1. Neuroscience

Sonic hedgehog-dependent recruitment of GABAergic interneurons into the developing visual thalamus

  1. Rachana Deven Somaiya
  2. Katelyn Stebbins
  3. Ellen C Gingrich
  4. Hehuang Xie
  5. John N Campbell
  6. A Denise R Garcia
  7. Michael A Fox  Is a corresponding author
  1. Center for Neurobiology Research, Fralin Biomedical Research Institute at Virginia Tech Carilion, United States
  2. Graduate Program in Translational Biology, Medicine, and Health, Virginia Tech, United States
  3. Virginia Tech Carilion School of Medicine, United States
  4. Department of Biology, Drexel University, United States
  5. Department of Neurobiology and Anatomy, Drexel University College of Medicine, United States
  6. Fralin Life Sciences Institute at Virginia Tech, United States
  7. School of Neuroscience, College of Science, Virginia Tech, United States
  8. Genetics, Bioinformatics and Computational Biology Program, Virginia Tech, United States
  9. Department of Biomedical Sciences and Pathobiology, Virginia–Maryland College of Veterinary Medicine, United States
  10. Department of Biology, University of Virginia, United States
  11. Neuroscience Graduate Program, University of Virginia, United States
  12. Department of Biological Sciences, College of Science, Virginia Tech, United States
  13. Department of Pediatrics, Virginia Tech Carilion School of Medicine, United States
https://doi.org/10.7554/eLife.79833
Share this article
Cite this article
  1. Rachana Deven Somaiya
  2. Katelyn Stebbins
  3. Ellen C Gingrich
  4. Hehuang Xie
  5. John N Campbell
  6. A Denise R Garcia
  7. Michael A Fox
(2022)
Sonic hedgehog-dependent recruitment of GABAergic interneurons into the developing visual thalamus
eLife 11:e79833.
https://doi.org/10.7554/eLife.79833
  2. Download BibTeX
  3. Download .RIS
6 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
Sonic hedgehog (SHH), but not retinal activity, is required for the recruitment of interneurons into visual thalamus.

(A) Schematic representation of loss of retinal inputs and interneurons in visual thalamus of Atoh7−/− mice. (B) In situ hybridization (ISH) shows a reduction in Gad1+ cells in dorsal lateral geniculate nucleus (dLGN) and ventral lateral geniculate nucleus (vLGN) of >P150 Atoh7−/− mice compared with controls. (C) Quantification of percentage of Gad1+ cells in dLGN and vLGN of >P150 controls and Atoh7−/− mice. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). Asterisks (*) indicate p < 0.05 by Student’s t-test (n = 3 mice for each group). (D) Schematic representation of Calb2Cre-inducible expression of tetanus toxin (TeNT) in retinal ganglion cells (RGCs). Rosa26floxstop-TeNT mice with the construct containing a loxP-flanked neomycin (Neo) cassette and TeNT coding sequence under Rosa26 locus, were crossed with Calb2Cre mice that harbor a Cre recombinase and internal ribosome entry site (IRES) in the Calb2 locus. (E) ISH for Gad1 in dLGN and vLGN of P120 control and Rosa26floxstop-TeNT;Calb2Cre mice. (F) Quantification revealed no significant difference in Gad1+ cells in visual thalamus of control and Rosa26floxstop-TeNT;Calb2Cre mice. Each data point represents one biological replicate and bars depict means ± SEM. ns indicates no significant differences by Student’s t-test (n = 3 mice for each group). (G) Schematic representation of strategy to delete SHH from neural cells in the developing brain. This was achieved by crossing Shhfl/fl mice, which have two loxP sites flanking exon 2 of the Shh gene, with NesCre transgenic mice that contain a Cre recombinase and human growth hormone polyadenylation signal (hGH pA) under the control of Nestin promoter and enhancer. (H) ISH revealed a dramatic reduction in Gad1+ cells in dLGN and vLGN of P18 Shhfl/flNesCre mice compared with controls. (I) Quantification of percentage of Gad1+ cells in dLGN and vLGN of P18 control and Shhfl/flNesCre mice. Each data point represents one biological replicate and bars depict means ± SEM. Asterisks represent significant differences (***p < 0.001; *p < 0.05) by Student’s t-test (n = 3 mice for each group). Scale bars in C, E, H: 100 μm.

Figure 1—figure supplement 1
Download asset Open asset
Thalamic Fgf15 expression is dependent on retinal inputs and sonic hedgehog (SHH).

(A) In situ hybridization (ISH) revealed a dramatic reduction in Fgf15 expression in dorsal lateral geniculate nucleus (dLGN) and ventral lateral geniculate nucleus (vLGN) of P2 Atoh7−/− mutants compared with controls. (B) ISH revealed a dramatic reduction in Fgf15 expression in dLGN and vLGN of P3 Shhfl/flNesCre mutants compared with controls. (C) Quantification for density of Fgf15+ cells in dLGN and vLGN of P3 control and Shhfl/flNesCre mutant mice. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). Asterisks (*) indicate *p < 0.05 by Student’s t-test. Scale bars in A, B: 100 μm.

Figure 1—figure supplement 2
Download asset Open asset
Anatomical and functional characterization of Rosa26floxstop-TeNT;Calb2Cre mice.

(A) Expression of tdT in the GCL of P0 Rosastop-tdT;Calb2Cre mouse retina. (B) Schematic representation of the behavioral response to a looming visual stimulus. (C) Adult Rosa26floxstop-TeNT;Calb2Cre (age-matched and littermate mutants to controls) and Atoh7−/− mutants (not age-matched and not littermate mutants to controls) had reduced reaction times to a looming visual stimulus compared with controls. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). Asterisks represent significant differences (***p < 0.001; *p < 0.05) by Student’s t-test. (D) Cholera Toxin Subunit B (CTB)-labeled eye-specific retinal projections to dorsal lateral geniculate nucleus (dLGN) in P16 control and P24 Rosa26floxstop-TeNT;Calb2Cre mutant mice. (E) Quantification of the percentage of dLGN area covered by contraRGCs projections, ipsiRGCs projections, or overlapping eye-specific projections in controls and Rosa26floxstop-TeNT;Calb2Cre mutants. Each data point represents one biological replicate and bars depict means ± SEM. Asterisks (*) indicate *p < 0.05 by Student’s t-test (n = 7 mice for control group and n = 8 mice for mutant group). Scale bars in A: 50 μm and D: 200 μm.

Figure 2
Download asset Open asset
Expression of sonic hedgehog (SHH) signaling molecules by astrocytes in visual thalamus.

(A) Raw transcript reads of mRNAs for downstream SHH signaling components in P3 dorsal lateral geniculate nucleus (dLGN) and ventral lateral geniculate nucleus (vLGN) by RNAseq. Each data point represents a different biological replicate and bars depict means ± standard error of the mean (SEM). (B) Presence of Gli1-tdT+ cells in dLGN and vLGN of P7 Rosa26tdT;Gli1CreER mice. (C) IHC for S100ß in P7 Rosa26tdT;Gli1CreER mice revealed S100ß expression in Gli1-tdT+ cells in visual thalamus. (E) Quantification of percentage of Gli1-tdT+ cells that express S100ß in P7 visual thalamus. Each data point represents one biological replicate and bars depict means ± SEM (n = 3 mice for each region). (D) In situ hybridization (ISH) for Gja1 in P7 Rosa26tdT;Gli1CreER mice revealed expression of Gja1 mRNA by Gli1-tdT+ cells in visual thalamus. (F) Quantification shows 100% of Gli1-tdT+ cells express the astrocytic marker Gja1 in P7 visual thalamus. Each data point represents one biological replicate and bars depict means ± SEM (n = 3 mice for each region). (G) RNAscope-based ISH detected Ptch1 mRNA in dLGN and vLGN of P3 Aldh1l1-GFP mice. This revealed expression of Ptch1 mRNA in the cell bodies as well as in the processes of Aldh1l1-GFP+astrocytes. (H) Quantification of percentage of Aldh1l1-GFP+astrocytes that express Ptch1 mRNA in P3 visual thalamus. Each data point represents one biological replicate and bars depict means ± SEM (n = 3 mice for each region). (I) RNAscope-based ISH detected Smo mRNA in dLGN and vLGN of P3 Aldh1l1-GFP mice. This revealed expression of Smo mRNA in the cell bodies as well as in the processes of Aldh1l1-GFP+ astrocytes.(J) Quantification of percentage of Aldh1l1-GFP+astrocytes that express Smo mRNA in P3 visual thalamus. Each data point represents one biological replicate and bars depict means ± SEM (n = 3 mice for each region). Scale bars in B: 200 μm and in C, E, G, I: 10 μm.

Figure 3 with 2 supplements
Download asset Open asset
Deletion of sonic hedgehog (SHH) from retinal ganglion cells (RGCs) in the perinatal retina.

(A) RNAscope-based in situ hybridization (ISH) revealed dense Shh mRNA in the GCL of P3 retina (inner nuclear layer, INL; inner plexiform layer, IPL; ganglion cell layer, GCL). (B) RNAscope-based ISH revealed Shh mRNA in CALB2+ cells in the GCL of P3 retina. (C) Single-cell RNAseq data (from Rheaume et al., 2018) analyzed to show Calb2 and Shh mRNA expression by different subtypes of RGCs in P5 mouse retina. (D) Single-cell RNAseq data (from Shekhar et al., 2022) analysis for developmental expression of Calb2 by RGCs. (E) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) showed a reduction in Shh mRNA in retina of P3 Shhfl/fl;Calb2Cre mice compared to controls. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). Asterisks (*) indicate p < 0.05 by Student’s t-test (n = 3 mice for each group). Scale bars in A: 100 μm and in B: 10 μm.

Figure 3—figure supplement 1
Download asset Open asset
Presence of active sonic hedgehog (SHH) signaling in developing visual thalamus.

(A) Bright-field immunohistochemistry for βGal in dorsal lateral geniculate nucleus (dLGN) and ventral lateral geniculate nucleus (vLGN) of P3 Gli1nlacZ/+ mice. Scale bar in A: 100 μm.

Figure 3—figure supplement 2
Download asset Open asset
Expression of CALB2 in developing LGN and interneuron progenitor zones.

(A) IHC for CALB2 shows sparse expression in P3 tectal and thalamic progenitor zones of thalamic GABAergic interneurons. Scale bar in A: 100 μm.

Figure 4
Download asset Open asset
Retinal innervations innervate visual thalamus in the absence of retinal ganglion cell (RGC)-derived sonic hedgehog (SHH).

(A) Cholera Toxin Subunit B (CTB)-labeled eye-specific retinal projections to dorsal lateral geniculate nucleus (dLGN) in P25 control and P25 Shhfl/fl;Calb2Cre mutant mice. (B) Quantification for the percentage of dLGN area covered by contraRGCs projections, ipsiRGCs projections, or overlapping eye-specific projections in controls and Shhfl/fl;Calb2Cre mutants. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). ns indicates no significant differences by Student’s t-test (n = 3 mice for each group). Scale bar in A: 100 μm.

Figure 5
Download asset Open asset
Absence of retinal ganglion cell (RGC)-derived sonic hedgehog (SHH) does not impact astrocyte distribution but decreases Fgf15 expression in the visual thalamus.

(A) In situ hybridization (ISH) revealed reduced Fgf15 expression in dorsal lateral geniculate nucleus (dLGN) and ventral lateral geniculate nucleus (vLGN) of P3 Shhfl/fl;Calb2Cre mutants compared to controls. (B) Quantification for density of Fgf15+ cells in dLGN and vLGN of P3 control and Shhfl/fl;Calb2Cre mutant mice. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). Asterisks (*) indicate *p < 0.05 by Student’s t-test (n = 3 mice for each group). (C) ISH revealed no change in Fgfr3+ astrocytes in dLGN and vLGN of P7 Shhfl/fl;Calb2Cre mutants compared to controls. (D) Quantification for density of Fgfr3+ cells in dLGN and vLGN of P7 control and Shhfl/fl;Calb2Cre mutant mice. Each data point represents one biological replicate and bars depict means ± SEM. ns indicates no significant differences by Student’s t-test (n = 3 mice for each group). Scale bars in A, C: 100 μm.

Figure 6
Download asset Open asset
Retinal ganglion cell (RGC)-derived sonic hedgehog (SHH) is required for the recruitment of Gad1+ + into visual thalamus.

(A) In situ hybridization (ISH) revealed a reduction in Gad1+ cells in dorsal lateral geniculate nucleus (dLGN) and ventral lateral geniculate nucleus (vLGN) of P7 Shhfl/fl;Calb2Cre mutants compared with controls. (B) Quantification of percentage of Gad1+ cells in dLGN and vLGN of P7 Shhfl/fl;Calb2Cre and control mice. Each data point represents one biological replicate and bars depict means ± standard error of the mean (SEM). Asterisks (*) indicate *p < 0.05 by Student’s t-test (n = 3 mice for each group). (C) ISH revealed a reduction in Gad1+ cells in dLGN and vLGN of >P90 Shhfl/fl;Calb2Cre mutants compared with controls. (D) Quantification of percentage of Gad1+ cells in dLGN and vLGN of adult Shhfl/fl;Calb2Cre and control mice. Each data point represents one biological replicate and bars depict means ± SEM. Asterisks (*) indicate *p < 0.05 by Student’s t-test (n = 4 mice for control dLGN group, n = 3 mice for mutant dLGN group, n = 6 mice for control vLGN group, and n = 5 mice for mutant vLGN group). Scale bars in A, C: 100 μm.

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Antibodyanti-GFP
(rabbit polyclonal)		Thermo Fisher
Scientific		Cat#A-11122; RRID:AB_2215691:250
Antibodyanti-S100
(rabbit polyclonal)		DakoCat# Z0311; RRID:AB_100133831:200
Antibodyanti-Calretinin
(rabbit polyclonal)		SwantCat#7697; RRID: AB_26197101:1000
Antibodyanti-RFP
(rabbit polyclonal)		Thermo Fisher
Scientific		Cat#600-401-379-RTU; RRID:AB_22097511:500
AntibodyAnti-Digoxigenin-POD
(sheep polyclonal)		Millipore SigmaCat#11207733910; RRID:AB_5145001:1000
AntibodyAnti-Fluorescein-POD
(sheep polyclonal)		Millipore SigmaCat#11426346910; RRID:AB_8402571:1000
Biological sample
(Mus musculus)		Rosa26tdT;Gli1CreER brainsA.D.R. Garcia,
Drexel University		JAX #007913, #007914;
RRID: IMSR_JAX:007913, IMSR_JAX:007914
Peptide, recombinant proteinFluorescein RNA
Labeling Mix		RocheCat#11685619910
Peptide, recombinant proteinDIG RNA Labeling MixRocheCat#11277073910
Peptide, recombinant proteinSuperScript II Reverse
Transcriptase		Thermo Fisher ScientificCat#18064022
Peptide, recombinant proteinCholera Toxin Subunit B
(CTB, Recombinant),
Alexa Fluor 488 Conjugate		Thermo Fisher ScientificCAT#C22841
Peptide, recombinant proteinTamoxifenSigmaCAT#T5648-1G
Peptide, recombinant proteinCTB (Recombinant),
Alexa Fluor 555 Conjugate		Thermo Fisher ScientificCAT#C34776
Commercial assay, kitSuperScript II Reverse
Transcriptase First Strand
cDNA Synthesis kit		InvitrogenCat#18064014
Commercial assay, kitpGEM-T Easy Vector SystemsPromegaCat#A1360
Commercial assay, kitMAXIscript in vitro
Transcription Kit		AmbionCat#AM1312
Commercial assay, kitTyramide Signal
Amplification system		PerkinElmerCat#NEL753001KT
Commercial assay, kitiTaq Universal SYBR
Green Supermix		Bio-RadCat#1725124
Commercial assay, kitBio-Rad Total RNA
Extraction from Fibrous
and Fatty Tissue kit		Bio-RadCat#7326870
Commercial assay, kitRNAscope Multiplex
Fluorescent Reagent Kit V2		Advanced Cell
Diagnostics (ACD)		Cat#323100
OtherRNAseq datasets for
the developing mouse
dLGN and vLGN		DOI: https://doi.org/10.7554/eLife.33498.006Monavarfeshani et al., 2018
OtherSingle-cell RNAseq
dataset for RGC subtypes		DOI: https://doi.org/10.1038/s41467-018-05134-3Accession # GSE115404Rheaume et al., 2018
OtherSingle-cell RNAseq
dataset for RGCs at various ages		DOI: https://doi.org/10.7554/eLife.73809Accession # GSE185671Shekhar et al., 2022
Strain, strain
background (Mus musculus)		C57BL/6J miceThe Jackson LaboratoryJAX#000664; RRID:IMSR_JAX:000664
Strain, strain
background (Mus musculus)		Calb2CreThe Jackson LaboratoryJAX#010774; RRID:IMSR_JAX:010774
Strain, strain
background (Mus musculus)		Shhfl/flThe Jackson LaboratoryJAX#004293; RRID:IMSR_JAX:004293
Strain, strain
background (Mus musculus)		NesCreThe Jackson LaboratoryJAX#003771; RRID:IMSR_JAX:003771
Strain, strain
background (Mus musculus)		Aldh1l1-GFPS. Robel, Virginia TechStock#011015-UCD; RRID: MMRRC_011015-UCD
Strain, strain
background (Mus musculus)		Rosa26floxstop-TeNTA. Maximov, The Scripps
Research Institute		MGI:3839913Zhang et al., 2008
Strain, strain
background (Mus musculus)		Rosa26tdT(Ai14)The Jackson LaboratoryJAX#007914; RRID: IMSR_JAX:007914
Strain, strain
background (Mus musculus)		Gli1CreERAhn and Joyner, 2005JAX#007913; RRID: IMSR_JAX:007913
Strain, strain
background (Mus musculus)		Rosa26tdTThe Jackson LaboratoryJAX#007909; RRID:IMSR_JAX:007909
Strain, strain
background (Mus musculus)		Atoh7−/−S.W. Wang, University of
Texas MD Anderson
Cancer Center		Stock# 042298-UCD; RRID:MMRRC_042298-UCD
Strain, strain
background (Mus musculus)		Gli1nlacZ/+The Jackson LaboratoryJAX#008211; RRID:IMSR_JAX:008211Bai et al., 2002
Sequence-based reagentGad1 cloning primer
F: TGTGCCCAAACTGGTCCT; R: TGGCCGATGATTCTGGTT		Integrated DNA TechnologiesN/A
Sequence-based reagentGja1 cloning primer
F: CGTGAAGGGAAGAAGCGA;
R: GCCTGCAAACTGCCAAGT		Integrated DNA TechnologiesN/A
Sequence-based reagentShh qPCR primer
F: ACGTAGCCGAGAAGACCCTA;
R: ACTTGTCTTTGCACCTCTGAGT		Integrated DNA TechnologiesN/A
Sequence-based reagentGapdh qPCR primer
F: CGTCCCGTAGACAAAATGGT;
R: TTGATGGCAACAATCTCCAC		Integrated DNA TechnologiesN/A
Sequence-based reagent18s qPCR primer
F: GGACCAGAGCGAAAGCATTTG;
R: GCCAGTCGGCATCGTTTATG		Integrated DNA TechnologiesN/A
Sequence-based reagentCre genotyping primer
F: CGTACTGACGGTGGGAGAAT;
R: TGCATGATCTCCGGTATTGA		Integrated DNA TechnologiesN/A
Sequence-based reagentShhfl/fl genotyping primer
F: CAGAGAGCATTGTGGAATGG;
R: CAGACCCTTCTGCTCATGG		Integrated DNA TechnologiesN/A
Sequence-based reagenttdT genotyping primer
F: ACCTGGTGGAGT
TCAAGACCATCT;
R: TTGATGACGGCCA
TGTTGTTGTCC		Integrated DNA TechnologiesN/A
Sequence-based reagentGFP genotyping primer
F: AAGTTCATCTGCACCACCG; R: TCCTTGAAGAAGATGGTGCG		Integrated DNA TechnologiesN/A
Sequence-based reagentTeNT genotyping primer
FA: AAAGTCGCTCTGAGTTGTTAT;
RA: GGAGCGGGAGAAATGGATATG;
SA: CATCAAGGAAACCC
TGGACTACTG		Integrated DNA TechnologiesN/A
Sequence-based reagentAtoh7−/− genotyping primer
(to see the wild-type band)
F: ATGGCGCTCAGCTACATCAT;
R: GGGTCTACCTGGAGCCTAGC		Integrated DNA TechnologiesN/A
Sequence-based reagentNeo genotyping primer
(to see the mutant Atoh7 band)
F: GCCGGCCACAGTCGATGAATC;
R: CATTGAACAAGATGGATTGCA		Integrated DNA
Technologies		N/A
Recombinant DNA reagentMouse Fgf15 cDNAHorizon (Dharmacon)Cat#MMM1013-
202768318, Clone
ID: 5066286
Recombinant DNA reagentRNA scope probe-Mm-SmoACDCat#318411
Recombinant DNA reagentRNA scope probe-Mm-Ptch1-C2ACDCat#402811-C2
Recombinant DNA reagentRNA scope probe-Mm-Shh-C3ACDCat#314361-C3
Recombinant DNA reagentRNA scope 3-plex
positive control probe-mm		ACDCat#320881
Recombinant DNA reagentRNA scope 3-plex
negative control probe-mm		ACDCat#320871
Software, algorithmPrismGraphPadVersion 8.0; RRID: SCR_002798
Software, algorithmAdobe PhotoshopAdobe IncVersion: 21.1.2
Software, algorithmZEN black editionCarl ZeissVersion: 14.0.12.201
Software, algorithmFiji ImageJNIHVersion: 1.52p
Software, algorithmRStudioRStudio, IncVersion: 1.2.5042
OtherFgf15 riboprobeThis paperN/AInformation in ‘Riboprobe production’
OtherGad1 riboprobeThis paperN/AInformation in ‘Riboprobe production’
OtherGja1 riboprobeThis paperN/AInformation in ‘Riboprobe production’

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/79833/elife-79833-mdarchecklist1-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Rachana Deven Somaiya
  2. Katelyn Stebbins
  3. Ellen C Gingrich
  4. Hehuang Xie
  5. John N Campbell
  6. A Denise R Garcia
  7. Michael A Fox
(2022)
Sonic hedgehog-dependent recruitment of GABAergic interneurons into the developing visual thalamus
eLife 11:e79833.
https://doi.org/10.7554/eLife.79833