Macrophages regulate gastrointestinal motility through complement component 1q
- Department of Immunology, The University of Texas Southwestern Medical Center, United States
- The Howard Hughes Medical Institute, The University of Texas Southwestern Medical Center, United States
Figures
Figure 1 with 1 supplement
Complement component 1q (C1q) is expressed by macrophages in the mouse small intestine.
(A) RNA-seq analysis of soluble defense collagen expression in the small intestines (ileum) of C57BL/6 mice. Data were adapted from a previously published RNA-seq analysis (Gattu et al., 2019). Data …
-
Figure 1—source data 1
Unedited, uncropped immunoblot for Figure 1D.
- https://cdn.elifesciences.org/articles/78558/elife-78558-fig1-data1-v2.zip
Figure 1—figure supplement 1
Complement component 1q (C1q) is expressed in the mouse colon.
RNA-seq analysis of soluble defense collagen expression in the colons of C57BL/6 mice. Data were reanalyzed by Gattu et al., 2019. Each column represents one mouse. Data are available in the Gene …
Figure 2 with 1 supplement
Macrophages are the primary source of complement component 1q (C1q) in the mouse gastrointestinal tract.
(A) Macrophages were selectively depleted in C57BL/6 mice by intraperitoneal injection of anti-CSF1R antibody. Control mice were injected with isotype-matched non-specific antibodies. Mice were …
Figure 2—figure supplement 1
Complement component 1q (C1q) expression is lost systemically but preserved in the central nervous system of C1qa∆Mφ mice.
(A) Quantitative PCR (qPCR) measurement of C1qa expression in lung, skin, liver, kidney, and brain. Each data point represents one mouse. Data are representative of two independent experiments. (B) …
Figure 3 with 6 supplements
C1qaΔMφ mice do not show altered microbiota composition, barrier function, or resistance to enteric infection.
(A) Small intestinal C1qa expression is not induced by the intestinal microbiota. Quantitative PCR (qPCR) measurement of Reg3g and C1qa transcript abundances in the small intestines of germ-free …
-
Figure 3—source data 1
Unedited, uncropped immunoblot for Figure 3B.
- https://cdn.elifesciences.org/articles/78558/elife-78558-fig3-data1-v2.zip
Figure 3—figure supplement 1
Histological analysis of dextran sulfate sodium (DSS)-treated mice.
C1qafl/fl and C1qaΔMφ mice were given 3% DSS in drinking water to induce colitis. (A) Representative sections of the colon were stained with hematoxylin and eosin. Scale bars = 50 μm. (B) Colon …
Figure 3—figure supplement 2
Colon histology of Citrobacter rodentium-infected mice.
C1qafl/fl and C1qaΔMφ mice were infected orally with C. rodentium grown to log phase and fecal bacterial burdens were monitored for 18 days (Figure 3H). Representative sections of the colon from day …
Figure 3—figure supplement 3
Flow cytometry gating strategy for comparison of T cell populations in C1qafl/fl and C1qa∆Mφ mice.
Small intestinal cells were recovered from C1qafl/fl and C1qa∆Mφ littermates and analyzed by flow cytometry. T cells were gated as live CD45+ CD3+ CD4+. T cell subsets were further identified by …
Figure 3—figure supplement 4
Flow cytometry gating strategy for comparison of B cell and plasma cell populations in C1qafl/fl and C1qa∆Mφ mice.
Small intestinal cells were recovered from C1qafl/fl and C1qa∆Mφ littermates and analyzed by flow cytometry. B cells were gated as live CD45+ CD19+ B220+. Plasma cells were gated as CD19+ B220-, and …
Figure 3—figure supplement 5
Flow cytometry gating strategy for comparison of myeloid cell populations in C1qafl/fl and C1qa∆Mφ mice.
Small intestinal cells were recovered from C1qafl/fl and C1qa∆Mφ littermates and analyzed by flow cytometry. Macrophages were gated as live CD45+ MHCII+ CD11b+ F4/80hi. Monocytes were gated as live …
Figure 3—figure supplement 6
Flow cytometry gating strategy for comparison of innate lymphoid cell populations in C1qafl/fl and C1qa∆Mφ mice.
Small intestinal cells were recovered from C1qafl/fl and C1qa∆Mφ littermates and analyzed by flow cytometry. Innate lymphoid cells (ILC) were gated as live CD45+ Lin- CD90.2+ and then further …
Figure 4 with 1 supplement
Complement component 1q (C1q) is expressed by muscularis macrophages that are located near enteric neurons.
(A) Graphic depicting the muscularis of the mouse small intestine. The lumen, epithelium (epi), lamina propria (LP), submucosal plexus (SP), and longitudinal muscle-myenteric plexus (LMMP) are …
Figure 4—figure supplement 1
Flow cytometry analysis of complement component 1q (C1q) and CD169 expression on small intestinal macrophages.
(A) Similar numbers of CD169+ macrophages are present in the small intestines of C1qaΔMφ and C1qafl/fl littermates. Flow cytometry analysis of CD169+ macrophages was conducted on cells recovered …
Figure 5
Numbers of enteric neurons are similar in C1qafl/fl and C1qa∆Mφ mice.
(A) Immunofluorescence analysis of enteric neuronal ganglia marked with HuC/D (red) and neuronal fibers marked with TUBB3 (green) in LMMP wholemounts of small intestines and colons from C1qafl/fl …
Figure 6 with 4 supplements
C1qa∆Mφ mice have altered gastrointestinal motility.
(A) RNA-seq was performed on colonic LMMP from C1qaΔMφ and C1qafl/fl littermates. Annotated gene ontology (GO) biological processes were assigned to genes that were differentially expressed in C1qaΔM…
Figure 6—figure supplement 1
Single-cell RNA-seq analysis of intestinal macrophages from C1qaΔMφ and C1qafl/fl littermates.
Lamina propria cell suspensions were prepared from the small intestines of C1qafl/fl and C1qaΔMφ littermates (n=3 for each genotype). Total small intestinal cells were pooled according to genotype …
Figure 6—figure supplement 2
The gene encoding complement component 1q (C1q) receptor BAI1 (Adgrb1) is expressed by enteric neurons.
(A) A recent report identified five candidate C1q receptor proteins encoded by neural stem cells in humans and mice (Benavente et al., 2020). We searched for the mouse homologs of the genes encoding …
Figure 6—video 1
Ex vivo recording of colonic peristalsis in C1qafl/fl mice.
Figure 6—video 2
Ex vivo recording of colonic peristalsis in C1qa∆Mφ mice.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C1qafl/fl; B6(SJL)-C1qatm1c(EUCOMM)Wtsi/TennJ | Jackson Laboratory; Fonseca et al., 2017 | Stock #031261 | |
| Strain, strain background (Mus musculus) | LysM-Cre; B6.129P2-Lyz2tm1(cre)Ifo/J | Jackson Laboratory; Clausen et al., 1999 | Stock #004781 | |
| Strain, strain background (Mus musculus) | C1qaΔMΦ | this paper | Generated by crossing C1qafl/fl mice with LysM-Cre mice | |
| Strain, strain background (Mus musculus) | C3-/-; B6.129S4-C3tm1Crr/J | Jackson Laboratory; Wessels et al., 1995 | Stock #029661 | |
| Strain, strain background (Mus musculus) | Germ-free C57BL/6 J mice | UT Southwestern Gnotobiotics Core Facility | ||
| Strain, strain background (Salmonella enterica) | Salmonella enterica subsp. enterica serovar Typhimurium strain SL1344 | Dr. Vanessa Sperandio; Eichelberg and Galán, 1999 | ||
| Strain, strain background (Citrobacter rodentium) | Citrobacter rodentium strain DBS100 | ATCC | Strain# 51459 | |
| Antibody | Anti-Actin HRP (rabbit monoclonal) | Cell Signaling | Clone: 13E5 | Immunoblot (1:5000) |
| Antibody | Anti-ARG1 (sheep monoclonal) | R&D Systems | Clone: P05089 | Flow (1:100) |
| Antibody | Anti-B220 (rat monoclonal) | Thermo Fisher | Clone: RA3-6B2 | Flow (1:500) |
| Antibody | Anti-C1q (rat monoclonal) | Cedarlane Laboratories | Clone: RmC7H8 | Flow (1:50) |
| Antibody | Anti-C1q (rabbit polyclonal) | Thermo Fisher | Cat# PA5-29586 | Immunoblot (1:500) |
| Antibody | Anti-C1q-biotin (mouse monoclonal) | Abcam | Clone: JL1 | ELISA (1:1000); Immunofluorescence (1:100) |
| Antibody | Anti-CD3 (rat monoclonal) | Thermo Fisher | Clone: 17A2 | Flow (1:200) |
| Antibody | Anti-CD4 (rat monoclonal) | BioLegend | Clone: GK1.5 | Flow (1:500) |
| Antibody | Anti-CD11b (rat monoclonal) | Thermo Fisher | Clone: M1/70 | Flow (1:200) |
| Antibody | Anti-CD11c (Armenian hamster monoclonal) | Thermo Fisher | Clone: N418 | Flow (1:500) |
| Antibody | Anti-CD16/32 (rat monoclonal) | BioLegend | Clone: 93 | Fc receptor block (1:1000) |
| Antibody | Anti-CD19 (rat monoclonal) | BioLegend | Clone: 1D3 | Flow (1:500) |
| Antibody | Anti-CD45 (rat monoclonal) | BioLegend | Clone: 30-F11 | Flow (1:500) |
| Antibody | Anti-CD90.2 (rat monoclonal) | BioLegend | Clone: 30-H12 | Flow (1:500) |
| Antibody | Anti-CD169 (rat monoclonal) | BioLegend | Clone: 3D6.112 | Flow (1:200) |
| Antibody | Anti-CD169 (rat monoclonal) | Abcam | Clone: 3D6.112 | Immunofluorescence (1:200) |
| Antibody | Anti-CSF1R (rat monoclonal) | Bio X Cell | Cat# AFS98 | Macrophage depletion (100 mg/kg) |
| Antibody | Anti-F4/80 (rat monoclonal) | BioLegend | Clone: BM8 | Flow (1:100) |
| Antibody | Anti-FoxP3 (rat monoclonal) | Thermo Fisher | Clone: FJK-16s | Flow (1:50) |
| Antibody | Anti-GATA3 (mouse monoclonal) | BD Biosciences | Clone: L50-823 | Flow (1:50) |
| Antibody | Anti-IgA (rat monoclonal) | Thermo Fisher | Clone: 11-44-2 | Flow (1:50) |
| Antibody | Anti-LY6C (rat monoclonal) | BioLegend | Clone: RB6-8C5 | Flow (1:500) |
| Antibody | Anti-MHCII (rat monoclonal) | Thermo | Clone: M5/114.15.2 | Flow (1:500) |
| Antibody | Anti-REG3G antiserum (rabbit polyclonal) | Cash et al., 2006; antiserum generated by Pacific Biosciences | Immunoblot (1:1000) | |
| Antibody | Anti-RORγt (rat monoclonal) | Thermo Fisher | Clone: AFKJS-9 | Flow (1:50) |
| Antibody | Anti-T-BET (mouse monoclonal) | BioLegend | Clone: 4B10 | Flow (1:50) |
| Antibody | Anti-TREM2 (rat monoclonal) | R&D Systems | Clone: 237920 | Flow (1:200) |
| Antibody | Anti-TUBB3 (rabbit polyclonal) | Abcam | Cat# ab18207 | Immunofluorescence (1:200) |
| Antibody | Anti-S100β (rabbit polyclonal) | Dako | Cat# GA504 | Immunofluorescence |
| Antibody | Anti-HuC/D (rabbit monoclonal) | Abcam | Cat# ab184267 | Immunofluorescence (1:400) |
| Antibody | Goat anti-rabbit IgG HRP conjugate | Abcam | Cat# ab6721 | Immunoblot (1:5000) |
| Antibody | secondary antibodies – donkey polyclonal anti-rabbit/rat/mouse AlexaFluor 488/594/647 | Invitrogen | Immunofluorescence (1:400) | |
| Antibody | mouse IgG1 | Abcam | Cat# ab18443 | ELISA (10 μg/ml) |
| Antibody | Rat IgG2a | Thermo Fisher | Clone: 2A3 | Isotype control for anti-CSF1R macrophage depletion (100 mg/kg) |
| Antibody | Rat IgG1 PE isotype control | Cedarlane Laboratories | Cat# CLCR104 | Flow (1:50) |
| Sequence-based reagent | mouse C1qa TaqMan assay | Thermo Fisher | Assay ID: Mm00432142_m1 | |
| Sequence-based reagent | mouse C1qb TaqMan assay | Thermo Fisher | Assay ID: Mm01179619_m1 | |
| Sequence-based reagent | mouse C1qc TaqMan assay | Thermo Fisher | Assay ID: Mm00776126_m1 | |
| Sequence-based reagent | mouse Chat TaqMan assay | Thermo Fisher | Assay ID: Mm01221880_m1 | |
| Sequence-based reagent | mouse Nos1 TaqMan assay | Thermo Fisher | Assay ID: Mm01208059_m1 | |
| Sequence-based reagent | mouse S100b TaqMan assay | Thermo Fisher | Assay ID: Mm00485897_m1 | |
| Sequence-based reagent | mouse Reg3g TaqMan assay | Thermo Fisher | Assay ID: Mm00441127_m1 | |
| Sequence-based reagent | mouse Ifng TaqMan assay | Thermo Fisher | Assay ID: Mm01168134_m1 | |
| Sequence-based reagent | mouse Il4 TaqMan assay | Thermo Fisher | Assay ID: Mm00445259_m1 | |
| Sequence-based reagent | mouse IL5 TaqMan assay | Thermo Fisher | Assay ID: Mm00439646_m1 | |
| Sequence-based reagent | mouse Il10 TaqMan assay | Thermo Fisher | Assay ID: Mm01288386_m1 | |
| Sequence-based reagent | mouse Il13 TaqMan assay | Thermo Fisher | Assay ID: Mm00434204_m1 | |
| Sequence-based reagent | mouse Il17a TaqMan assay | Thermo Fisher | Assay ID: Mm00439618_m1 | |
| Sequence-based reagent | mouse Il17f TaqMan assay | Thermo Fisher | Assay ID: Mm00521423_m1 | |
| Sequence-based reagent | mouse 18 S gene TaqMan assay | Thermo Fisher | Assay ID: Mm03928990_g1 | |
| Sequence-based reagent | bacterial 16 S universal rRNA forward primer | Gift from Dr. Andrew Koh | 5’- ACTCCTACGGGAGGCAGCAGT-3’ | |
| Sequence-based reagent | Bacterial 16 S universal rRNA reverse primer | Gift from Dr. Andrew Koh | 5’- ATTACCGCGGCTGCTGGC-3’ | |
| Sequence-based reagent | bacterial 16 S V3 - rRNA gene forward primer | Thermo Fisher; (Klindworth et al., 2013) | 16 S rRNA gene sequencing | 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′ |
| Sequence-based reagent | bacterial 16 S v4 - rRNA gene reverse primer | Thermo Fisher; Klindworth et al., 2013 | 16 S rRNA gene sequencing | 5′- GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGGACTACHVGGGTATCTAATCC-3′ |
| Sequence-based reagent | mouse C1qa RNAscope probe (C1) | Advanced Cell Diagnostics | Cat# 498241 | |
| Sequence-based reagent | mouse C1qa RNAscope probe (C3) | Advanced Cell Diagnostics | Cat# 498241-C3 | |
| Sequence-based reagent | mouse Chat RNAscope probe (C1) | Advanced Cell Diagnostics | Cat# 408731 | |
| Sequence-based reagent | mouse Nos1 RNAscope probe (C2) | Advanced Cell Diagnostics | Cat# 437651-C2 | |
| Sequence-based reagent | mouse Adgrb1 RNAscope probe (C1) | Advanced Cell Diagnostics | Cat# 317901 | |
| Sequence-based reagent | mouse Csf1r RNAscope probe (C2) | Advanced Cell Diagnostics | Cat# 428191-C2 | |
| Peptide, recombinant protein | recombinant mouse C1q | Complementech | Cat# M099 | |
| Commercial assay or kit | Chromium Next GEM Single Cell 3’ Kit v3.1 | 10 x Genomics | Cat# PN-1000269 | |
| Commercial assay or kit | Chromiium Next GEM Chip G Single Cel Kit | 10 x Genomics | Cat# PN-1000127 | |
| Commercial assay or kit | Dual Index Kit TT Set A | 10 x Genomics | Cat# PN-1000215 | |
| Commercial assay or kit | FOXP3/Transcription Factor Fixation/Permeabilization Buffer Set | Thermo Fisher | Cat# 00-5523-00 | |
| Commercial assay or kit | MMLV Reverse Transcriptase Kit | Thermo Fisher | Cat# 28025–021 | |
| Commercial assay or kit | NextSeq 500/550 High Output Kit v2.5 | Illumina | Cat# 20024907 | |
| Commercial assay or kit | PE300 (Paired end 300 bp) v3 kit | Illumina | Cat# MS-102–3001 | |
| commercial assay or kit | RNAscope Fluorescent Multiple Reagent Kit | Advanced Cell Diagnostics | Cat# 320850 | |
| Commercial assay or kit | RNeasy Universal Mini Kit | Qiagen | Cat# 73404 | |
| Commercial assay or kit | DNEasy Blood & Tissue Kit | Qiagen | Cat# 69504 | |
| Commercial assay or kit | TaqMan Master Mix | Thermo Fisher | Cat# 4369542 | |
| Commercial assay or kit | TruSeq RNA sample preparation kit | Illumina | Cat# RS-122–2001 | |
| Commercial assay or kit | SsoAdvanced Universal SYBR Green Supermix | BioRad | Cat# 1725270 | |
| Chemical compound, drug | Agencourt AmpureXP beads | Beckman Coulter Genomics | Cat# A63880 | |
| Chemical compound, drug | Carmine Red | Sigma | Cat# C1022-25G | |
| Chemical compound, drug | Collagenase IV | Sigma | Cat# C5138-1G | |
| Chemical compound, drug | Borosilicate glass beads (2 mm) | Millipore Sigma | Cat# Z273627-1EA | |
| Chemical compound, drug | Dextran sulfate sodium | Thomas Scientific | Cat# 216011090 | |
| Chemical compound, drug | DNase I | Sigma | Cat# DN25 | |
| Chemical compound, drug | Dispase II | Sigma | Cat# D4693-1G | |
| Chemical compound, drug | FITC-dextran (4000 Da) | Sigma | Cat# FD4-1g | |
| Chemical compound, drug | Ghost 710 | Tonbo Biosciences | Cat# 13–0871 T100 | Flow cytometry viability dye |
| Chemical compound, drug | Methylcellulose | Sigma | Cat# M0262-100G | |
| Chemical compound, drug | Nalidixic acid, sodium salt | Research Products International | Cat# N23100-25.0 | |
| Chemical compound, drug | Optimal Cutting Temperature Compound (OCT) | Thermo Fisher | Cat# 23-730-571 | |
| Chemical compound, drug | Percoll Plus | GE Healthcare | Cat# GE17-0891-09 | |
| Chemical compound, drug | 4% Paraformaldehyde Solution | Thermo Fisher | Cat# J19943.K2 | |
| Chemical compound, drug | Normal donkey serum | Southern Biotech | Cat# 0030–01 | |
| Chemical compound, drug | Triton X-100 | Thermo Fisher | Cat# A16046.AP | |
| Chemical compound, drug | Protease inhibitors | Millipore Sigma | Cat# 11836153001 | |
| Chemical compound, drug | Rhodamine B-dextran | Thermo Fisher | Cat# D1841 | |
| Chemical compound, drug | Streptavidin-Cy5 | Thermo Fisher | Cat# 434316 | |
| Chemical compound, drug | Streptavidin-HRP conjugate | Abcam | Cat# ab7403 | ELISA |
| Chemical compound, drug | Sylgard 184 Silicone Elastomer | Fisher Scientific | Cat# 4019862 | |
| Chemical compound, drug | VECTASHIELD Antifade Mounting Medium with 4′,6-diamidino-2-phenylindole (DAPI) | Vector Labs | Cat# H-1200–10 | |
| Software, algorithm | Cell Ranger Single-Cell Software Suite | 10 X Genomics | ||
| Software, algorithm | clusterProfiler | Yu et al., 2012 | ||
| Software, algorithm | CLC Genomics Workbench | Qiagen | ||
| Software, algorithm | CLC Bio microbial genomics module | Qiagen | https://digitalinsights.qiagen.com/plugins/clc-microbial-genomics-module/ | |
| Software, algorithm | FlowJo | BD Biosciences | ||
| Software, algorithm | ggplot2 | Love et al., 2015 | ||
| Software, algorithm | GraphPad PRISM | GraphPad Software | Version 7.0; RRID:SCR_002798 | |
| Software, algorithm | Gut Analysis Toolbox | Sorensen et al., 2022 | ||
| Software, algorithm | Igor Pro 9 | WaveMetrics | ||
| Software, algorithm | Illumina Nextera Protocol | Illumina | Part # 15044223 Rev. B | |
| Software, algorithm | ImageJ | National Institutes of Health | https://imagej.nih.gov/ij/ | |
| Software, algorithm | Limma | Ritchie et al., 2015 | ||
| Software, algorithm | NovoExpress | Agilent Technologies | ||
| Software, algorithm | PVCAM software | Teledyne Photometrics | ||
| Software, algorithm | Seurat V3 R Package | Stuart et al., 2019 | ||
| Other | Agilent 2100 Bioanalyzer | Agilent Technologies | G2939A | RNA integrity analysis |
| Other | Amicon Ultra centrifugal filters | Millipore | Cat #UFC900324 | Fecal protein extraction |
| Other | BioRad ChemiDoc Touch System | BioRad | Cat# 1708370 | Western blot imaging: |
| Other | Chromium Controller & Next GEM Accessory Kit | 10 X Genomics | Cat# PN-120223 | Single cell RNA sequencing library construction |
| Other | CMOS camera | Teledyne Photometrics | MOMENT | Ex vivo peristalsis: |
| Other | Leica CM1950 (Cryostat) | Leica | Cryosectioning | |
| Other | FACSAria | BD Biosciences | Flow cytometric cell sorting | |
| Other | ORCA-Fusion sCMOS camera | Hamamatsu Photonics | C14440-20UP | Imaging |
| Other | Illumina MiSeq | Illumina | RRID:SCR_016379 | 16 S rRNA |
| Other | Illumina NextSeq 550 | Illumina | Bulk RNA sequencing and single cell RNA sequencing | |
| Other | Keyence Fluorescence Microscope | Keyence | BZ-X800 | Immunofluorescence |
| Other | NovoCyte 3005 | Agilent Technologies | Flow cytometry analysis | |
| Other | Organ bath chamber | Tokai Hit | Ex vivo peristalsis | |
| Other | Peristaltic pump | Gilson | MINIPULS3 | Ex vivo peristalsis |
| Other | QuantStudio 7 Flex Real-Time PCR System | Applied Biosystems | Cat #4485701 | qPCR analysis |
| Other | SpectraMax M5 plate reader | Molecular Devices | ELISA and small intestinal motility analysis | |
| Other | Zeiss Axio Imager M1 Microscope | Zeiss | Immunofluorescence |
