1. Microbiology and Infectious Disease

Two enhancer binding proteins activate σ54-dependent transcription of a quorum regulatory RNA in a bacterial symbiont

  1. Ericka D Surrett
  2. Kirsten R Guckes
  3. Shyan Cousins
  4. Terry B Ruskoski
  5. Andrew G Cecere
  6. Denise A Ludvik
  7. C Denise Okafor
  8. Mark J Mandel
  9. Tim I Miyashiro  Is a corresponding author
  1. Department of Biochemistry and Molecular Biology, Pennsylvania State University, United States
  2. Department of Medical Microbiology and Immunology, University of Wisconsin-Madison, United States
  3. Department of Chemistry, Pennsylvania State University, United States
  4. The Microbiome Center, Huck Institutes of the Life Sciences, Pennsylvania State University, United States
https://doi.org/10.7554/eLife.78544
Share this article
Cite this article
  1. Ericka D Surrett
  2. Kirsten R Guckes
  3. Shyan Cousins
  4. Terry B Ruskoski
  5. Andrew G Cecere
  6. Denise A Ludvik
  7. C Denise Okafor
  8. Mark J Mandel
  9. Tim I Miyashiro
(2023)
Two enhancer binding proteins activate σ54-dependent transcription of a quorum regulatory RNA in a bacterial symbiont
eLife 12:e78544.
https://doi.org/10.7554/eLife.78544
  2. Download BibTeX
  3. Download .RIS
9 figures, 4 tables and 1 additional file

Figures

Figure 1
Download asset Open asset
Signal transduction network underlying quorum sensing in Vibrio fischeri.

Quorum sensing in V. fischeri depends on autoinducers 3-oxo-C6 HSL (3OC6 HSL), AI-2, and C8 HSL, which are synthesized by LuxI, LuxS, and AinS, respectively. Interaction of C8 HSL or AI-2 with their cognate sensors (AinR and LuxPQ, respectively), results in lower levels of phosphorylated LuxO. Phosphorylated LuxO promotes σ54-dependent transcription of qrr1, which encodes the sRNA Qrr1. Qrr1 post-transcriptionally represses LitR, which is a positive regulator of luxR. Consequently, quorum sensing inhibits Qrr1 expression, thereby promoting bioluminescence production. Figure generated with BioRender.com.

Figure 2 with 1 supplement
Download asset Open asset
BinK inhibits the expression of the sRNA Qrr1.

(A) Top, Tn5 insertion location within VF_A0360 (binK). Below, Green fluorescence images associated with ES114 (WT) and DRO22 (binK::Tn5) harboring pTM268 (Pqrr1::gfp) or pVSV105 (vector). Dotted circle indicates border of the spot of bacterial growth resulting from placing a cell suspension on the surface of solid rich medium and incubating the sample at 28°C for 24 hr. Scale bar = 1 mm. (B) Green fluorescence levels of TIM313 (WT Tn7::erm), MJM2481 (ΔbinK Tn7::erm), and TIM412 (ΔbinK Tn7::[binK erm]) harboring pTM268. Point = green fluorescence of a spot (N = 3), bar = group mean. Dotted line = autofluorescence cutoff. One-way analysis of variance (ANOVA; F2,6 = 466.9, p < 0.0001); Tukey’s post hoc test with p-values corrected for multiple comparisons (n.s. = not significant, ****p < 0.0001). (C) Signaling pathway for Syp-dependent biofilm formation in V. fischeri ES114. Phosphoryl groups are relayed (dotted arrows) from RscS to the HPT domain of SypF for phosphotransfer to SypG. SypG activates σ54-dependent transcription of the syp locus to promote biofilm formation. BinK negatively regulates this process and likely changes the phosphorylation of SypG (directly or indirectly). (D) Top, Bioluminescence assay of ES114 (WT), MJM2251 (ΔbinK), MJM1198 (rscS*), and MJM2255 (ΔbinK rscS*). Point = specific luminescence (RLU/OD600) of indicated strain at the indicated turbidity (OD600). Shown are points derived from a representative culture (N = 3). Experimental trials: 2.

Figure 2—source data 1

Source data for Figure 2B, D.

https://cdn.elifesciences.org/articles/78544/elife-78544-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Download asset Open asset
Analyses of bioluminescence assay described in Figure 2D.

Left, Point = peak specific bioluminescence derived from each culture, with bar = group mean. One-way analysis of variance (ANOVA) of log-transformed data revealed statistical significance among group means (F3,8 = 306.8, p < 0.0001); Tukey’s post hoc test with p-values corrected for multiple comparisons (same letter = not significant, different letters = p < 0.0001). Right, Point = fold change in specific bioluminescence from min to max, with bar = group mean. One-way ANOVA revealed statistical significance among group means (F3,8 = 56.23, p < 0.0001); Tukey’s post hoc test with p-values corrected for multiple comparisons (same letter = not significant, a/c = p < 0.05, c/d = p < 0.001, a/d = p < 0.0001).

Figure 3 with 1 supplement
Download asset Open asset
Qrr1 enhances the ability of V. fischeri to access crypt spaces.

(A) Left, experimental design of squid co-inoculation assays with YFP-labeled test strain and CFP-labeled wild-type competitor strain. Right, example image montage illustrating a light organ featuring populations comprised of cells expressing YFP or CFP. Dotted line = boundary of an individual population. Scale bar = 100 µm. Row of boxes below the image indicate the strain type(s) present within each predicted crypt space of the light organ; blue = CFP+ YFP−, green = YFP+ CFP−, hatched = CFP+ YFP+, white = CFP− YFP−. For panels B–E, experimental trials = 2. (B) Left, TIM305 (Δqrr1) as test strain. Right, ES114 (WT) as test strain. Each row represents an individual animal (N = 28). (C) Number of crypts colonized by indicated strains per squid in panel B. Wilcoxon test (****p < 0.0001, n.s. = not significant). (D) ΔbinK. Number of crypts colonized by MJM2251 (ΔbinK) as test strain. N = 27. Wilcoxon test (****p < 0.0001). (E) ΔbinK Δqrr1. Number of crypts colonized by EDR010 (ΔbinK Δqrr1) as test strain. N = 26. Wilcoxon test (*p < 0.05). (F) Aggregation assay with ES114 (WT), MJM2251 (ΔbinK), and EDR010 (ΔbinK Δqrr1) labeled with YFP. Top, merged brightfield and yellow fluorescence (green) images of aggregates (arrows) formed by indicated strains. LO = light organ. Scale bar = 200 µm. Bottom, quantification of aggregate size. Kruskal–Wallis (H = 16.79, d.f. = 3, p = 0.0008); Dunn’s post hoc test with p-values corrected for multiple comparisons (same letter = not significant, a/c and b/c = p < 0.05, a/b = p < 0.01). Experimental trials: 2.

Figure 3—source data 1

Source data for Figure 3B–F.

https://cdn.elifesciences.org/articles/78544/elife-78544-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Impact of Qrr1 on crypt colonization is independent of BinK.

Number of crypts colonized by MJM2251 (ΔbinK) as CFP-labeled strain and EDR010 (ΔbinK Δqrr1) as YFP-labeled strain. N = 28. Wilcoxon test (****p < 0.0001).

Figure 4 with 3 supplements
Download asset Open asset
SypG activates σ54-dependent transcription of qrr1.

(A) Proposed model of BinK-dependent regulation of Qrr1 expression. (B) Green fluorescence levels of ES114 (WT), MJM2251 (ΔbinK), KRG004 (ΔrpoN), and KRG011 (ΔbinK ΔrpoN) harboring pTM268 (Pqrr1::gfp). Dotted line = autofluorescence cutoff. One-way analysis of variance (ANOVA; F3,8 = 35.69, p < 0.0001); Tukey’s post hoc test with p-values corrected for multiple comparisons (same letter = not significant, different letters = p < 0.001). (C) Green fluorescence levels of ES114 (WT), MJM2251 (ΔbinK), TIM306 (ΔluxO), and (ΔbinK ΔluxO) harboring pTM268 (Pqrr1::gfp). Dotted line = autofluorescence cutoff. One-way ANOVA (F3,8 = 367.4, p < 0.0001). (D) Green fluorescence levels of MJM2251 (ΔbinK), EDR009 (ΔbinK ΔluxO), EDR014 (ΔbinK ΔsypG), and EDR013 (ΔbinK ΔluxO ΔsypG) harboring pTM268 (Pqrr1::gfp). Dotted line = autofluorescence cutoff. One-way ANOVA (F3,8 = 60.66, p < 0.0001). (E) Green fluorescence levels of ES114 (WT), MJM2251 (ΔbinK), MJM4982 [sypG(D53E)], and MJM4983 [ΔbinK sypG(D53E)] harboring pTM268 (Pqrr1::gfp). Dotted line = autofluorescence cutoff. One-way ANOVA (F3,8 = 3921, p < 0.0001). (F) Green fluorescence levels of TIM313 (WT), EDS008 (ΔluxO ΔsypG), and EDS010 (ΔluxO ΔsypG Ptrc::sypG) harboring pEDR003 (Pqrr1::gfp) and grown on 150 µM IPTG. Dotted line = autofluorescence cutoff. One-way ANOVA (F2,6 = 438.8, p < 0.0001).

Figure 4—source data 1

Source data for Figure 4B–F.

https://cdn.elifesciences.org/articles/78544/elife-78544-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Comparisons of LuxO with other Class I bacterial enhancer binding proteins (bEBPs) encoded by V. fischeri.

Pairwise alignments of LuxO (top sequence) with indicated bEBP (bottom sequence) encoded by V. fischeri strain ES114. Amino acids highlighted in black or gray indicate identity and similarity, respectively.

Figure 4—figure supplement 2
Download asset Open asset
Alignment of SypG with LuxO crystal structure.

Left, overlay of homology models generated by MODELLER for the REC and AAA+ domains of LuxO (WP_011261589.1), SypG (WP_011263835.1), and NtrC (WP_011260965.1) with the crystal structure of the corresponding regions in the LuxO homolog of V. angustum (PDB 5EP0). Dotted box indicates the eight residues of the linker region between REC and AAA+ domains (cyan). The deviation within the corresponding region of NtrC is shown in red. Right, the region indicated by the box for the individual models of the indicated bacterial enhancer binding protein (bEBP). Sequences are the pairwise alignments of the eight amino acids associated with the V. angustum reference (top) and indicated bEBP (bottom).

Figure 4—figure supplement 3
Download asset Open asset
LuxO does not activate promoters of the syp locus in V. fischeri.

(A) Green fluorescence levels of ES114 (WT), MJM2251 (ΔbinK), EDR014 (ΔbinK ΔsypG), EDR009 (ΔbinK ΔluxO), EDR013 (ΔbinK ΔluxO ΔsypG), and CL59 (luxOD55E) harboring PsypA::gfp reporter plasmid pVF_A1020P. Dotted line = autofluorescence cutoff. One-way analysis of variance (ANOVA; F5,12 = 13.20, p = 0.0002). (B) Green fluorescence levels of ES114 (WT), MJM2251 (ΔbinK), EDR014 (ΔbinK ΔsypG), EDR009 (ΔbinK ΔluxO), EDR013 (ΔbinK ΔluxO ΔsypG), and CL59 (luxOD55E) harboring PsypP::gfp reporter plasmid pVF_A1035P. Dotted line = autofluorescence cutoff. One-way ANOVA (F5,12 = 61.10, p < 0.0001).

Figure 5
Download asset Open asset
SypG activity overrides inhibition of Pqrr1 activity by quorum sensing.

(A) Brightfield (top) and green fluorescence (bottom) images of representative spots of growth (N = 3) containing TIM313 (WT Tn7::erm), TIM303 (WT Tn7::[Pqrr1::gfp erm]), or EDS015 (ΔsypG Tn7::[Pqrr1::gfp erm]) harboring plasmid pKV69 (rscS* = −) or pKG11 (rscS* = +). Scale bar = 1 mm. (B) Brightfield images of representative spots of growth (N = 3) containing TIM303 (WT) or SSC005 (Δqrr1) harboring plasmid pKV69 (rscS* = −) or pKG11 (rscS* = +). Scale bar = 1 mm. (C) Green fluorescence of ES114 (WT) and JHK007 (ΔainS ΔluxIR) harboring Pqrr1::gfp reporter pTM268 (circles) and grown ± 100 nM C8 HSL. ES114 harboring pVSV105 was used as a non-fluorescent control (NF). Two-way analysis of variance (ANOVA) revealed statistical significance for strain (F2,12 = 2809, p < 0.0001), C8 treatment (F1,12 = 2233, p < 0.0001), and their interaction (F2,12 = 1480, p < 0.0001); Tukey’s post hoc test with p-values corrected for multiple comparisons (same letter = not significant, b/e = p < 0.05, a/d = p < 0.01, other combinations of different letters = p < 0.0001). (D) Green fluorescence images of representative spots of growth (N = 3) containing KRG016 (ΔainS ΔluxIR Tn7::Pqrr1::gfp) harboring plasmid pKG11 (rscS* = +) or pKV69 (rscS* = −) on medium ± 100 nM C8 HSL. Scale bar = 1 mm.

Figure 5—source data 1

Source data for Figure 5C.

https://cdn.elifesciences.org/articles/78544/elife-78544-fig5-data1-v1.xlsx
Figure 6
Download asset Open asset
SypG activates σ54-dependent transcription of qrr1.

(A) Elements within Pqrr1 that facilitate σ54-dependent transcriptional activation. Sequence corresponds to 13 bp UASLuxO-2, with nucleotides (−131)–(−129) that were individually mutated by site-directed mutagenesis shown in bold. (B) Green fluorescence levels of EDS010 (ΔluxO ΔsypG Tn7::[Ptrc::sypG erm]) harboring Pqrr1::gfp reporter plasmids pEDR003, pEDR011 (−355), pEDR010 (−262), pEDR012 (−209), pEDR006 (−175), pEDR009 (−106), and pEDR008 (−60). Dotted line = autofluorescence cutoff. One-way analysis of variance (ANOVA; F6,14 = 411.7, p < 0.0001). (C) Green fluorescence levels of TIM306 (ΔluxO) and CL59 (luxOD55E) harboring Pqrr1::gfp reporter plasmids pEDR003, pEDS004 (G−131T), pEDS005 (C−130A), and pEDS006 (A−129C). The luxOD55E encodes a variant of LuxO that exhibits high activity in colonies. Dotted line = autofluorescence cutoff. One-way ANOVA (F4,10 = 2998, p < 0.0001). (D) Green fluorescence levels of EDS008 (ΔluxO ΔsypG) and EDS010 (ΔluxO ΔsypG Tn7::Ptrc::sypG) harboring Pqrr1::gfp reporter plasmids pEDR003 (WT), pEDS004 (G−131T), pEDS005 (C−130A), and pEDS006 (A−129C). Dotted line = autofluorescence cutoff. One-way ANOVA (F4,10 = 712.5, p < 0.0001). (E–H) Squid colonization assays, with each graph showing the number of crypts colonized by CFP-labeled TIM313 (WT) and the indicated YFP-labeled test strain. The diagram above each graph illustrates the genetic composition of the qrr1 locus (top) and Tn7 integration site (bottom) in the corresponding test strain. Test strains are TIM313 (WT), KRG021 (Δqrr1), KRG018 (Pqrr1::qrr1), and (D) KRG019 (Pqrr1 (G−131T)::qrr1). Wilcoxon test (***p < 0.001, n.s. = not significant).

Figure 6—source data 1

Source data for Figure 6B–H.

https://cdn.elifesciences.org/articles/78544/elife-78544-fig6-data1-v1.xlsx
Figure 7 with 7 supplements
Download asset Open asset
Conservation of SypG-LuxO structural features in the Vibrionaceae family.

(A) Experimental design for visualizing the extent of identity conserved between the primary structures of LuxO and SypG homologs among different taxa. (B) Each block represents a multiple sequence alignment of LuxO homologs encoded within the indicated Fischeri clade members that has 481 amino acid positions including gaps. Positions marked by a black line indicate that the corresponding amino acid of the LuxO homolog is identical to that of SypG based on pairwise alignments. Shown below each block are the positions of amino acid identity that are conserved among the indicated taxa. (C) Each block represents a multiple sequence alignment of LuxO homologs encoded within the indicated Vibrionaceae members that has 489 amino acid positions including gaps. Positions marked by a black line indicate that the corresponding amino acid of the LuxO homolog is identical to that of SypG based on pairwise alignments. Shown below each block are the positions of amino acid identity that are conserved among the indicated taxa.

Figure 7—figure supplement 1
Download asset Open asset
Conservation of Qrr1 within the Fischeri clade.

Region between uvrB and luxO genes in indicated taxa were aligned by MEGA X. Highlighted positions indicate 100% identity across sequences. Line above alignment indicates positions predicted to encode a Qrr1 homolog. Accessions and regions analyzed: Vibrio fischeri = NC_006840.2 [complement(1033214.1033512)], Aliivibrio salmonicida = NC_011312.1 [complement(2009689.2009989)], Aliivibrio sifiae = NZ_MSCP01000001.1 [1631724.1632055], Aliivibrio wodanis = LN554846.1 [complement(1083567.1083879)], and Aliivibrio logei = NZ_MAJU01000008.1 [810639.810940].

Figure 7—figure supplement 2
Download asset Open asset
Conservation of gene synteny for luxO and sypG within the Fisheri clade.

(A) Gene synteny associated with luxO in the Fisheri clade. Top, region featuring luxO on chromosome 1 (NC_006840.2) of V. fischeri strain ES114. Bottom, progressiveMauve analysis of gene synteny associated with luxO for Fischeri clade members. Outlined regions indicate genomic blocks that are present in other taxa, with the interior plot indicating nucleotide similarity. Photobacterium phosphoreum was included as an outgroup. Accessions and regions analyzed: LN554846.1 [983877.1185307], NZ_MSCP01000001.1 [complement(1530329.1731726)], NC_006840.2 [933510.1134940], NZ_MAJU01000008.1 [complement(709196.910641)], NC_011312.1 [1909987.2111432], and NZ_MSCQ01000001.1 [complement(1671280.1872728)]. (B) Gene synteny associated with sypG in the Fisheri clade. Top, region featuring sypG on chromosome 2 (NC_006841.2) of V. fischeri strain ES114. Bottom, progressiveMauve analysis of gene synteny associated with sypG for Fischeri clade members. Outlined regions indicate genomic blocks that are present in other taxa, with the interior plot indicating nucleotide similarity. Photobacterium phosphoreum was included as an outgroup. Accessions and regions analyzed: LN554847.1 [1266858.1468330], NZ_MSCP01000002.1 [1390955.1592439], NC_006841.2 [1057508.1259010], NZ_MAJU01000009.1 [1.200000], NC_011313.1 [complement(241212.442708)], and NZ_MSCQ01000001.1 [complement(845650.1047125)].

Figure 7—figure supplement 3
Download asset Open asset
Pairwise alignments of LuxO (top sequence) and SypG (bottom sequence) homologs encoded by indicated Fischeri clade members.

Amino acids highlighted in black (gray) indicate identity (similarity).

Figure 7—figure supplement 4
Download asset Open asset
Multiple sequence alignment of LuxO homologs encoded by Fischeri clade members.

Amino acids highlighted in black or gray indicate identity and similarity, respectively, among 100% of sequences. Top to bottom: A. wodanis, A. sifiae, V. fischeri, A. logei, and A. salmonicida.

Figure 7—figure supplement 5
Download asset Open asset
Gene synteny associated with luxO in Vibrionaceae taxa with incomplete genomes.

Analysis of gene synteny by progressiveMauve for luxO encoded by indicated Vibrionaceae members. Outlined regions indicate genomic blocks that are present in other taxa, with the interior plot indicating nucleotide similarity. The gene cluster spanning uvrB-yvcK that contains luxO is indicated by the dashed outline. The regions linked to luxO for the fully assembled genomes of V. harveyi, P. phosphoreum, and V. fischeri are included for comparisons. Accessions and regions analyzed: NZ_RSFA01000020.1 [1.49638], NZ_BCUD01000001.1 [1.140875], NZ_POSL01000002.1 [complement(144684.346084)], NZ_CP009467.1 [complement(2563561.2764964)], NZ_SNZO01000002.1 [complement(542785.744227)], NZ_MSCQ01000001.1 [complement(1671280.1872728)], and NZ_MSCQ01000001.1 [complement(1671280.1872728)].

Figure 7—figure supplement 6
Download asset Open asset
Conservation of qrr gene within uvrB-luxO intergenic region among Vibrionaceae.

(A) Cartoon indicating length in bp of uvrB-luxO intergenic region for indicated taxa. Location of putative gene encoding a Qrr is denoted by the cyan arrow. (B) Sequences of homologs of Qrr1 (denoted by the black lines) encoded within the uvrB-luxO intergenic region of each indicated taxon. Each homolog was identified by first using the locations of the −24 (GGC) and −12 (GC) sites corresponding to σ54 binding sites to determine the putative transcriptional start site and then locating the thymidine repeat corresponding to the likely terminator sequence.

Figure 7—figure supplement 7
Download asset Open asset
Gene synteny associated with pepN among select Vibrionaceae.

Analysis of gene synteny by progressiveMauve for PepN homolog (identified by BLAST using WP_069687131.1) encoded by indicated Vibrionaceae members. Dotted line indicates pepN gene. Outlined regions indicate locally colinear blocks (LCBs) that are present in at least two taxa, with the interior plot indicating nucleotide similarity. Numbers identify the LCBs that were used to interpret gene synteny, with the arrows indicating the relative LCB orientation. The syp locus is indicated by the dashed outline and associated with LCB 4. V. harveyi and V. tubiashii feature the syp locus downstream of LCB 2. In contrast, the syp locus of V. vulnificus is in an opposite orientation and located between LCBs 3 and 1. Neither V. anguillarum nor V. cholerae feature a syp locus. Accessions and regions analyzed: NC_022223.1 [complement(1659437.1962043)], NC_002505.1 [complement(1452881.1755487)], NZ_CP009467.1 [complement(1843797.2146403)], NZ_CP009354.1 [1461021.1763627], and NC_014965.1 [complement(1499333.1801960)].

Figure 8 with 1 supplement
Download asset Open asset
SypG-dependent transcription of qrr1 for A. salmonicida.

Green fluorescence of EDS008 (control) and EDS021 (Tn7::sypGAS) harboring pAGC003 (Pqrr1AS::gfp). N = 3. Genotypes of both strains include ΔluxO and ΔsypG alleles, as well as erm integrated at the Tn7 site. EDS008 harboring pVSV105 was used as a non-fluorescent control (dotted line). A paired t-test revealed significance between groups (*p = 0.0325). Experimental trials: 2.

Figure 8—source data 1

Source data for Figure 8.

https://cdn.elifesciences.org/articles/78544/elife-78544-fig8-data1-v1.xlsx
Figure 8—figure supplement 1
Download asset Open asset
Conservation of the qrr1 locus among V. fischeri and A. salmonicida.

Pairwise alignment of luxO-uvrB intergenic region in V. fischeri (Vf) and A. salmonicida (As) generated by ClustalW in MEGA X, with identical nucleotides highlighted. Regions relevant to the expression of Qrr1 are labeled.

Figure 9
Download asset Open asset
Model of dual bacterial enhancer binding protein (bEBP) control over Qrr1 expression in V. fischeri.

(A) Left, cells in an environment with low autoinducer concentration, for example, low cell density, will express Qrr1 by activating LuxO through the quorum-sensing pathway. Middle, cells in an environment with high autoinducer concentration, for example, high cell density, will have low Qrr1 levels due to the inactive state of LuxO. Right, even under conditions of high autoinducer concentration, expression of Qrr1 can occur if SypG is activated by the aggregation pathway. (B) Model of initial entry of V. fischeri into the light organ. Planktonic cells within the environment express Qrr1 due to low autoinducer levels (panel A, box 1). Motion of the cilia associated with the appendages sweep bacteria into a stagnant zone, where they locally accumulate (panel A, box 2), which has the potential to lower Qrr1 expression. Within a few hours, the cells have formed aggregates that depend on SypG (panel A, box 3), which induces Qrr1 expression to prime cells for entry into the pores.

Tables

Table 1
LuxO and SypG homologs in Fischeri clade.
TaxonStrainLuxO homologAccessionSypG homologAccessionIdentitySimilarity
V. fischeriES114WP_011261589.1NC_006840.2WP_011263835.1NC_006841.2243/502 (48.41%)326/502 (64.94%)
A. salmonicidaLFI1238WP_173362130.1NC_011312.1WP_044583634.1NC_011313.1236/504 (46.83%)320/504 (63.49%)
A. sifiaeNBRC 105001WP_172794763.1NZ_MSCP01000001.1WP_105064188.1NZ_MSCP01000002.1238/495 (48.08%)316/495 (63.84%)
A. wodanisAWOD1CED71013.1LN554846.1CED57805.1LN554847.1238/494 (48.18%)321/494 (64.98%)
A. logei1S159WP_175365415.1NZ_MAJU01000008.1WP_065611272.1NZ_MAJU01000009.1238/504 (47.22%)319/504 (63.29%)
Table 2
LuxO and SypG homologs in Vibrionaceae clades.
CladeTaxonLuxO homolog*AccessionSypG homolog†AccessionIdentity‡Similarity‡
Salinivibrio-Grimontia-Enterovibrio§G. hollisaeWP_005503370.1NZ_CP014056N.D.—N.A.N.A.
RosenbergiiP. lutimarisWP_107348500.1NZ_SNZO01000002N.D.—N.A.N.A
ProfundumP. profundumWP_065814467.1NC_006370N.D.—N.AN.A
DamselaePhotobacterium damselae subsp. piscicidaWP_086957069.1NZ_AP018045N.D.—N.AN.A
PhosphoreumP. phosphoreumWP_045027808.1NZ_MSCQ01000001WP_105026695.1NZ_MSCQ01000001237/499 (47.49%)310/499 (62.93%)
FischeriV. fischeriWP_011261589.1NC_006840WP_011263835.1NC_006841243/502 (48.41%)326/502 (64.94%)
AnguillarumV. anguillarumWP_026028983.1NC_022223N.D.—N.AN.A
RumoiensisV. rumoiensisN.D.—N.D.—N.AN.A
VulnificusV. vulnificusWP_011149911.1NC_014965WP_013571858.1NC_014965247/508 (48.62%)320/508 (62.99%)
DiazotrophicusV. diazotrophicusWP_042486207.1NZ_POSL01000002N.D.—N.AN.A
GazogenesV. gazogenesWP_021019492.1NZ_CP018835N.D.—N.AN.A
PorteresiaeV. tritoniusWP_068714228.1NZ_AP014635N.D.—N.AN.A
CholeraeV. choleraeWP_001888250.1NC_002505N.D.—N.AN.A
HalioticoliV. breoganiiWP_065209630.1NZ_CP016177WP_065210697.1NZ_CP016178228/513 (44.44%)298/513 (57.70%)
SplendidusV. splendidusWP_004734031.1NZ_CP031055WP_065205220.1NZ_CP031055237/511 (46.38%)314/511 (61.45%)
PectenicidaV. pectenicidaWP_125320437.1NZ_RSFA01000020WP_125322971.1NZ_RSFA01000107237/501 (47.31%)321/501 (64.07%)
ScopthalmiV. ponticusWP_075650093.1NZ_AP019657WP_075649540.1NZ_AP019657229/506 (45.26%)319/506 (63.04%)
NereisV. nereisWP_061781622.1NZ_BCUD01000001N.D.—N.AN.A
OrientalisV. tubiashiiWP_038550519.1NZ_CP009354WP_004748949.1NZ_CP009354242/497 (48.69%)319/497 (64.19%)
CoralliilyticusV. coralliilyticusWP_019275536.1NZ_CP048693WP_021455926.1NZ_CP048693242/503 (48.11%)322/503 (64.02%)
HarveyiV. harveyiWP_005444697.1NZ_CP009467WP_050907635.1NZ_CP009467244/522 (46.74%)320/522 (61.30%)
NigripulchritudoV. nigripulchritudoWP_022603175.1NC_022528WP_022550524.1NC_022528247/508 (48.62%)331/508 (65.16%)
MediterraneiV. mediterraneiWP_062462808.1NZ_CP018308WP_088875891.1NZ_CP018308236/503 (46.92%)318/503 (63.22%)
  1. *

    N.D. (not detected) indicates that the top hit from BLAST was a bEBP other than LuxO.

  2. †

    N.D. (not detected) indicates that the top hit from BLAST was a bEBP other than SypG.

  3. ‡

    N.A. (not applicable) due to SypG homolog not detected.

  4. §

    The Salinivibrio-Grimontia-Enterovibrio group is ancestrally related to the Vibrionaceae family and is included as an outgroup in this analysis.

Table 3
Strains and plasmids used in this study.
Strain nameGenotypeReference
ES114Wild-type V. fischeriMandel et al., 2008
DRO22ES114 Tn5::binKThis work
MJM2481ES114 ΔbinK Tn7::ermThis work
TIM303ES114 Tn7::(Pqrr1::gfp erm)Miyashiro et al., 2010
TIM313ES114 Tn7::ermMiyashiro et al., 2010
TIM412ES114 ΔbinK Tn7::(binK erm)This work
MJM2251ES114 ΔbinKBrooks and Mandel, 2016
KRG004ES114 ΔrpoNThis work
KRG011ES114 ΔbinK ΔrpoNThis work
EDR009ES114 ΔbinK ΔluxOThis work
EDR013ES114 ΔbinK ΔluxO ΔsypGThis work
EDR014ES114 ΔbinK ΔsypGThis work
MJM4982ES114 sypG(D53E)This work
MJM4983ES114 ΔbinK sypG(D53E)This work
EDS008ES114 ΔluxO ΔsypG Tn7::ermThis work
EDS010ES114 ΔluxO ΔsypG Tn7::(lacIq Ptrc::sypG erm)This work
EDS015ES114 ΔsypG Tn7::(Pqrr1::gfp erm)This work
SSC009ES114 ΔsypK Tn7::(Pqrr1::gfp erm)This work
JHK007ES114 ΔainS ΔluxIR Plux-luxCDABEGKimbrough and Stabb, 2013
LFI1238Wild-type Aliivibrio salmonicidaHjerde et al., 2008
EDS021ES114 ΔluxO ΔsypG Tn7::(lacIq Ptrc-sypGAS erm)This work
MJM2255ES114 rscS* ΔbinKBrooks and Mandel, 2016
MJM1198MJM1100 rscS*Singh et al., 2015
EDR010ES114 ΔbinK Δqrr1This work
TIM305ES114 Δqrr1Miyashiro et al., 2010
SSC005ES114 Δqrr1 Tn7::ermThis work
TIM306ES114 ΔluxOMiyashiro et al., 2010
TIM311ES114 ΔluxO Tn7::ermMiyashiro et al., 2010
KRG016ES114 ΔainS ΔluxIR Tn7::(Ptrc::gfp erm)This work
KRG018ES114 Δqrr1 Tn7::Pqrr1::qrr1 ermThis work
KRG019ES114 Δqrr1 Tn7::Pqrr1(G−131T)::qrr1 ermThis work
KRG021ES114 Δqrr1 Tn7::ermThis work
Plasmid nameRelevant genotypeSource
pVSV105R6Kori ori(pES213) RP4 oriT catDunn et al., 2006
pTM267pVSV105 kan-gfp PtetA-mCherryMiyashiro et al., 2010
pTM268pVSV105 Pqrr1-gfp PtetA-mCherryMiyashiro et al., 2010
pSCV38pVSV105 PtetA-yfp PtetA-mCherryVerma and Miyashiro, 2016
pYS112pVSV105 PproD-cfp PtetA-mCherrySun et al., 2016
pEDR003Region [(−373)–(+5)] of Pqrr1 cloned upstream of gfp reporter in pTM267This work
pEDR011Region [(−357)–(+5)] of Pqrr1 cloned upstream of gfp reporterThis work
pEDR012Region [(−262)–(+5)] of Pqrr1 cloned upstream of gfp reporterThis work
pEDR006Region [(−209)–(+5)] of Pqrr1 cloned upstream of gfp reporterThis work
pEDR009Region [(−106)–(+5)] of Pqrr1 cloned upstream of gfp reporterThis work
pEDR008Region [(−60)–(+5)] of Pqrr1 cloned upstream of gfp reporterThis work
pEDS007Region [(−373)–(+5)] of Pqrr1 with G−97T substitution cloned upstream of gfp reporterThis work
pEDS008Region [(−373)–(+5)] of Pqrr1 with C−96A substitution cloned upstream of gfp reporterThis work
pEDS009Region [(−373)–(+5)] of Pqrr1 with A−95C substitution cloned upstream of gfp reporterThis work
pEDS004Region [(−373)–(+5)] of Pqrr1 with G−131T substitution cloned upstream of gfp reporterThis work
pEDS005Region [(−373)–(+5)] of Pqrr1 with C−130A substitution cloned upstream of gfp reporterThis work
pEDS006Region [(−373)–(+5)] of Pqrr1 with A−129C substitution cloned upstream of gfp reporterThis work
pTM235pEVS79 ΔluxOMiyashiro et al., 2010
pTM238pEVS79 Δqrr1Miyashiro et al., 2010
pDAT05pEVS79 sypG(D53E)Ludvik et al., 2021
pEDR007pEVS79 ΔsypGThis work
pEVS79pBC SK (+) oriT catStabb and Ruby, 2002
pEVS104Stabb and Ruby, 2002
pEVS107R6Kori oriT mini-Tn7 mob erm kanMcCann et al., 2003
pTn7BinKpEVS107 binKBrooks and Mandel, 2016
pTM239pEVS107 Pqrr1-gfp ermMiyashiro et al., 2014
pAGC003pEVS107 lacIq Ptrc-sypGAsThis work
pAGC004pTM267 Pqrr1AS-gfpThis work
pKG11pKV69 rscS*Yip et al., 2006
pKV69Mobilizable vector; tetR catVisick and Skoufos, 2001
pKRG040pEVS107 Pqrr1::qrr1This work
pKRG041pEVS107 Pqrr1(G-131T)::qrr1This work
pVF_A1020PpTM267 PsypA::gfpThis work
pVF_A1035PpTM267 PsypP::gfpThis work
Table 4
Primers used in this study.
Primers5′ → 3′
ΔsypG
sypG-del-XbaI-l1CGGTCTAGATGTGGTGGATTCTTTTCCATAAATGCC
sypG-del-XbaI-u1GGCTCTAGAGTTAAGCCCGTCAACACTCT
sypF-KpnI-u1GGTACCGTTCTGGTTTAGGGTTAGCTATTTGTCA
sypH-SacI-l1GAGCTCCAGACAATAAAGAGGGGATGATAGC
ΔrpoN
ES_rpoN Del Up FCCTCAAGAAGCTTCTATTTTTAGAA
ES_rpoN Del Up RTAGGCGGCCGCACTAAGTATGGTATTTAGCGATACCTTTTGTACATT
ES_rpoN Del Down FGGATAGGCCTAGAAGGCCATGGTTAATGAAAAGGAAGTGTTATGCAA
ES_rpoN Del Down RGATAGCTATCCCATTACCTATACCA
sypGD53E sequencing
DAT_095 sypG fwdCTACAGCAAGCCAGAAATGAAGCAG
DAT_096 sypG revGGGTGCCTTTTGATTGAATTAAGTTC
pEDS003
sypG-pTrc-KpnI-u1GGTACCTTCGCTAGGTAAAACAGGATGTTA
sypG-pTrc-BsrGI-l1GGTGTACAGTAACCATATTTCATCATTCCGAT
pAGC003
AS-KpnI-SypG-U1GGTACCTGCACAAGGCTTCACTA
AS-BsrGI-SypG-L1TGTACACAAAAGCCATACCTCAAAAG
pEDR003
qrr1-prom-XmaI-u2GGCCCGGGCAGCCAACACATCAAAACCTGTCA
qrr1-prom-XbaI-l2GGTCTAGAACTAGTGGTCAATATACCTATTGCAGGGAG
pEDR006
qrr1-prom-XmaI-u3GGCCCGGGGTATCATCAAATCCAACTTGAGGG
qrr1-prom-XbaI-l2GGTCTAGAACTAGTGGTCAATATACCTATTGCAGGGAG
pEDR008
qrr1-XmaI-reg1-u1GCGCCCGGGGGCTTATTTAGCTTATTTTTACG
gfp-XhoI-l1TACTCGAGTTTGTGTCCGAGAATGTTTCCATC
pEDR009
qrr1-XmaI-reg2-u1CCGCCCGGGACGCAATTTGCAAAATGC
gfp-XhoI-l1TACTCGAGTTTGTGTCCGAGAATGTTTCCATC
pEDR010
qrr1-XmaI-reg5-u1GGCCCCGGGCAATATCAAAACCTAACGGG
gfp-XhoI-l1TACTCGAGTTTGTGTCCGAGAATGTTTCCATC
pEDR011
qrr1-XmaI-reg7-u1GGCCCCGGGACCTGTCATGTCAGGC
gfp-XhoI-l1TACTCGAGTTTGTGTCCGAGAATGTTTCCATC
pEDR012
qrr1-XmaI-reg4-u1CCGCCCGGGGCAGTATCTTCTACCATTAATAAA
gfp-XhoI-l1TACTCGAGTTTGTGTCCGAGAATGTTTCCATC
pEDS004, pKRG041
qrr1-prom-SDM-G243T-u1TAAAAATGCGGTTGATATTTTCATTATGCAATCAGGATTCG
qrr1-prom-SDM-G243T-l1CGAATCCTGATTGCATAATGAAAATATCAACCGCATTTTTA
pEDS005
qrr1-prom-SDM-C244A-u1AAAAATGCGGTTGATATTTGAATTATGCAATCAGGATTCGC
qrr1-prom-SDM-C244A-l1GCGAATCCTGATTGCATAATTCAAATATCAACCGCATTTTT
pEDS006
qrr1-prom-SDM-A245C-u1AAAATGCGGTTGATATTTGCCTTATGCAATCAGGATTCGCA
qrr1-prom-SDM-A245C-l1TGCGAATCCTGATTGCATAAGGCAAATATCAACCGCATTTT
pEDS007
qrr1prom-mut_G277T_u1GGATTCGCAAAACGCAATTTTCAAAATGCAAAAAAGGATG
qrr1prom-mut_G277T_l1CATCCTTTTTTGCATTTTGAAAATTGCGTTTTGCGAATCC
pEDS008
qrr1prom-mut_G278A_u1GATTCGCAAAACGCAATTTGAAAAATGCAAAAAAGGATGAC
qrr1prom-mut_G278A_l1GTCATCCTTTTTTGCATTTTTCAAATTGCGTTTTGCGAATC
pEDS009
qrr1prom-mut_G279C_u1CGCAAAACGCAATTTGCCAAATGCAAAAAAGGATG
qrr1prom-mut_G279C_l1CATCCTTTTTTGCATTTGGCAAATTGCGTTTTGCG
pKRG040
Qrr1-SpeI-u1CCGGACTAGTTAGTTAGTTATTGATTTTAA
Qrr1-KpnI-l1CCGGGGTACCCAGCCAACACATCAAAACCT
pAGC003
AS-KpnI-SypG-U1GGTACCTGCACAAGGCTTCACTA
AS-BsrGI-SypG-L1TGTACACAAAAGCCATACCTCAAAAG
pAGC004
AS-Qrr1-XmaI-U1CCCGGGGTCCAGTCATATCCGGCAAGC
AS-Qrr1-XbaI-L1TCTAGAGGTCACTATACATATAGCAGAG

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/78544/elife-78544-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Ericka D Surrett
  2. Kirsten R Guckes
  3. Shyan Cousins
  4. Terry B Ruskoski
  5. Andrew G Cecere
  6. Denise A Ludvik
  7. C Denise Okafor
  8. Mark J Mandel
  9. Tim I Miyashiro
(2023)
Two enhancer binding proteins activate σ54-dependent transcription of a quorum regulatory RNA in a bacterial symbiont
eLife 12:e78544.
https://doi.org/10.7554/eLife.78544