG QF2 driver plasmid insertion |
| DM2 | TCAGCTTCAGGGCCTTGTG | |
| E1 | AAAATCCAAAAGAAAATCGATGAGC | For verification of QUAS-MP2-QUAS scorpine effector plasmid insertion |
| E2 | GAGTGGAGTACCACACTTGCAT | |
| SPLNK#1 | CGAAGAGTAACCGTTGCTAGGAGAGACG | Primers for Splinkerette PCR |
| SPLNK#2 | GTGGCTGAATGAGACTGGTGTCGAC | |
| pBacRE#1 | CGATATACAGACCGATAAAACACATGCGTC | |
| pBacLE #2 | GCGACTGAGATGTCCTAAATGCAC |
Appendix 1—table 8
Plasmid injection and screening for transformants.
| Donor plasmid | Helper | # embryos injected | # G0 (number of survivors) | Pools | Pools with positive progeny |
|---|---|---|---|---|---|
| MG QF2 driver plasmid | phsp-pBac | 440 | 35 | 17 | P1 and P2 |
| SG QF2 driver plasmid | phsp-pBac | 500 | 19 | 8 | P1 and P5 |
| QUAS-MP2-Scorpine effector plasmid | phsp-pBac | 547 | 43 | 22 | P1 and P2 |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/77584/elife-77584-transrepform1-v1.docx
-
Source data 1
Source data of Figures 1—4, Appendix 1—figures 1–7.
- https://cdn.elifesciences.org/articles/77584/elife-77584-data1-v1.zip
-
Appendix 1—figure 1—source data 1
‘Appendix 1-Figure 1-DNA gel of PCR verification 1.tif and Appendix 1-Figure 1-DNA gel of PCR verification 2.tif’ are the original DNA gel for Appendix 1—figure 1.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig1-data1-v1.zip
-
Appendix 1—figure 2—source data 1
Source data of Appendix 1—figure 2A, B, C, D, E and F.
‘Appendix 1-Figure 2-source data.xlsx’ is the original data for Appendix 1—figure 2A–E; ‘Appendix 1-Figure 2-source data.pzf’ shows that Appendix 1—figure 2A–F were generated with GraphPad Prism; ‘Appendix 1-Figure 2-source data-Female Survival Curve P value.pzf’ and ‘Appendix 1-Figure 2-source data-Male survival curve P value.pzf’ shows the calculation of p-value with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig2-data1-v1.zip
-
Appendix 1—figure 3—source data 1
Source data of Appendix 1—figure 3B.
‘Appendix 1-Figure 3A and B-source data-life span.pzf’ shows that Appendix 1—figure 3A and B were generated with GraphPad Prism; ‘Appendix 1-Figure 3-source data-Female Survival Curve P value.pzf’ and ‘Appendix 1-Figure 3-source data-Male Survival Curve P value.pzf’ show the calculation of p-value for Appendix 1—figure 3A and B with GraphPad Prism, respectively; ‘Appendix 1-Figure 3C and D-source data-fecundity and fertility.pzf’ was generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig3-data1-v1.zip
-
Appendix 1—figure 4—source data 1
‘Appendix 1-Figure 4B-source data-blood feeding in feeder.xlsx’ is the original colony-forming unit (CFU) data for Appendix 1—figure 4B; ‘Appendix 1-Figure 4B-source data-blood feeding in feeder.pzf’ shows that Appendix 1—figure 4B was generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig4-data1-v1.zip
-
Appendix 1—figure 5—source data 1
‘Appendix 1-Figure 5-source data.pzf’ shows that Appendix 1—figure 5 was generated with GraphPad Prism.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig5-data1-v1.zip
-
Appendix 1—figure 6—source data 1
Pictures of ‘Appendix 1-Figure 6-western blot-α-tubulin in midgut.tif,” ‘Appendix 1-Figure 6-western blot-multi-effectors (Scorpine antibody) in midgut.tif,’ ‘Appendix 1-Figure 6-western blot-scoprine in midgut.tif,’ and ‘Appendix 1-Figure 6-western blot-MP2 in midgut.tif’ are original images of Western blots detected with rabbit anti-α-tubulin antibody, mouse anti-scorpine, mouse anti-scorpine, and mouse anti-MP2.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig6-data1-v1.zip
-
Appendix 1—figure 7—source data 1
Pictures of ‘Appendix 1-Figure 7-western blot-AAPP in midgut by digestion.tif,’ ‘Appendix 1-Figure 7-western blot-MP2 in midgut by digestion.tif,’ and ‘Appendix 1-Figure 7-western blot-Scorpine in midgut by digestion.tif’ are original images of Western blots detected with mouse anti-AAPP, mouse anti-MP2, and mouse anti-scorpine.
- https://cdn.elifesciences.org/articles/77584/elife-77584-app1-fig7-data1-v1.zip
