A neutrophil–B-cell axis impacts tissue damage control in a mouse model of intraabdominal bacterial infection via Cxcr4
- Department of Medicine I, Laboratory of Infection Biology, Medical University Vienna, Austria
- Ce-M-M-, Research Center for Molecular Medicine of the Austrian Academy of Sciences, Austria
- Department of Laboratory Medicine, Medical University of Vienna, Austria
- Department of Medicine II, Division of Cardiology, Medical University of Vienna, Austria
- Department of Pathology, Medical University Vienna, Austria
- Newcastle Fibrosis Research Group, Biosciences Institute, Newcastle University, United Kingdom
- Polypharma Biologics, Netherlands
Figures
Figure 1 with 1 supplement
LPS pre-exposure induces long-term disease tolerance during Gram-negative sepsis.
(A) E. coli colony forming units (CFU) 18 hr post-infection (p.i.) in peritoneal lavage fluid (PLF) and liver of mice, which were pretreated with lipopolysaccharide (LPS) or saline (NaCl) at …
Figure 1—figure supplement 1
LPS pre-exposure induces long-term disease tolerance during Gram-negative sepsis.
(A) Blood E. coli CFUs 18 hr p.i. with E. coli of mice, pretreated with lipopolysaccharide (LPS) or NaCl 2 weeks before infection. (B–C) Peritoneal lavage fluid (PLF) and plasma cytokine and …
Figure 2 with 1 supplement
B cells regulate disease tolerance during sepsis independent of early inflammatory responses.
(A) Aspartate aminotransferase (ASAT) plasma levels at 18 hr p.i. with E. coli, of lipopolysaccharide (LPS) or NaCl pretreated wildtype or lymphocyte deficient mice (Rag2-/-), which have received …
Figure 2—figure supplement 1
B cells regulate disease tolerance during sepsis independent of early inflammatory responses.
(A) Aspartate aminotransferase (ASAT) plasma levels 18 hr p.i. with E. coli of NaCl or lipopolysaccharide (LPS) pretreated wild type (WT) and Rag2-/- mice. (B) E. coli CFUs in livers and peritoneal …
Figure 3 with 1 supplement
Disease tolerance is associated with rearranged B cell compartments.
(A) Flow-cytometric analysis of B and T cells in the spleen of mice treated with lipopolysaccharide (LPS) or NaCl 2 weeks earlier. (B) Flow-cytometric analysis of B cells in spleens of Rag2-/- mice …
Figure 3—figure supplement 1
Disease tolerance is associated with rearranged B cell compartments.
(A) Spleen weight of mice, which were treated with NaCl or lipopolysaccharide (LPS) 2 weeks earlier. (B) Nucleated cells per femur of mice treated with NaCl or LPS 2 weeks earlier. (C) Gating …
Figure 4 with 1 supplement
B cells impact neutrophils, the key effectors driving sepsis-induced tissue damage.
(A) Aspartate aminotransferase (ASAT) plasma levels 18 hr p.i. with E. coli in lipopolysaccharide (LPS) or NaCl pretreated mice, in which platelets, monocytes/macrophages, or neutrophils, …
Figure 4—figure supplement 1
B cells impact neutrophils, the key effectors driving sepsis-induced tissue damage.
(A) Peritoneal lavage fluid (PLF) cell numbers of uninfected mice and mice 18 hr p.i. with E. coli, which received an anti-Ly-6G depletion antibody i.v. 24 hr before infection. (B) Flow-cytometric …
Figure 5 with 1 supplement
Neutrophil tissue damaging properties are modulated by bone marrow B cells via Cxcr4.
(A) Principle componen analysis (PCA) of the top 1000 most variable genes expressed by neutrophils isolated from blood or bone marrow, of mice pretreated with lipopolysaccharide (LPS) or NaCl 2 …
Figure 5—figure supplement 1
Neutrophil tissue damaging properties are modulated by bone marrow B cells via Cxcr4.
(A) Gating strategy applied for neutrophil sorting from blood and bone marrow. (B–C) Hierarchical clustering of differentially expressed gene (DEG) of blood and bone marrow neutrophils from mice …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, female) | C57BL/6 J | Own colony, Jackson Labs | JAX #000664 | |
| Strain, strain background (Mus musculus, female) | B6;129P-Nfkb1tm1Bal/J (Nfkb1-/-) | Provided by Derek Mann (Newcastle University, UK), Jackson Labs | JAX #002849, (Sha et al., 1995) | |
| Strain, strain background (Mus musculus, female) | B6.Cg-Rag2tm1.1Cgn/J (Rag2-/-) | Own colony, Jackson Labs | JAX #008449, (Hao and Rajewsky, 2001) | |
| Strain, strain background (Mus musculus, female) | B6.129P2-Igh-Jtm1Cgn/J (JHT) | Own colony, Jackson Labs | JAX #002438, (Gu et al., 1993) | |
| Strain, strain background (Mus musculus, female) | B6;129S4-Ighmtm1Che/J (Ighm-/-) | Own colony, Jackson Labs | JAX #003751, (Boes et al., 1998) | |
| Strain, strain background (Mus musculus, female) | B6.129S2-Ifnar1tm1Agt/Mmjax (Ifnar1-/-) | Own colony, Jackson Labs | MMRRC Strain #032045-JAX, (Müller et al., 1994) | |
| Strain, strain background (Mus musculus, female) | C57BL/6-Tg(UBC-GFP)30Scha/J (UBI-GFP) | Own colony, Jackson Labs | JAX #004353, (Schaefer et al., 2001) | |
| Strain, strain background (E. coli) | E. coli, O18:K1 | Clinical isolate | n.a. | |
| Antibody | Ultra-LEAF anti-mouse Ly-6G (rat monoclonal) | BioLegend | Cat# 127650; RRID:AB_2572002 | ‘1 mg/mouse’ i.v. |
| Antibody | anti-mouse GPIbα (CD42b) (rat monoclonal) | Emfret | Cat# R300; RRID:AB_2721041 | ‘40 μg/mouse’ i.v. |
| Antibody | anti-mouse CD4 (rat monoclonal) | Generated in house, clone GK1.5 | n.a. | ‘200 μg/mouse’ i.v. |
| Antibody | anti-mouse CD8 (rat monoclonal) | Generated in house, clone YTS169 | n.a. | ‘400 μg/mouse’ i.v. |
| Antibody | PE anti-mouse CD61 (armenian hamster monoclonal) | BioLegend | Cat# 104307; RRID:AB_313084 | FC ‘(1:200)’ |
| Antibody | BV510 anti-mouse CD45 (rat monoclonal) | BioLegend | Cat# 103138; RRID:AB_2563061 | FC ‘(1:200)’ |
| Antibody | APC/Cy7 anti-mouse TER-119 (rat monoclonal) | BioLegend | Cat# 116223; RRID:AB_2137788 | FC ‘(1:200)’ |
| Antibody | FITC anti-mouse CD3 (rat monoclonal) | BioLegend | Cat# 100204; RRID:AB_312661 | FC ‘(1:200)’ |
| Antibody | PerCP/Cy5.5 anti-mouse CD4 (rat monoclonal) | BioLegend | Cat# 100433; RRID:AB_893330 | FC ‘(1:100)’ |
| Antibody | Pacific Blue anti-mouse CD8a (rat monoclonal) | BioLegend | Cat# 100728; RRID:AB_493426 | FC ‘(1:200)’ |
| Antibody | FITC anti-mouse CD19 (rat monoclonal) | BioLegend | Cat# 115506; RRID:AB_313641 | FC ‘(1:200)’ |
| Antibody | BV605 anti-mouse CD19 (rat monoclonal) | BioLegend | Cat# 115540; RRID:AB_2563067 | FC ‘(1:200)’ |
| Antibody | PE anti-mouse CD19 (rat monoclonal) | BioLegend | Cat# 115507; RRID:AB_313642 | FC ‘(1:200)’ |
| Antibody | PE anti-mouse IgD (rat monoclonal) | BioLegend | Cat# 405706; RRID:AB_315028 | FC ‘(1:200)’ |
| Antibody | eFluor450 anti-mouse IgM (rat monoclonal) | eBioscience, Thermo Fisher | Cat# 48-5890-80; RRID:AB_10671342 | FC ‘(1:200)’ |
| Antibody | FITC anti-mouse CD23 (rat monoclonal) | BioLegend | Cat# 101606; RRID:AB 312831 | FC ‘(1:100)’ |
| Antibody | PerCP/Cy5.5 anti-mouse CD21/CD35 (CR2/CR1) (rat monoclonal) | BioLegend | Cat# 123416; RRID:AB_1595490 | FC ‘(1:100)’ |
| Antibody | APC anti-mouse CD43 (rat monoclonal) | BioLegend | Cat# 143208; RRID:AB_1114965 | FC ‘(1:200)’ |
| Antibody | PE/Cy7 anti-mouse Ly-6G (rat monoclonal) | BioLegend | Cat# 127617; RRID:AB_1877262 | FC ‘(1:200)’ |
| Antibody | PE anti-mouse Ly6G (rat monoclonal) | BioLegend | Cat# 127608; RRID:AB_1186099 | FC ‘(1:200)’ |
| Antibody | Brilliant Violet 605 anti-mouse Ly-6C (rat monoclonal) | BioLegend | Cat# 128036; RRID:AB_2562353 | FC ‘(1:200)’ |
| Antibody | Alexa Fluor 700 anti-mouse CD11b (rat monoclonal) | BioLegend | Cat# 101222; RRID:AB_493705 | FC ‘(1:200)’ |
| Antibody | PE anti-mouse CD62L (rat monoclonal) | BD Biosciences | Cat# 553151; RRID:AB_394666 | FC ‘(1:200)’ |
| Antibody | APC anti-mouse Cxcr4 (rat monoclonal) | BioLegend | Cat# 146507; RRID:AB_2562784 | FC ‘(1:200)’ |
| Antibody | anti-mouse NIMP-R14 (rat monoclonal) | Abcam | Cat# ab2557-50; RRID:AB_303154 | IHC ‘(1:50)’ |
| Antibody | Biotin anti-rat IgG (goat polyclonal) | BioRad | Cat# STAR131B; RRID:AB_11152774 | IHC ‘(1:200)’ |
| Antibody | anti-mouse F4/80 (rat monoclonal) | AbD Serotec | Cat# MCA497G; RRID:AB_872005 | IHC ‘(1:200)’ |
| Antibody | Biotin anti-rat IgG (goat polyclonal) | Vector Laboratories | Cat# BA-4001; RRID:AB_10015300 | IHC ‘(1:200)’ |
| Antibody | anti-mouse IgM (goat polyclonal) | Sigma-Aldrich | Cat# M8644; RRID:AB_260700 | ELISA ‘(2 μg/mL)’ |
| Antibody | anti-mouse IgM, κ isotype control antibody (mouse monoclonal) | BioLegend | Cat# 401602 | ELISA ‘(0,781–50 ng/mL)’ |
| Antibody | Alkaline phosphatase anti-mouse IgM, (goat polyclonal) | Sigma-Aldrich | Cat# A9688; RRID:AB_258472 | ELISA ‘(1:20000)’ |
| Antibody | anti-mouse CD16/32 (rat monoclonal) | BioLegend | Cat# 101320; RRID:AB_1574975 | FC ‘(1:50)’ |
| Sequence-based reagent | mouse Cxcr4 fwd | This study | PCR primers, Microsynth | TGCAGCAGGTAGCAGTGAAA |
| Sequence-based reagent | mouse Cxcr4 rev | This study | PCR primers, Microsynth | TGTATATACTCACACTGATCGGTCC |
| Sequence-based reagent | mouse Gapdh fwd | This study | PCR primers, Microsynth | GGTCGTATTGGGCGCCTGGTCACC |
| Sequence-based reagent | mouse Gapdh rev | This study | PCR primers, Microsynth | CACACCCATGACGAACATGGGGGC |
| Peptide, recombinant protein | Bovine serum albumin | Sigma-Aldrich | Cat# A8806 | |
| Peptide, recombinant protein | Protease Type XIV | Sigma-Aldrich | Cat# P5147 | |
| Commercial assay or kit | Mouse IL-6 ELISA | BioLegend | Cat# 431301 | |
| Commercial assay or kit | Mouse Cxcl1/KC DuoSet ELISA | R&D Systems | Cat# DY453 | |
| Commercial assay or kit | Mouse IL-1β ELISA | BioLegend | Cat# 432601 | |
| Commercial assay or kit | Mouse Ccl2/MCP-1 DuoSet ELISA | R&D Systems | Cat# DY479 | |
| Commercial assay or kit | Avidin/Biotin blocking kit | Vector Labs | Cat# SP-2001 | |
| Commercial assay or kit | Vectastain ABC kit | Vector Labs | Cat# PK-6100 | |
| Commercial assay or kit | DAB Subtrate kit | Vector Labs | Cat# SK-4100 | |
| Commercial assay or kit | RNeasy Plus micro kit | Gibco | Cat# 74034 | |
| Commercial assay or kit | iScript cDNA Synthesis kit | BioRad | Cat#170–8891 | |
| Commercial assay or kit | iTaq Universal SYBR Green Supermix | BioRad | Cat#172–5124 | |
| Commercial assay or kit | TECHNOTHROMBIN TGA Assay | Technoclone | Cat#5006010 | |
| Chemical compound, drug | Lipopolysaccharide purified from E. coli O55:B5 | Sigma-Aldrich | cat# L2880 | |
| Chemical compound, drug | Endotoxin-free PBS, pH 7.4 | Gibco | Cat# 11503387 | |
| Chemical compound, drug | Fixable Viability Dye eFluor 780 | ThermoFisher, eBioscience | Cat# 65-0865-14 | FC ‘(1:3000)’ |
| Chemical compound, drug | NaCl | Carl Roth | Cat# 0601.1 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | Cat# E5134 | |
| Chemical compound, drug | TRIS | VWR Chemicals | Cat# 28808.294 | |
| Chemical compound, drug | MgCl2 | Sigma Aldrich | cat# M8266 | |
| Chemical compound, drug | CaCl2 | Sigma Aldrich | cat# C3306 | |
| Chemical compound, drug | Triton X-100 | Sigma-Aldrich | cat# T9284 | |
| Chemical compound, drug | NH4Cl | Sigma-Aldrich | cat# 09718 | |
| Chemical compound, drug | KHCO3 | Carl Roth | cat# P748.1 | |
| Chemical compound, drug | Na2EDTA | Sigma-Aldrich | cat# 324503 | |
| Chemical compound, drug | RLT Plus Buffer | Qiagen | cat# 1053393 | |
| Chemical compound, drug | β-mercaptoethanol | Sigma-Aldrich | cat# M3148 | |
| Chemical compound, drug | Formalin 7.5% | SAV LP GmbH | cat# FN-60180-75-1 | |
| Chemical compound, drug | Citrate based antigen unmasking solution | Vector laboratories | cat# H3300 | |
| Chemical compound, drug | Eosin Y Solution | Sigma-Aldrich | cat# 318906 | |
| Chemical compound, drug | Hematoxylin solution (Mayer´s) | Sigma-Aldrich | Cat# MHS16 | |
| Chemical compound, drug | Mayer´s Hemalum solution | Merck | cat# 654833 | |
| Chemical compound, drug | Clodronate loaded liposomes | http://www.clodronateliposomes.org | cat# C-010 | |
| Chemical compound, drug | Protease inhibitor cocktail | Sigma-Aldrich | cat# P8340 | |
| Chemical compound, drug | RNase Inhibitor | Takara/Clonentech | cat# 2313 A | |
| Chemical compound, drug | Eukitt | Sigma-Aldrich | cat# 03989 | |
| Chemical compound, drug | Lumi Phos plus | Lumigen, Beckmann Coulter | cat# P-701 | |
| Chemical compound, drug | Antigen Unmasking Solution | Vector Labs | Cat# H3300-250 | |
| Software, algorithm | GraphPad Prism 9.1 | Graphpad Software, Inc. | https://www.graphpad.com | |
| Software, algorithm | FlowJo | Becton, Dickinson and Company | https://www.flowjo.com/ | |
| Software, algorithm | Bioconductor R package Genomic alignments | Lawrence et al., 2013 | ||
| Software, algorithm | DSeq2 | Love et al., 2014 | ||
| Software, algorithm | GOrilla | Eden et al., 2009 | ||
| Software, algorithm | ihw R package | Ignatiadis et al., 2016 | ||
| Software, algorithm | STAR aligner | Dobin et al., 2013 | ||
| Software, algorithm | Trimmomatic | Bolger et al., 2014 | ||
| Other | Columbia agar plates +5% sheep blood | Biomerieux | http://www.biomerieux-culturemedia.com/ | E. coli CFU counts |
| Other | Fetal Bovine Serum | Sigma | Cat# F9665 | Blocking and flow cytometry |
| Other | Goat Serum | Novus Biologicals | Cat# NBP2-23475 | Blocking |
Additional files
-
Supplementary file 1
DEG of blood neutrophils isolated from mice 2 weeks post NaCl or LPS treatment.
- https://cdn.elifesciences.org/articles/78291/elife-78291-supp1-v1.xlsx
-
Supplementary file 2
DEG of bone marrow neutrophils isolated from mice 2 weeks post NaCl or LPS treatment.
- https://cdn.elifesciences.org/articles/78291/elife-78291-supp2-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/78291/elife-78291-mdarchecklist1-v1.pdf
