High hedgehog signaling is transduced by a multikinase-dependent switch controlling the apico-basal distribution of the GPCR smoothened
- Université Paris Cité, CNRS, Institut Jacques Monod, France
Figures
Figure 1 with 3 supplements
Cell surface Smoothened (SMO) is unevenly distributed along the apico-basal (Ap-Ba) axis and high levels of hedgehog (HH) promote its basolateral enrichment.
(A–A’) (A) Left: scheme of a wing imaginal disc (WID) with the posterior (P) compartment, where HH (in green) is produced, the anterior (A)/P boundary is represented by the dotted dark blue line and the dorsal/ventral (D/V) boundary by the dotted yellow line. The fading green color represents the anterior gradient formed by HH (across about 12 rows of cells). The apGal4 driver used to express SNAP-smo, is expressed in the dorsal compartment. The circle represents the wing pouch. The rectangle indicates the region that is shown in the XY images. Right: the x (D/V), y (A/P), and z (Ap-Ba) axis used for imaging are in yellow, blue, and red, respectively. Here and in all the XY images, the dorsal compartment is to the top. (A’) Scheme of an antero-posterior XZ section of the wing pouch with the columnar epithelium at the bottom (c.e., which is represented in (A) and studied here) and the peripodial epithelium at the top (p.e.), with their respective apical sides facing a lumen (lu.). (B–B”) Confocal XY sections along the Ap-Ba axis (as indicated) of a third instar larva WID expressing UAS SNAP-smo (driven by apGal4) in the dorsal compartment and labeled with a non-liposoluble fluorescent SNAP substrate. The scale bar represents 20 µm. Here and in the other XY images: the dorsal part of the wing pouch is shown, the discs are oriented anterior to the left, dorsal up, and the A/P boundary is represented by a vertical dotted white line drawn based on the absence of cubitus interruptus (CI) labeling in the P compartment (see Figure 1—figure supplement 2B). Here, in C–C” and F–F” the images were acquired using the confocal LSM980 spectral Airyscan 2, 63×. (C–C”) Confocal XZ antero-posterior image in the dorsal part of an apGal4; UAS SNAP-smo third instar larva wing pouch labeled for Surf SNAP-SMO with a non-liposoluble fluorescent SNAP substrate (C, green in C’’) and immunolabeled for CI-F (C’, red in C’’). Merged image in (C’’). Based on CI staining, four regions (represented between the C and C’ images and separated by dotted white lines) are identified along the antero-posterior axis: the P region (green), and three A regions: CI-A (low levels of full-length activated CI, in purple), CI-F (higher levels of CI full-length, in pink) and CI-R (CI repressor not detected by the anti-CI antibody used here, in red). This image was reconstituted from the XY stack that includes the three sections shown in B–B”. Here and in the other XZ images: the discs are oriented anterior to the left, apical up, the A/P boundary is represented by a vertical dotted white line, and the scale bars are 10 µm. (D–E) Graphs showing the mean intensity (D) and the relative intensity (calculated for each region along the Ap-Ba axis as the ratio of its integrated density over the integrated density of the height of the disc, which is designated the column) (E) of Surf SNAP-SMO in the apical, lateral, and basal domains (in light, medium, and dark blue, respectively) of the CI-R (R), CI-F (F), CI-A (A), and P regions. N=33. Here and in the other figures, all the quantifications were done using projections of eight XZ sections that were directly acquired using an SP5 AOBS confocal, 40×. The error bars represent the SD and the statistical analysis was performed using paired t-test for the mean intensities and Wilcoxon matched-pairs signed rank tests for the relative intensities. (F–F”) Confocal XZ images in the dorsal part of WIDs from apGal4; UAS SNAP-smo, hhts2 flies in which HH was inactivated at the restrictive temperature prior to dissection and labeling of Surf SNAP-SMO (F, green in F’’) and CI-F (indicated here as CI, in F’, red in F’’). Merged image in (F’’).
-
Figure 1—source data 1
Mean intensity of Surf SNAP-SMO along the apico-basal axis.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Relative intensity of Surf SNAP-SMO along the apico-basal axis.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig1-data2-v1.xlsx
Figure 1—figure supplement 1
SNAP-Smoothened (SNAP-SMO) activity.
(A) Wing of a smoD16/smoD16; BAC (CH322-98K24) SNAP-smo/BAC (CH322-98K24) SNAP-smo fly with a wild type phenotype. This indicates that BAC (CH322-98K24) SNAP-smo rescues the effects of smo loss of function (i.e. embryonic lethality) and restores normal wing patterning. (B–B”) XY confocal images of wing imaginal discs (WIDs) of smoD16/smoD16; BAC (CH322-98K24) SNAP-smo/BAC (CH322-98K24) SNAP-smo third instar larvae after co-immunolabeling EN (B, green in B”) and cubitus interruptus-F (CI-F) (B’, red in B”). Merged images in (B”). Both the expression of (engrailed) en in the anterior compartment near the anterior (A)/posterior (P) and the decrease of CI-F levels, which depend on high levels of hedgehog (HH), are restored, further confirming that BAC (CH322-98K24) SNAP-smo is fully functional. Note that en is also expressed in the P compartment independently of HH. Here and in the other XY images, the scale bar is 50 µm. (C–C”) XY confocal images of WIDs of apGal4; UAS SNAP-smo third instar larvae after co-immunolabeling EN (C, green in C’’) and CI-F (C’, red in C’’). Merged images in (C”). Note that the lack of effect of SNAP-SMO overexpression confirms numerous reports that have shown that the overexpression of tagged and untagged forms of SMO has no effect on HH signaling.
Figure 1—figure supplement 2
Analysis of the apico-basal (Ap-Ba) distribution of SNAP-Smoothened (SNAP-SMO).
(A) Schematic representation of the method used for labeling SNAP-SMO. In brief, after dissection, the fraction of SNAP-SMO present at the cell surface (thereby called Surf SNAP-SMO) was specifically labeled using a non-liposoluble fluorescent SNAP ligand before fixation. For Intra SNAP-SMO labeling, the discs were then washed, and incubated with a non-liposoluble, non-fluorescent reagent (to block any labeled Surf SNAP-SMO) before being labeled again with a liposoluble reagent carrying a different fluorochrome. (B) Cubitus interruptus-F (CI-F) immunolabeling of the apGal4; UAS SNAP-smo wing imaginal disc (WID) shown in Figure 1B’. The ci is expressed only in the anterior (A) region of the disc. (C) Definition and representation of the different regions of the WIDs labeled for Surf SNAP-SMO. XZ images of an apGal4; UAS SNAP-smo WID labeled for Surf SNAP-SMO (left, green in the left bottom image and white and black in the bottom right) and immunolabeled for CI-F (blue in bottom left image) and/or Discs large (DLG, red in left images), respectively. The top right shows the four different regions defined from CI-F labeling pattern and that was used for quantification (called R, F, A, P; the abbreviations and color code are as indicated in Figure 1). The bottom right shows the different regions that were defined among the Ap-Ba axis: based on DLG labeling, the apical region was set as corresponding on average (from n>10 discs) to the 15% most apical part of the wing proper epithelium, while the basal region was arbitrarily defined as the 10% most basal region, and the lateral/intermediate region as (75% of the disc’s height) in between. Column corresponds to the entire height of the epithelium (i.e. 100%). Note that in all figure supplements except for Figure 5—figure supplement 1 panels B–B”, the images were taken with a Leica confocal SP5, which allows direct XZ imaging of a sufficient number of discs to allow the quantifications presented in all the figures. (D–D’) XZ confocal images of apGal4; UAS SNAP-smo imaginal discs showing CI-F (D) and Intra SNAP-SMO (D’, labeled as in (A–A’’’)). In all the regions of the disc, Intra SNAP-SMO is present in vesicle-like dots that are mainly in the intermediate region of the cells. Here and in the other XZ images, the scale bar is 10 µm. (E) Quantification of the mean intensities of Intra SNAP-SMO along the Ap-Ba axis in the far anterior (FA) and posterior (P) regions of the disc as the one shown in (D’ or C). Intra SNAP-SMO levels along the Ap-Ba axis are comparable in the P and FA regions. (F–F”) XY confocal images of WIDs of apGal4; UAS SNAP-smo, hhts2 flies co-immunolabeled for EN (F, green in F”) and CI-F (F’, red in F”). Merged image in (F”).
-
Figure 1—figure supplement 2—source data 1
Mean intensity of Intra SNAP-SMO along the apico-basal axis.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig1-figsupp2-data1-v1.xlsx
Figure 1—figure supplement 3
Apico-basal (Ap-Ba) distribution of immunolabeled endogenous Smoothened (SMO) or Surf SNAP-SMO expressed at endogenous levels.
(A) XZ confocal images of wild-type wing imaginal discs (WIDs) immunolabeled for endogenous SMO (A, green in the merged image A”) and cubitus interruptus-F (CI-F) (A’, blue in merge image A”). (B) Relative intensities of endogenous immunolabeled SMO along the Ap-Ba axis in the far anterior (FA) and posterior (P) regions. (C) XY confocal images of Surf SNAP-SMO (C, green in the merge image C”) in WIDs of smoD16/smoD16; BAC (CH322-98K24) SNAP-smo/BAC (CH322-98K24) SNAP-smo third instar larva. CI-F is shown in (C’), red in (C”). The endogenous levels of SNAP-SMO are too low to allow accurate quantification. Note that, unlike SNAP-smo driven by apGal4, endogenous smo and SNAP-smo carried by the BAC are expressed at low levels in the peripodial epithelium (p.e, black arrow), just above the apical region of the cells of the columnar epithelium, which makes the observations more complicated. Of note, for overexpressed SNAP-SMO, the basal population of endogenous SMO or SNAP-SMO expressed at endogenous levels is increased in the presence of hedgehog (HH). However, although both are present in the apical region, they do not strongly accumulate in this region as observed with overexpressed SNAP-SMO (compared to Figure 1C and A, C). Given the following data (in Figure 2 and Figure 2—figure supplement 1), which show that endogenous SMO, SNAP-SMO expressed at endogenous levels or overexpressed SNAP-SMO are all initially targeted to the apical surface, where they are endocytosed, it is likely that this apical endocytosis of neosynthesized SNAP-SMO might be a limiting step under the overexpression conditions.
-
Figure 1—figure supplement 3—source data 1
Relative intensity of endogenous SMO (immunolabeling).
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig1-figsupp3-data1-v1.xlsx
Figure 2 with 1 supplement
Blocking Smoothened (SMO) endocytosis favors its accumulation in the apical region independently of hedgehog (HH).
(A–B) XZ confocal images of wing imaginal discs (WID) from shi+; apGal4; UAS SNAP-smo (A, called ctr for control in C and C’) or shits; apGal4; UAS SNAP-smo (B, called shits in C and C’) male flies put at the restrictive temperature for 30 min before dissection, labeling of Surf SNAP-SMO and imaging under the same conditions. Note that here and in all the following figures the images were taken using an SP5 AOBS confocal, 40× oil. (C–C’) Quantification of the mean intensities (C) and relative intensities (C’) of Surf SNAP-SMO in the different regions of the disc (far anterior [FA] and posterior [P]) and along the apico-basal (Ap-Ba) axis, as indicated. The mean intensity is also shown for the whole epithelial column (gray). N=17 and 10 for ctr and shits flies, respectively. (D–E”) XZ confocal images of WIDs from apGal4, Gal80ts; UAS SNAP-smo (D) (ctr) or apGal4, Gal80ts/+; UAS SNAP-smo/UAS YFP-rab5CA (E–E”) flies put at the restrictive temperature for 24 hr (to allow YFP-rab5CA expression) before dissection and labeling for Surf SNAP-SMO. In the latter case, E” is a merged image with Surf SNAP-SMO in green and YFP-RAB5CA in red. Note that for better visualization of SMO, imaging of YFP-rab5CA and ctr discs were not acquired under the same conditions. (F) The relative intensity of Surf SNAP-SMO along the Ap-Ba axis in apGal4, Gal80ts; UAS SNAP-smo ctr discs (called ctr, n=11) and apGal4, Gal80ts/+; UAS SNAP-smo/UAS YFP-rab5CA (called rab5CA, n=8) discs. (G) The relative intensity of Surf SNAP-SMO along the Ap-Ba axis in apGal4; UAS SNAP-smo (called ctr, n=20) and apGal4/UAS smurf RNAi; UAS SNAP-smo (called smurf RNAi, n=6) discs. Note that YFP-rab5CA or smurf RNAi overexpression has a much stronger effect than shits inactivation, reflecting that endocytosis is blocked for a much shorter time in the latter case. Here and in all the following figures, the XZ images correspond to a unique single XZ section.
-
Figure 2—source data 1
Mean intensity of Surf SNAP-SMO for control and shits flies.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Relative intensity of Surf SNAP-SMO for control and shits flies.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig2-data2-v1.xlsx
-
Figure 2—source data 3
Relative intensity of Surf SNAP-SMO for control and RAB5CA flies.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig2-data3-v1.xlsx
-
Figure 2—source data 4
Relative intensity of Surf SNAP-SMO for control and smurf RNAi flies.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig2-data4-v1.xlsx
Figure 2—figure supplement 1
Effect of shits and rab5CA on Surf SNAP-Smoothened (SNAP-SMO).
(A–B) The false color representation of XY confocal lateral section of a wing imaginal disc (WID) (dorsal part of pouch) of shi+; apGal4; UAS SNAP-smo (A) or shits; apGal4; UAS SNAP-smo (B) male flies put at restrictive temperature before dissection and labeling of Surf SNAP-SMO. (C–D) XY confocal images of WIDs from apGal4, Gal80ts; UAS SNAP-smo (C) or apGal4, Gal80ts/+; UAS SNAP-smo/UAS YFP-rab5CA (D-D”) flies put at restrictive temperature before dissection and Surf SNAP-SMO labeling. Surf SNAP-SMO in C, D, and green in D”. YFP-RAB5CA (noted RAB5CA, in D, red in D”). (E) Quantification of the apico-basal (Ap-Ba) distribution of Surf SNAP-SMO in WIDs of shits; apGal4; UAS SNAP-smo male flies kept at permissive temperature (18°C) (N=7) or shifted to the restrictive temperature (30°C) prior to dissection (N=10) (as indicated). The difference seen between the two conditions confirms that the effects in Figure 2B, C and C’ are due to the inactivation of the shits allele. (F) Quantification of the Ap-Ba distribution of Surf SNAP-SMO in WIDs of shi+; apGal4; UAS SNAP-smo (control [ctr]) or shits; apGal4; UAS SNAP-smo kept at 18°C. The same distribution is seen for the two genotypes, indicating that the effects in Figure 2B, C and C’ are due to the inactivation of the shits allele. N=8 for the ctrs and n=7 for the shits flies. (G–G”) XZ confocal images of apGal4, Gal80ts/UAS YFP-rab5CA WIDs labeled for endogenous SMO (G, green in G”) and showing YFP-RAB5CA (indicated as RAB5CA), G’, red in G”. (H–H”) XZ confocal images of apGal4, Gal80ts/+; BAC (CH322-98K24) SNAP-smo/UAS YFP-rab5CA WIDs labeled for Surf SNAP-SMO (H, red in H”) and showing YFP-RAB5CA (H’, red in H”). Here and in (G–G”), flies were put at restrictive temperature before dissection. These data (G–G”, H–H”) show that both endogenous SMO and SNAP-SMO expressed from the BAC are, as overexpressed SNAP-SMO, addressed to the apical cell surface where they are endocytosed in a RAB5 dependent manner. This indicates that their overexpression does not impact their intracellular journey.
-
Figure 2—figure supplement 1—source data 1
Relative intensity of Surf SNAP-SMO in shibirets flies at 18°C or 30°C.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig2-figsupp1-data1-v1.xlsx
-
Figure 2—figure supplement 1—source data 2
Relative intensity of Surf SNAP-SMO in control and shibirets flies at 18°C.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig2-figsupp1-data2-v1.xlsx
Figure 3 with 1 supplement
Hedgehod (HH) controls the fate of endocytosed Smoothened (SMO), favoring its recycling and leading to its basolateral accumulation.
XZ confocal images of dissected wing imaginal discs expressing UAS SNAP-smo fixed immediately (0 min) (A) or 15 min (B) after labeling of Surf SNAP-SMO. Quantification of the mean intensity (C) and of the relative intensity (D) in the far anterior and posterior regions of the disc and along the apico-basal axis. N=20 for 0 min and 23 for 15 min. Int: intermediate. The discs were treated in the same conditions, all the images were acquired under the same conditions and the dynamic range was normalized to allow a better comparison of Surf SNAP-SMO.
-
Figure 3—source data 1
Mean intensity of Surf SNAP-SMO at T0 and at T15'.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Relative intensity of Surf SNAP-SMO at T0 and T15'.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig3-data2-v1.xlsx
Figure 3—figure supplement 1
The fate of endocytosed SNAP-Smoothened (SNAP-SMO).
(A–A”) ( B–B”) Colocalization of endocytosed Surf SNAP-SMO with RAB7. XY (A–A”) and XZ (B–B”) confocal images of apGal4; UAS SNAP-smo wing imaginal discs labeled for Surf SNAP-SMO A, B, green in A”, (B”) and immunolabeled for RAB7 A’, B’, red in A”, (B”). (C–C’) Graphs showing the % of the decrease in Surf SNAP-SMO between t0 and t15 in the far anterior (FA) (–HH) and posterior (P) regions (+HH) calculated as (t0–t15)/t0. Column in gray, apical, intermediate, and basal as indicated. t0: n=20. t15: 20 discs were chosen at random among the 23 discs. This was done with three randomly picked sets of 20 discs to ensure robustness.
-
Figure 3—figure supplement 1—source data 1
Percentage of decrease in Surf SNAP-SMO between T0 and T15.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
The apico-basal (Ap-Ba) distribution of Smoothened (SMO) is controlled by phosphorylation by the protein kinase A (PKA)/ casein kinase I (CKI) and Fused (FU) kinases.
(A–D) Confocal images of wing imaginal discs labeled for Surf SNAP-SMOWT (A), SNAP-SMOPKA-SD (B), SNAP-SMOPKA-SD FU-SA (C), and SNAP-SMOPKA-SD FU-SD (D). Note that for better visualization of SMO, imaging of the different forms of SNAP-SMO was not done under the same conditions. See also the corresponding false-color images in Figure 4—figure supplement 1A. (E–E”) Quantification of the Ap-Ba distribution of the different forms of SNAP-SMO, as indicated. N=21 WT, 10 PKA-SD, 17 PKA-SD FU-SA, and 18 PKA-SD FU-SD discs, respectively. (See Figure 4—figure supplement 1E) showing the reproducibility of Surf SNAP-SMOWT distribution. Note that the effects of the PKA-SD mutations are even stronger than the effect of hedgehog (HH) on SNAP-SMOWT, probably because in presence of HH, only a fraction of the SMO population is phosphorylated (Sanial et al., 2017).
-
Figure 4—source data 1
Relative intensity of Surf SNAP-SMO for different SMO mutants.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Effect of the phosphorylation of Smoothened (SMO) by the protein kinase A (PKA) and Fused (FU) kinases on its accumulation and signaling activity.
(A, A’-D, D’) False color representation of the accumulation at the cell surface of wild type and mutant forms of SNAP-SMO (as indicated and expressed in the dorsal part of the wing discs using the apGal4 driver). (A, D) XY section. (A’–D’) XZ projection. All discs were imaged in the same conditions. Enlargements are shown at the bottom that corresponds to the frames indicated above. (E) Comparison of the relative intensities of wild type Surf SNAP-SMO in the experiments shown in Figures 1 and 4 called WT1 and WT2 respectively. Both sets of experiments display a very similar distribution of SNAP-SMO along the apico-basal axis, both with (P) and without hedgehog (HH) (far anterior [FA]). This shows the reproducibility of our data. (F–F”) XY confocal images of apGal4, SNAP-smoPKA-SD wing imaginal discs (WIDs) after co-immunolabeling EN (F, F”) and CI-F (F’, F”). Merged images in (F”). (G–G”) XY confocal images of apGal4, SNAP-smoPKA-SD FU-SA WIDs after co-immunolabeling EN (G, G”) and CI-F (G’, G”). Merged images in (G”).
-
Figure 4—figure supplement 1—source data 1
Relative intensity of Surf SNAP-SMO in WT1 and WT2.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 2 supplements
Trapping the Fused (FU) kinase to the apical region promotes the stabilization of Smoothened (SMO) at the cell surface.
Confocal images of wing imaginal discs coexpressing (using the apGal4 driver) GFP-fu and T48 or NVR1 fused to the mcherry (mche). XY sections are shown in (A–A”’ and C–C”’), anterior YZ sections in (B–B”’ and D–D”’). The mche is shown in (A, B, C, and D), GFP-FU in A’, B’ C’, and D’, green in the merged images A”’, B”’, C”’, and D”’ and immunolabeled endogenous SMO in A”, B”, C” and D”, red in the merged images A”’, B”’, C”’, and D”’. Note that contrary to SNAP-SMO, endogenous SMO is also present in the peripodial membrane (black arrow above the SMO images). D: dorsal, V: ventral, A: anterior, P: posterior, ap: apical, and ba: basal. Here and in Figure 6, the scale bar for XY section represents 50 µm.
Figure 5—figure supplement 1
Fused (FU) and Smoothened (SMO) colocalization.
(A-A’) Confocal images of wild type discs immunolabeled for FU. XY section in (A) and XZ section in (A’). (B–B”) XY confocal images of endogenous SMO (left panels) and FU (center panels) immunolabeled in wing imaginal discs of wild type flies. Merge images are shown in the right panels. Sections at different levels of the apico-basal axis are shown (apical B, medial B’, and basal B”). Imaging was done using the LSM980 spectral Airyscan 2, 63×. Scale bar: 10 μm. (C) XZ confocal image in the dorsal part of a disc expressing GFP-fu (under the apGal4 driver). GFP-FU distribution is similar to the one observed for endogenous FU.
Figure 5—figure supplement 2
Effect on the subcellular localization of Smoothened (SMO) of trapping the Fused (FU) kinase to the apical (ap) or basolateral region.
(A–A’’’, B–B’’’) YZ confocal images of wing imaginal discs (WIDs) coexpressing (using the apGal4 driver), GFP-fu with either mche-T48 or mche-NVR1. mcherry (A and B, respectively, red in the merged image A’’ and B”), GFP-FU (A’ and B’ green in A” and B”); immunolabeled endogenous SMO (A”’ and B”’). The YZ sections correspond to dorso-ventral sections in the posterior compartment with the apical left, and dorsal up. (C-C”) YZ confocal images of a BAC (CH322-98K24) SNAP-smo/BAC (CH322-98K24) SNAP-smo WIDs coexpressing (using the apGal4 driver), GFP-fu with mche-T48. mcherry (C), GFP-FU (C’, green in the merge image C”’), Surf SNAP-SMO (C”, red in C”’). (D, D’) Quantification of the mean intensity in the far anterior (D, corresponding to Figure 5B”) and posterior regions (D’, corresponding to B”) and of the relative intensity (D”) in the far anterior region. Note that the quantification method excluded the endogenous SMO labeling in the peripodial epithelium.
-
Figure 5—figure supplement 2—source data 1
Relative and mean intensity of endogenous SMO in T48 GFP-FU flies.
- https://cdn.elifesciences.org/articles/79843/elife-79843-fig5-figsupp2-data1-v1.xlsx
Figure 6 with 1 supplement
Trapping the Fused (FU) kinase to the apical region is sufficient to promote medium but not high hedgehog (HH)/ Smoothened (SMO) signaling.
Confocal XY images of discs expressing GFP-fused with mche-T48 in fuWT (A–B) or knockout (fuKO) context (E–F), with mche-NVR1 in fuWT (C–D) or alone in fuKO context (G–H) and immunolabeled for Patched (PTC) (A, C, E, and G) or EN (B, D, F, and H). In (A–D), the normal pattern of expression of these genes is visible in the ventral region of the discs.
Figure 6—figure supplement 1
Effect of trapping the Fused (FU) kinase on decapentaplegic (dpp) expression.
(A, B) Confocal images of discs expressing GFP-fu with mche-T48 (A) or with mche-NVR1 (B) immunolabeled for the β-galactosidase (dpp-Z, to report dpp expression). (C, D) Construction of the fuKO mutant by CRISPR.
Figure 7
Model: hedgehog (HH) controls the fate of endocytosed Smoothened (SMO) via a multikinase phosphorylation barcode.
SMO is initially targeted (curved arrow) to the apical plasma membrane (presented in pink), where it is endocytosed (vesicle on the top, with a pink membrane). Endocytosed SMO can then be sent to the lysosome for degradation (vesicle on the left with gray membrane), recycled to the apical membrane, or transcytosed to the basolateral membrane (represented in blue), where it can, in turn, be re-endocytosed (followed by recycling or degradation). HH controls several of these steps via the graded action of the proteing kinase A (PKA)/casein kinase I (CKI) and Fused (FU) kinases. The double arrow represents the diffusion of SMO in the basolateral plasma membrane. In absence of HH (left panel), a large fraction of endocytosed SMO is targeted for degradation at the expense of its recycling (reduced recycling is indicated by gray arrows). In that situation, the C-terminal cytoplasmic domain of SMO is not phosphorylated and adopts a closed, inactive conformation. Conversely, in presence of HH (see middle and right panels) the degradation of endocytosed SMO is reduced (gray arrows), in favor of its recycling (green arrows), especially in the basolateral region. These effects of HH lead to an increased accumulation of SMO at the cell surface and require the phosphorylation of the C-terminal cytoplasmic domain of SMO by the PKA/CKI. This triggers a change in the conformation of this region, which is associated with the activation of SMO. In the presence of intermediate levels of HH (middle panel), SMO accumulation and/or activation reaches a threshold that in turn activates FU, which then retroacts on SMO, further enhancing the stabilizing and activating effects of the PKA/CKI kinases. The fact that FU is required for that effect in the apical region, suggests that the PKA/CKI also acts in this domain. In the presence of high levels of HH (right panel), FU is further activated and promotes the enrichment of SMO in the most basal region by phosphorylating its C-terminal cytoplasmic domain, which likely increases its clustering. This favors SMO’s trapping in the most basal region, which leads to high levels of HH signaling. The green arrow on the bottom right corner indicates a putative diffusion trapping mechanism, the gray bottom arrow indicates that recycling may be subsequently reduced.
Author response image 1
Author response image 2
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | apGal4 | Weihe et al., 2001 | FLYB: FBtp0084979 | FlyBase symbol: P{ap-GAL4.U} |
| Genetic reagent (D. melanogaster) | UAS SNAP-smoWT | Sanial et al., 2017 | ||
| Genetic reagent (D. melanogaster) | UAS SNAP-smoPKA-SD | This paper | Generated by BestGene Inc using the PhiC31 integration system | |
| Genetic reagent (D. melanogaster) | UAS SNAP-smoPKA-SD FU-SA | This paper | Generated by BestGene Inc using the PhiC31 integration system | |
| Genetic reagent (D. melanogaster) | UAS SNAP-smoPKA-SD FU-SD | This paper | Generated by BestGene Inc using the PhiC31 integration system | |
| Genetic reagent (D. melanogaster) | hhts | Heemskerk and DiNardo, 1994 | FLYB: FBal0031490 | |
| Genetic reagent (D. melanogaster) | shibirets | van der Bliek and Meyerowitz, 1991 | FLYB: FBal0015610 | |
| Genetic reagent (D. melanogaster) | apGal4 Gal80ts | Gift from F Schweisguth | ||
| Genetic reagent (D. melanogaster) | UAS-YFP-rab5CA | Hugo J. Bellen, Baylor College of Medicine | RRID:BDSC_9773 | |
| Genetic reagent (D. melanogaster) | UAS smurf RNAi | Perkins et al., 2015 | RRID:BDSC_40905 | |
| Genetic reagent (D. melanogaster) | UAS mCherry-NVR1-GFP nanobody | Harmansa et al., 2017 | RRID:BDSC_68175 | |
| Genetic reagent (D. melanogaster) | UAS mCherry-T48-GFP nanobody | Harmansa et al., 2017 | RRID:BDSC_68178 | |
| Genetic reagent (D. melanogaster) | UAS GFP-fused | Ruel et al., 2003 | ||
| Genetic reagent (D. melanogaster) | dpp-LacZ, apGal4 | Gift from R Holmgren | dpp-LacZ RRID:BDSC_12379 | |
| Genetic reagent (D. melanogaster) | w1118 | Hazelrigg et al., 1984 | FLYB: FBal0018186 | FlyBase symbol: Dmel\w1118 |
| Genetic reagent (D. melanogaster) | BAC SNAP- smo | This paper | snap insertion via recombineering mediated gap-repair. Fly generated by BestGene Inc using the PhiC31 integration system. | |
| Genetic reagent (D. melanogaster) | fuKO/FM0Bar | This paper | fu knockout (KO) mutant fly generated via CRISPR/ Cas9 by inDROSO | |
| Antibody | anti-PTC (mouse monoclonal) | DSHB, Martín et al., 2001 | DSHB Cat# Drosophila Ptc (Apa 1), RRID:AB_528441 | IF(1:50) |
| Antibody | anti-EN (mouse monoclonal) | DSHB, University of Iowa, USA, Patel et al., 1989 | DSHB Cat# 4D9 anti-engrailed/invected, RRID:AB_528224 | IF(1:50) |
| Antibody | anti-DLG (mouse monoclonal) | DSHB, Parnas et al., 2001 | DSHB Cat# 4F3 anti-discs large, RRID:AB_528203 | IF(1:50) |
| Antibody | anti-SMO (mouse monoclonal) | DSHB, Lum et al., 2003 | DSHB Cat# Smoothened (20C6), RRID:AB_528472 | IF(1:100) |
| Antibody | anti-Rab7 (mouse monoclonal) | DSHB, University of Iowa, USA, | DSHB Cat# Rab7, RRID:AB_2722471 | IF(1:25) |
| Antibody | anti-FU (rabbit polyclonal) | Gift from Ruel et al., 2003 | IF(1:100) | |
| Antibody | anti-β-Galactosidase (rabbit polyclonal) | MP Biomedicals | 085597-CF | IF(1:100) |
| Antibody | anti-CI (rat monoclonal 2A1) | Gift from Motzny and Holmgren, 1995 | IF(1:5) | |
| Antibody | anti-mouse IgG Alexa Fluor Plus 555 (goat polyclonal) | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A32727, RRID:AB_2633276 | IF(1:200) |
| Antibody | anti-rat IgG Alexa Fluor Plus 647 (goat polyclonal) | Thermo Fisher Scientific | Thermo Fisher Scientific, Cat# A-21247, RRID: AB_141778 | IF(1:200) |
| Antibody | anti-rabbit IgG Alexa Fluor Plus 555 (goat polyclonal) | Thermo Fisher Scientific | Thermo Fisher Scientific, Cat# A32732, RRID: AB_2633281 | IF(1:200) |
| Antibody | anti-rabbit IgG Alexa Fluor Plus 488 (Goat polyclonal) | Thermo Fisher Scientific | Thermo Fisher Scientific, Cat# A32731, RRID: AB_2633280 | IF(1:200) |
| Antibody | anti-rabbit IgG Alexa Fluor Plus 647 (goat polyclonal) | Thermo Fisher Scientific | Thermo Fisher Scientific, Cat# A-21245, RRID: AB_253581 | IF(1:200) |
| Antibody | anti-mouse IgG cross adsorbed 488 (chicken polyclonal) | Thermo Fisher Scientific | Thermo Fisher Scientific, Cat# A-21200, RRID: AB_2535786 | IF(1:200) |
| Antibody | anti-mouse IgG Dylight 649 (donkey polyclonal) | Jackson Immuno | 715-495-151 | IF(1:200) |
| Recombinant DNA reagent (D. melanogaster) | BAC smo | BAC Resources PAC | CH322-98K24 | https://bacpacresources.org/home.htm |
| Recombinant DNA reagent | BAC snap-smo | This paper | snap cDNA introduced in CH322-98K24 after Serine 33 codon of smo | |
| Recombinant DNA reagent | pENTR/D-TOPO-snap smo | Sanial et al., 2017 | Template for snap amplification | |
| Recombinant DNA reagent | pENTR/D-TOPO-snap smoPKA-SD | Sanial et al., 2017 | ||
| Recombinant DNA reagent | pENTR/D-TOPO-snap smoPKA-SD FU-SA | Sanial et al., 2017 | ||
| Recombinant DNA reagent | pENTR/D-TOPO-snap smoPKA-SD FU-SD | Sanial et al., 2017 | ||
| Recombinant DNA reagent | pUASt-GW-attB | Brigui et al., 2015 | ||
| Sequence-based reagent | rpsL-neo/smo mRNA 360 /F | Eurofins Genomics | PCR primers | AGGTTGCGATCTTATGCCTGTGGGTGGTCGCAGACGCATCGGCCAGTTCGggcctggtgatgatggcgggatcg |
| Sequence-based reagent | rpsL-neo/smo mRNA 462 /R | Eurofins Genomics | PCR primers | AGTTCCACATCCGACTGCTGCGCACTTGCGGGCGTTGTGCTGCCGAACTTGGCtcagaagaactcgtcaagaaggcg |
| Sequence-based reagent | pEnSnapSmo/smo mRNA 360 /F | Eurofins Genomics | PCR primers | AGGTTGCGATCTTATGCCTGTGGGTGGTCGCAGACGCATCGGCCAGTTCG |
| Sequence-based reagent | pEnSnapSmo/smo mRNA 462 /R | Eurofins Genomics | PCR primers | AGTTCCACATCCGACTGCTGCGCACTTGCGGGCGTTGTGCTGCCGAACTTGGC |
| Sequence-based reagent | smo mRNA 289/Seq/F | Eurofins Genomics | PCR primers | GACTCGCCTCTGGCAAATGG |
| Sequence-based reagent | smo mRNA 512/Seq/R | Eurofins Genomics | PCR primers | TGCCCTTCTTGGCGTACAGTCGG |
| Sequence-based reagent | Rpsl/neo/273/Seq/F | Eurofins Genomics | PCR primers | GAACTCCGCGCTGCGTAAAGTATG |
| Sequence-based reagent | snap/203/Seq/F | Eurofins Genomics | PCR primers | CCTACTTTCACCAGCCTGAG |
| Chemical compound, drug | SNAP-Surface Alexa Fluor 488 | New England Biolabs | Cat#S9124S | 3.3 µM |
| Chemical compound, drug | SNAP-Surface Alexa Fluor 546 | New England Biolabs | Cat#S9132S | 3.3 µM |
| Chemical compound, drug | SNAP-Surface Block | New England Biolabs | Cat#S9143S | 2 µM |
| Chemical compound, drug | SNAP-Surface Alexa Fluor 647 | New England Biolabs | Cat#S9136S | 3.3 µM |
| Software, algorithm | Fiji | Schindelin et al., 2012 | Fiji, RRID:SCR_002285 | http://fiji.sc/ |
| Software, algorithm | Adobe Photoshop | Adobe | RRID: SCR_014199 | https://www.adobe.com/products/photoshop.html |
| Software, algorithm | Adobe Illustrator | Adobe | RRID:SCR_010279 | http://www.adobe.com/products/illustrator.html |
| Software, algorithm | Adobe InDesign | Adobe | RRID:SCR_021799 | https://www.adobe.com/fr/products/indesign.html |
| Software, algorithm | Prism – GraphPad 9 | Graph Pad Software | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/79843/elife-79843-mdarchecklist1-v1.pdf
-
Source code 1
Fiji Macro for the quantification.
- https://cdn.elifesciences.org/articles/79843/elife-79843-code1-v1.zip
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
High hedgehog signaling is transduced by a multikinase-dependent switch controlling the apico-basal distribution of the GPCR smoothened
eLife 11:e79843.
https://doi.org/10.7554/eLife.79843
