Interplay between PML NBs and HIRA for H3.3 dynamics following type I interferon stimulus
- University of Lyon, Université Claude Bernard Lyon 1, CNRS UMR 5261, INSERM U 1315, LabEx DEVweCAN, Institut NeuroMyoGène (INMG), Pathophysiology and Genetics of the Neuron and Muscle (PGNM) laboratory, team Chromatin Dynamics, Nuclear Domains, Virus, France
- Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR 5310, INSERM U 1217, Institut NeuroMyoGène (INMG), team Nerve-Muscle interactions, France
Figures
Figure 1 with 1 supplement
HIRA accumulation in PML NBs correlates with increased PML concentration in primary cells.
(A–B) (top) Fluorescence microscopy visualization of HIRA (green) and PML (red) in BJ cells treated with Poly(I:C) at 10 μg/mL for 24 hr (left) or with TNFα at 100 ng/mL for 24 hr (right). …
-
Figure 1—source data 1
Raw WB for Figure 1C (left panel) for PML and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data1-v1.tif
-
Figure 1—source data 2
Raw WB for Figure 1C (left panel) for PML and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data2-v1.tif
-
Figure 1—source data 3
Raw WB for Figure 1C (right panel) for PML.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data3-v1.tif
-
Figure 1—source data 4
Raw WB for Figure 1C (right panel) for PML with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data4-v1.tif
-
Figure 1—source data 5
Raw WB for Figure 1C (right panel) for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data5-v1.tif
-
Figure 1—source data 6
Raw WB for Figure 1C (right panel) for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data6-v1.tif
-
Figure 1—source data 7
Raw WB for Figure 1D for SP100.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data7-v1.tif
-
Figure 1—source data 8
Raw WB for Figure 1D for SP100 with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data8-v1.tif
-
Figure 1—source data 9
Raw WB for Figure 1D for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data9-v1.tif
-
Figure 1—source data 10
Raw WB for Figure 1D for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-data10-v1.tif
Figure 1—figure supplement 1
Impact of various cytokines on HIRA localization in PML NBs.
(A) (left) Fluorescence microscopy visualization (left) of HIRA (green) and PML (red) in BJ cells treated with IFNβ at 1000 U/mL for 24 hr. Ruxolitinib (Ruxo) was added at 2 μM 1 hr before IFNβ and …
-
Figure 1—figure supplement 1—source data 1
Raw WB for Figure 1—figure supplement 1C for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data1-v1.tif
-
Figure 1—figure supplement 1—source data 2
Raw WB for Figure 1—figure supplement 1C for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data2-v1.tif
-
Figure 1—figure supplement 1—source data 3
Raw WB for Figure 1—figure supplement 1C for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data3-v1.tif
-
Figure 1—figure supplement 1—source data 4
Raw WB for Figure 1—figure supplement 1C for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data4-v1.tif
-
Figure 1—figure supplement 1—source data 5
Raw WB for Figure 1—figure supplement 1D for PML.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data5-v1.tif
-
Figure 1—figure supplement 1—source data 6
Raw WB for Figure 1—figure supplement 1D for PML with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data6-v1.tif
-
Figure 1—figure supplement 1—source data 7
Raw WB for Figure 1—figure supplement 1D for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data7-v1.tif
-
Figure 1—figure supplement 1—source data 8
Raw WB for Figure 1—figure supplement 1D for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig1-figsupp1-data8-v1.tif
Figure 2 with 1 supplement
HIRA recruitment to PML NBs is dependent on SUMO proteins.
(A) Fluorescence microscopy visualization of Proximity Ligation Assays (PLA) signals (red) obtained after incubation of anti-PML +anti SUMO, anti-HIRA +anti PML or anti-HIRA +anti SUMO antibodies on …
-
Figure 2—source data 1
Raw WB for Figure 2C for SUMO1.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data1-v1.tif
-
Figure 2—source data 2
Raw WB for Figure 2C for SUMO1 with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data2-v1.tif
-
Figure 2—source data 3
Raw WB for Figure 2C for Actin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data3-v1.tif
-
Figure 2—source data 4
Raw WB for Figure 2C for Actin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data4-v1.tif
-
Figure 2—source data 5
Raw WB for Figure 2C for SUMO2/3.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data5-v1.tif
-
Figure 2—source data 6
Raw WB for Figure 2C for SUMO1 with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data6-v1.tif
-
Figure 2—source data 7
Raw WB for Figure 2C for Actin (bottom panel).
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data7-v1.tif
-
Figure 2—source data 8
Raw WB for Figure 2C for Actin (bottom panel) with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig2-data8-v1.tif
Figure 2—figure supplement 1
HIRA accumulation in PML NBs does not depend on overexpression of SUMO proteins nor on its SUMOylation.
(A) Fluorescence microscopy visualization of HA (green) and PML (red) in normal IMR90 cells ('empty') or in IMR90 cells stably expressing HIRA-HA WT or HIRA-HA mutated on K809G. Cells were treated …
Figure 3 with 2 supplements
HIRA recruitment to PML NBs relies on SIM-SUMO interactions.
(A) Experimental design to assess SUMO-specific Affimers impact on HIRA relocalization to PML NBs. BJ cells were transduced with a Dox-inducible lentiviral vector encoding for a 6xHis-tagged …
-
Figure 3—source data 1
Raw WB for Figure 3D for PML and Actin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-data1-v1.tif
-
Figure 3—source data 2
Raw WB for Figure 3D for PML and Actin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-data2-v1.tif
-
Figure 3—source data 3
Raw WB for Figure 3D for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-data3-v1.tif
-
Figure 3—source data 4
Raw WB for Figure 3D for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-data4-v1.tif
-
Figure 3—source data 5
Raw WB for Figure 3D for Actin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-data5-v1.tif
-
Figure 3—source data 6
Raw WB for Figure 3D for Actin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-data6-v1.tif
Figure 3—figure supplement 1
HIRA accumulation in PML NBs depends on PML and on a putative SIM motif on HIRA.
(A) Western blot visualization of HIRA and PML from total cellular extracts of S1S2D5-His Affimer-transduced BJ cells treated as in Figure 3C. Tubulin is a loading control. Quantification of HIRA …
-
Figure 3—figure supplement 1—source data 1
Raw WB for Figure 3—figure supplement 1A for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data1-v1.tif
-
Figure 3—figure supplement 1—source data 2
Raw WB for Figure 3—figure supplement 1A for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data2-v1.tif
-
Figure 3—figure supplement 1—source data 3
Raw WB for Figure 3—figure supplement 1A for PML.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data3-v1.tif
-
Figure 3—figure supplement 1—source data 4
Raw WB for Figure 3—figure supplement 1A for PML with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data4-v1.tif
-
Figure 3—figure supplement 1—source data 5
Raw WB for Figure 3—figure supplement 1A for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data5-v1.tif
-
Figure 3—figure supplement 1—source data 6
Raw WB for Figure 3—figure supplement 1A for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data6-v1.tif
-
Figure 3—figure supplement 1—source data 7
Raw WB for Figure 3—figure supplement 1E for HA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data7-v1.tif
-
Figure 3—figure supplement 1—source data 8
Raw WB for Figure 3—figure supplement 1E for HA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data8-v1.tif
-
Figure 3—figure supplement 1—source data 9
Raw WB for Figure 3—figure supplement 1E for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data9-v1.tif
-
Figure 3—figure supplement 1—source data 10
Raw WB for Figure 3—figure supplement 1E for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp1-data10-v1.tif
Figure 3—figure supplement 2
HIRA accumulation in PML NBs depends on SP100, independent of its SUMOylation on K297R.
(A) (left) Fluorescence microscopy visualization of HIRA (green) and PML (red) in BJ cells treated with the indicated siRNAs for 48 hr and with IFNβ at 1000 U/mL for the last 24 hr of siRNAs …
-
Figure 3—figure supplement 2—source data 1
Raw WB for Figure 3—figure supplement 2B (left panel) for SP100 and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data1-v1.tif
-
Figure 3—figure supplement 2—source data 2
Raw WB for Figure 3—figure supplement 2B (left panel) for SP100 and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data2-v1.tif
-
Figure 3—figure supplement 2—source data 3
Raw WB for Figure 3—figure supplement 2B (right panel) for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data3-v1.tif
-
Figure 3—figure supplement 2—source data 4
Raw WB for Figure 3—figure supplement 2B (right panel) for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data4-v1.tif
-
Figure 3—figure supplement 2—source data 5
Raw WB for Figure 3—figure supplement 2B (right panel) for H3.3 and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data5-v1.tif
-
Figure 3—figure supplement 2—source data 6
Raw WB for Figure 3—figure supplement 2B (right panel) for H3.3 and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data6-v1.tif
-
Figure 3—figure supplement 2—source data 7
Raw WB for Figure 3—figure supplement 2F (left panel) for SP100.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data7-v1.tif
-
Figure 3—figure supplement 2—source data 8
Raw WB for Figure 3—figure supplement 2F (left panel) for SP100 with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data8-v1.tif
-
Figure 3—figure supplement 2—source data 9
Raw WB for Figure 3—figure supplement 2F (left panel) for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data9-v1.tif
-
Figure 3—figure supplement 2—source data 10
Raw WB for Figure 3—figure supplement 2F (left panel) for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig3-figsupp2-data10-v1.tif
Figure 4 with 2 supplements
HIRA accumulation in PML NBs depends on DAXX and H3.3 levels.
(A) Fluorescence microscopy visualization of HIRA-HA or HIRA-Myc marked respectively with HA and Myc antibodies (green) and PML (red) in BJ HIRA-HA WT and BJ HIRA-Myc WT cells. Cell nuclei are …
Figure 4—figure supplement 1
HIRA accumulation in PML NBs upon IFN-I treatment can be modulated by the pool of DAXX in primary cells.
(A) Western blot visualization of PML and DAXX from total cellular extracts of BJ cells treated as in Figure 4C. Tubulin is a loading control. * indicates unspecific signal. Quantification of PML …
-
Figure 4—figure supplement 1—source data 1
Raw WB for Figure 4—figure supplement 1A for PML.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data1-v1.tif
-
Figure 4—figure supplement 1—source data 2
Raw WB for Figure 4—figure supplement 1A for PML with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data2-v1.tif
-
Figure 4—figure supplement 1—source data 3
Raw WB for Figure 4—figure supplement 1A for DAXX and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data3-v1.tif
-
Figure 4—figure supplement 1—source data 4
Raw WB for Figure 4—figure supplement 1A for DAXX and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data4-v1.tif
-
Figure 4—figure supplement 1—source data 5
Raw WB for Figure 4—figure supplement 1A for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data5-v1.tif
-
Figure 4—figure supplement 1—source data 6
Raw WB for Figure 4—figure supplement 1A for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data6-v1.tif
-
Figure 4—figure supplement 1—source data 7
Raw WB for Figure 4—figure supplement 1B for DAXX.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data7-v1.tif
-
Figure 4—figure supplement 1—source data 8
Raw WB for Figure 4—figure supplement 1B for DAXX with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data8-v1.tif
-
Figure 4—figure supplement 1—source data 9
Raw WB for Figure 4—figure supplement 1B for SP100.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data9-v1.tif
-
Figure 4—figure supplement 1—source data 10
Raw WB for Figure 4—figure supplement 1B for SP100 with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data10-v1.tif
-
Figure 4—figure supplement 1—source data 11
Raw WB for Figure 4—figure supplement 1B for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data11-v1.tif
-
Figure 4—figure supplement 1—source data 12
Raw WB for Figure 4—figure supplement 1B for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data12-v1.tif
-
Figure 4—figure supplement 1—source data 13
Raw WB for Figure 4—figure supplement 1E for Myc.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data13-v1.tif
-
Figure 4—figure supplement 1—source data 14
Raw WB for Figure 4—figure supplement 1E for Myc with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data14-v1.tif
-
Figure 4—figure supplement 1—source data 15
Raw WB for Figure 4—figure supplement 1E for H3.3 and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data15-v1.tif
-
Figure 4—figure supplement 1—source data 16
Raw WB for Figure 4—figure supplement 1E for H3.3 and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp1-data16-v1.tif
Figure 4—figure supplement 2
HIRA accumulation in PML NBs upon IFN-I can be modulated by the pool of H3.3 histones in primary cells.
(A) (left) Fluorescence microscopy visualization of HIRA (green) and H3.3-HA marked by HA antibody (red) in BJ eH3.3i cells treated with doxycyclin (Dox) at 100 ng/mL and with IFNβ at 1000 U/mL for …
-
Figure 4—figure supplement 2—source data 1
Raw WB for Figure 4—figure supplement 2B for HA and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp2-data1-v1.tif
-
Figure 4—figure supplement 2—source data 2
Raw WB for Figure 4—figure supplement 2B for HA and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig4-figsupp2-data2-v1.tif
Figure 5 with 1 supplement
PML NBs become juxtaposed to ISGs loci upon IFN-I treatment.
(A) Confocal fluorescence microscopy visualization of IF-FISH against PML proteins (green) and GHRL control gene locus (red) or PML, MX1 or OAS1 ISGs loci (red) in BJ cells treated with IFNβ at 1000 …
Figure 5—figure supplement 1
ISGs are upregulated upon IFN-I treatment in a PML-dependent manner and become juxtaposed to PML NBs.
(A) Histogram shows ISGs mRNA relative levels of MX1, OAS1, ISG15, and ISG54 normalized on GAPDH mRNA levels of BJ cells treated with IFNβ at 100 U/mL for 6 and 24 hr, or left untreated (NT). …
-
Figure 5—figure supplement 1—source data 1
Raw WB for Figure 5—figure supplement 1B for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig5-figsupp1-data1-v1.tif
-
Figure 5—figure supplement 1—source data 2
Raw WB for Figure 5—figure supplement 1B for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig5-figsupp1-data2-v1.tif
-
Figure 5—figure supplement 1—source data 3
Raw WB for Figure 5—figure supplement 1B for PML.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig5-figsupp1-data3-v1.tif
-
Figure 5—figure supplement 1—source data 4
Raw WB for Figure 5—figure supplement 1B for PML with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig5-figsupp1-data4-v1.tif
-
Figure 5—figure supplement 1—source data 5
Raw WB for Figure 5—figure supplement 1B for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig5-figsupp1-data5-v1.tif
-
Figure 5—figure supplement 1—source data 6
Raw WB for Figure 5—figure supplement 1B for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig5-figsupp1-data6-v1.tif
Figure 6 with 2 supplements
HIRA and PML depletions impair H3.3 enrichment at distal regions of ISGs.
(A) (top) Schematic representation of MX1, OAS1, and ISG54 gene loci. Localization of primers is marked in color: red, green, and blue for primers localized in the Transcription Start Site (TSS), …
-
Figure 6—source data 1
Raw WB for Figure 6E for PML.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-data1-v1.tif
-
Figure 6—source data 2
Raw WB for Figure 6E for PML with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-data2-v1.tif
-
Figure 6—source data 3
Raw WB for Figure 6E for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-data3-v1.tif
-
Figure 6—source data 4
Raw WB for Figure 6E for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-data4-v1.tif
-
Figure 6—source data 5
Raw WB for Figure 6E for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-data5-v1.tif
-
Figure 6—source data 6
Raw WB for Figure 6E for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-data6-v1.tif
Figure 6—figure supplement 1
H3.3 and H3K36m3 increase on ISGs upon IFN-I.
(A) (left) Histogram shows relative H3F3A mRNA levels (normalized on GAPDH mRNA levels) of BJ cells treated or not with IFNβ at 100 U/mL for 24 hr. Rationalization was performed on the untreated …
-
Figure 6—figure supplement 1—source data 1
Raw WB for Figure 6—figure supplement 1A for H3.3 and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-figsupp1-data1-v1.tif
-
Figure 6—figure supplement 1—source data 2
Raw WB for Figure 6—figure supplement 1A for H3.3 and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-figsupp1-data2-v1.tif
Figure 6—figure supplement 2
Overexpression of HIRA increases H3.3 deposition at ISGs TES region upon IFN-I.
(A) Histogram shows H3.3 enrichment obtained through ChIP experiments on BJ cells treated or not with IFNβ at 1000 U/mL for 24 hr and stably expressing or not HIRA-HA WT. Rationalization was …
-
Figure 6—figure supplement 2—source data 1
Raw WB for Figure 6—figure supplement 2B for HIRA and tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-figsupp2-data1-v1.tif
-
Figure 6—figure supplement 2—source data 2
Raw WB for Figure 6—figure supplement 2B for HIRA and tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-figsupp2-data2-v1.tif
-
Figure 6—figure supplement 2—source data 3
Raw WB for Figure 6—figure supplement 2B for HIRA (high exposure).
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-figsupp2-data3-v1.tif
-
Figure 6—figure supplement 2—source data 4
Raw WB for Figure 6—figure supplement 2B for HIRA (high exposure) with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig6-figsupp2-data4-v1.tif
Figure 7 with 1 supplement
HIRA mediates H3.3 deposition during transcription of ISGs.
(A) Histogram shows H3.3 enrichment obtained through ChIP experiments on BJ cells treated with the indicated siRNAs for 48 hr and with IFNβ at 1000 U/mL for the last 24 hr of siRNAs treatment. …
-
Figure 7—source data 1
Raw WB for Figure 7B for HIRA.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig7-data1-v1.tif
-
Figure 7—source data 2
Raw WB for Figure 7B for HIRA with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig7-data2-v1.tif
-
Figure 7—source data 3
Raw WB for Figure 7B for SP100.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig7-data3-v1.tif
-
Figure 7—source data 4
Raw WB for Figure 7B for SP100 with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig7-data4-v1.tif
-
Figure 7—source data 5
Raw WB for Figure 7B for tubulin.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig7-data5-v1.tif
-
Figure 7—source data 6
Raw WB for Figure 7B for tubulin with labels.
- https://cdn.elifesciences.org/articles/80156/elife-80156-fig7-data6-v1.tif
Figure 7—figure supplement 1
SP100 knock-down increases ISGs transcription upon IFN-I treatment.
(A) ChIP-Seq profile of HIRA enrichment over 48 core ISGs ranging from –3.0 kb to 3.0 kb downstream and upstream of the gene bodies in IMR90 cells stably transduced to express the indicated shRNAs …
Author response image 1
Members of the HIRA complex accumulate in PML NBs following IFN-I treatment.
Fluorescence microscopy visualization of ASF1 (green), UBN1 (green) or CABIN1 (green) together with PML (red) in BJ cells treated with IFNβ at 1000U/mL for 24h (+IFNβ) or left untreated (NT). Cell …
Author response image 2
EYFP-SP100 localizes in PML NBs in absence of endogenous SP100.
Fluorescence microscopy visualization of HIRA (green) together with PML (red) and EYFP-SP100 (pseudocolored in cyan) in BJ cells treated with an siRNA against SP100 for 48h and transduced with a …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (H. sapiens) | BJ | ATCC | CRL-2522 | Human primary foreskin fibroblasts |
| Cell line (H. sapiens) | BJ S1S2D5 | This paper | Human primary foreskin fibroblasts transduced with TetOne-Tat-S1S2D5-Flag-His | |
| Cell line (H. sapiens) | BJ eH3.3i | This paper | Human primary foreskin fibroblasts transduced with H3.3-SNAP-HA3 | |
| Cell line (H. sapiens) | BJ HIRA-HA WT/mSIM(1-5) | This paper | Human primary foreskin fibroblasts transduced with HIRA-HA WT/mSIM(1-5) | |
| Cell line (H. sapiens) | BJ EYFP-SP100 isoform A WT or K297R (siRNA resistant) | This paper | Human primary foreskin fibroblasts transduced with EYFP-SP100 isoform A WT or K297R (siRNA resistant) | |
| Cell line (H. sapiens) | BJ Myc-DAXX | This paper | Human primary foreskin fibroblasts transduced with Myc-DAXX | |
| Cell line (H. sapiens) | IMR90 | ATCC | CCL-186 | Fetal lung primary fibroblasts |
| Cell line (H. sapiens) | IMR90 eH3.3i | This paper | Fetal lung primary fibroblasts transduced with H3.3-SNAP-HA3 | |
| Cell line (H. sapiens) | IMR90 HIRA-HA WT/K809G | This paper | Fetal lung primary fibroblasts transduced with HIRA-HA WT/K809G | |
| Cell line (H. sapiens) | HEK 293T | Intercell, AG Corpet et al., 2014 | Immortalized embryonic kidney cells | |
| Cell line (M. musculus) | MEF PML-/- | Gift from Dr. Lallemand-Breitenbach Sahin et al., 2014 | Mouse embryonic fibroblasts knocked-out for PML | |
| Cell line (M. musculus) | MEF PML-/- Myc-PML1 WT/3 K | This paper | Mouse embryonic fibroblasts knocked-out for PML and transduced with TetOne-Myc-PML1 WT/3 K | |
| Antibody | Anti-Actin (Rabbit polyclonal) | Sigma-Aldrich | A2066 | WB 1:1000 |
| Antibody | Anti-panH3 (Rabbit polyclonal) | Abcam | ab1791 | WB 1:5000 ChIP: 2 μg |
| Antibody | Anti-H3.3 (Rabbit monoclonal) | Diagenode | C15210011 | WB 1:1000 ChIP: 2 μg |
| Antibody | Anti-HA (Rabbit polyclonal) | Abcam | ab9110 | IF 1:1000 WB 1:1000 |
| Antibody | Anti-HIRA #01 (Mouse monoclonal, clone WC119) | Active Motif | 3558 | IF 1:500 WB 1:1000 |
| Antibody | Anti-HIRA #02 (Mouse monoclonal, clone WC119) | Millipore | 04–1488 | IF 1:500 WB 1:1000 |
| Antibody | Anti-HIRA #03 (Rabbit polyclonal) | Abcam | ab20655 | For mouse IF 1:100 |
| Antibody | Anti-6xHis #01 (Mouse monoclonal, clone 3D5) | Clontech | 631212 | IF 1:1000 |
| Antibody | Anti-6xHis #02 (Rabbit polyclonal) | Bethyl | A190-114A | IF 1:10000 |
| Antibody | Anti-c-Myc #01 (Mouse monoclonal, clone 9E10) | Santa Cruz | sc-40 | WB 1:1000 |
| Antibody | Anti-c-Myc #02 (Rabbit polyclonal) | Abcam | ab9106 | IF 1:1000 |
| Antibody | Anti-PML #01 (Mouse monoclonal, clone PG-M3) | Santa Cruz | sc-966 | IF 1:200 |
| Antibody | Anti-PML #02 (Rabbit polyclonal) | Santa Cruz | sc-5621 | IF 1:200 WB 1:1000 |
| Antibody | Anti-PML #03 (Rabbit polyclonal) | Sigma | PLA0172 | IF 1:5000 WB 1:1000 |
| Antibody | Anti-PML #04 (Mouse monoclonal, clone 36.1–104) | Millipore | MAB3738 | For mouse IF 1:100 |
| Antibody | Anti-SP100 (Rabbit polyclonal antiserum) | Kind gift from Dr. Thomas M. Sternsdorf | GH3 | IF: 1:100 WB: 1:1000 |
| Antibody | Anti-SUMO-1 (Rabbit monoclonal, clone Y299) | Abcam | ab32058 | WB 1:1000 |
| Antibody | Anti-SUMO-2/3 (Rabbit polyclonal) | Abcam | ab3742 | WB 1:1000 |
| Antibody | Anti-αTubulin (Mouse monoclonal, clone DM1A) | Sigma | T6199 | WB 1:10000 |
| Recombinant DNA reagent | pLentiN (plasmid) | Addgene | #37444 | Lentiviral plasmid |
| Recombinant DNA reagent | pLVX-TetOne (plasmid) | Clontech | 631849 | Doxycyclin inducible lentiviral plasmid |
| Recombinant DNA reagent | pcDNA5-Tat-S1S2D5-Flag-His (plasmid) | Gift from Dr. Hughes Hughes et al., 2017 | ||
| Recombinant DNA reagent | pLVX-TetOne-Tat-S1S2D5-Flag-His (plasmid) | This paper | PCR on pcDNA5-Tat-S1S2D5-Flag-His and cloning in lentiviral pLVX-TetOne plasmid | |
| Recombinant DNA reagent | pLentiN-HIRA-HA WT (plasmid) | This paper | RT-PCR on HeLa cells and cloning in lentiviral pLentiN plasmid | |
| Recombinant DNA reagent | pLentiN-HIRA-HA WT (plasmid) | This paper | RT-PCR on HeLa cells and cloning in lentiviral pLentiN plasmid | |
| Recombinant DNA reagent | pLentiN-HIRA-HA mSIM(1-5) (plasmid) | This paper | Site-directed mutagenesis on pLentiN-HIRA-HA WT plasmid. Mutations: mSIM1=V124 G/S125G; mSIM2=V225 G/L226G; mSIM3=L320 G/L321G; mSIM4=V805 G/V806G; mSIM5=V978 G/V979G | |
| Recombinant DNA reagent | pLentiN-HIRA-HA K809G (plasmid) | This paper | Site-directed mutagenesis K809G on pLentiN HIRA-HA WT plasmid | |
| Recombinant DNA reagent | pLNGY-PML1 WT (plasmid) | Gift from Dr. Everett Cuchet et al., 2011 | ||
| Recombinant DNA reagent | pLNGY-PML1.KKK (plasmid) | Gift from Dr. Everett Cuchet et al., 2011 | 3 main SUMOylation sites mutated PML1 | |
| Recombinant DNA reagent | pLVX-PML1 WT (plasmid) | This paper | PCR on pLNGY-PML1 WT and cloning in lentiviral pLVX-TetOne plasmid | |
| Recombinant DNA reagent | pLVX-PML1.KKK (plasmid) | This paper | PCR on pLNGY-PML1.KKK and cloning in lentiviral pLVX-TetOne plasmid | |
| Recombinant DNA reagent | pLNGY-EYFP-S100 isoform A WT (plasmid) | Gift from Dr. Everett Cuchet-Lourenço et al., 2011 | ||
| Recombinant DNA reagent | pLNGY-EYFP-S100 isoform A K297R (plasmid) | Gift from Dr. Everett Cuchet-Lourenço et al., 2011 | Main SUMOylation site K297 mutated on SP100 | |
| Recombinant DNA reagent | pLVX-EYFP-SP100 isoform A WT (plasmid) | This paper | PCR on pLNGY-EYFP-S100 isoform A WT and cloning in lentiviral pLVX-TetOne plasmid | |
| Recombinant DNA reagent | pLVX-EYFP-SP100 isoform A K297R (plasmid) | This paper | PCR on pLNGY-EYFP-S100 isoform A K297R and cloning in lentiviral pLVX-TetOne plasmid | |
| Recombinant DNA reagent | pBABE-H3.3-SNAP-HA3 (plasmid) | Gift from Dr. Jansen | ||
| Recombinant DNA reagent | pLVX-TetOne-H3.3-SNAP-HA3 (plasmid) | This paper | PCR on pBABE-H3.3-SNAP-HA3 and cloning in lentiviral pLVX-TetOne plasmid | |
| Recombinant DNA reagent | RP11-438J1 (BAC) | Gift from Dr. Schluth-Bolard | BAC used for FISH probe against GHRL | |
| Recombinant DNA reagent | RP11-185E17 (BAC) | RP11-185E17 | https://bacpacresources.org/ | BAC used for FISH probe against PML |
| Recombinant DNA reagent | RP11-120C17 (BAC) | RP11-120C17 | https://bacpacresources.org/ | BAC used for FISH probe against MX1 |
| Recombinant DNA reagent | RP11-134B23 (BAC) | RP11-134B23 | https://bacpacresources.org/ | BAC used for FISH probe against OAS1 |
| Sequence-based reagent | siHIRA | Ray-Gallet et al., 2011 | siRNA | sequence 5’GGAUAACACUGUCGUCAUCdTdT |
| Sequence-based reagent | siLuc | Adam et al., 2013 | siRNA | sequence 5’CGUACGCGGAAUACUUCGAdTdT |
| Sequence-based reagent | siPML | Everett et al., 2006 | siRNA | sequence 5’AGATGCAGCTGTATCCAAGdTdT |
| Sequence-based reagent | siSP100 | Everett et al., 2008 | siRNA | sequence 5'GUGAGCCUGUGAUCAAUAAdTdT |
| Sequence-based reagent | siSUMO-1 | Lallemand-Breitenbach et al., 2008 | siRNA | sequence 5’GGACAGGAUAGCAGUGAGAdTdT |
| Sequence-based reagent | siSUMO-2/3 | Yao et al., 2011 | siRNA | sequence 5’GUCAAUGAGGCAGAUCAGAdTdT |
| Sequence-based reagent | H3.3-ChIP-cluster3-Chr1-F (Enh1) | Pchelintsev et al., 2013 | CHIP qPCR primer | 5’GCCACTTGCCAATGTTTCTC |
| Sequence-based reagent | H3.3-ChIP-cluster3-Chr1-R (Enh1) | Pchelintsev et al., 2013 | CHIP qPCR primer | 5’TGGCCCCATGTAGTGAAAAG |
| Sequence-based reagent | ChIP-GCH1-TES-F | this paper | CHIP qPCR primer | 5'TCTGGTCCCGGTTTCCTTTG |
| Sequence-based reagent | ChIP-GCH1-TES-R | this paper | CHIP qPCR primer | 5'TTTAATTTGGCCCACGCTGC |
| Sequence-based reagent | ChIP-ISG54-TSS-F | This paper | CHIP qPCR primer | 5’GCAGGAAGTGGGGTTTGCTA |
| Sequence-based reagent | ChIP-ISG54-TSS-R | This paper | CHIP qPCR primer | 5’GAGGGATGTTTCATCGGCCT |
| Sequence-based reagent | ChIP-ISG54-mid-F | This paper | CHIP qPCR primer | 5’ATGTAACTAACCCCAGGTGCG |
| Sequence-based reagent | ChIP-ISG54-mid-R | This paper | CHIP qPCR primer | 5’TGCTTCCCACTCCCATTTTGA |
| Sequence-based reagent | ChIP-ISG54-TES-F | This paper | CHIP qPCR primer | 5’AGTCTGGAAGCCTCATCCCT |
| Sequence-based reagent | ChIP-ISG54-TES-R | This paper | CHIP qPCR primer | 5’CCTAGTGGGCACCACATCTC |
| Sequence-based reagent | ChIP-MX1-TSS-F | Cheon et al., 2013 | CHIP qPCR primer | 5’GCCCTCTCTTCTTCCAGGCAAC |
| Sequence-based reagent | ChIP-MX1-TSS-R | Cheon et al., 2013 | CHIP qPCR primer | 5’GGGACAGGCATCAACAAAGC |
| Sequence-based reagent | ChIP-MX1-mid-F | This paper | CHIP qPCR primer | 5’TCTACGCTCTGGGGACATCA |
| Sequence-based reagent | ChIP-MX1-mid-R | This paper | CHIP qPCR primer | 5’GAACCAAACCCACCACCAGA |
| Sequence-based reagent | ChIP-MX1-TES-F | This paper | CHIP qPCR primer | 5’CTCCCGTGAACTGTTCTTTCCT |
| Sequence-based reagent | ChIP-MX1-TES-R | This paper | CHIP qPCR primer | 5’GCTGTAGGTGTCCTTGTCCT |
| Sequence-based reagent | ChIP-MX2-TES-F | This paper | CHIP qPCR primer | 5’ACCACTCCAGCAAACCCTTC |
| Sequence-based reagent | ChIP-MX2-TES-R | This paper | CHIP qPCR primer | 5’AATGGGATCTGGTTGGCGAG |
| Sequence-based reagent | ChIP-OAS1-TSS-F | This paper | CHIP qPCR primer | 5’ACCACAGACAACTGTGAAAGG |
| Sequence-based reagent | ChIP-OAS1-TSS-R | This paper | CHIP qPCR primer | 5’GTCCTTTAGCCAGCAACAAGC |
| Sequence-based reagent | ChIP-OAS1-mid-F | This paper | CHIP qPCR primer | 5’GCAGCACGTTGGGAGATAGA |
| Sequence-based reagent | ChIP-OAS1-mid-R | This paper | CHIP qPCR primer | 5’TTCTCCTGATGTGGCAAGGG |
| Sequence-based reagent | ChIP-OAS1-TES-F | This paper | CHIP qPCR primer | 5’CTTGTCACATCCCCACCTCTC |
| Sequence-based reagent | ChIP-OAS1-TES-R | This paper | CHIP qPCR primer | 5’GTCCTTTGCCCCTGTTTAGC |
| Sequence-based reagent | GAPDH-F | This paper | RT qPCR primer | 5’GAGTCAACGGATTTGGTCG |
| Sequence-based reagent | GAPDH-R | This paper | RT qPCR primer | 5’TTGATTTTGGAGGGATCTCG |
| Sequence-based reagent | H3F3A-F | This paper | RT qPCR primer | 5’CCAGGAAGCAACTGGCTACA |
| Sequence-based reagent | H3F3A-R | This paper | RT qPCR primer | 5’ACCAGGCCTGTAACGATGAG |
| Sequence-based reagent | HIRA-F | This paper | RT qPCR primer | 5’AGGACTCTCGTCTCATGCCT |
| Sequence-based reagent | HIRA-R | This paper | RT qPCR primer | 5’CAGCTTCAGTGCAAGTGCT |
| Sequence-based reagent | ISG15-F | This paper | RT qPCR primer | 5’GGTGGACAAATGCGACGAAC |
| Sequence-based reagent | ISG15-R | This paper | RT qPCR primer | 5’TCGAAGGTCAGCCAGAACAG |
| Sequence-based reagent | ISG54-F | This paper | RT qPCR primer | 5’TGAAAGAGCGAAGGTGTGCT |
| Sequence-based reagent | ISG54-R | This paper | RT qPCR primer | 5’CTCAGAGGGTCAATGGCGTT |
| Sequence-based reagent | MX1-F | This paper | RT qPCR primer | 5’GGAGGCACTGTCAGGAGTTG |
| Sequence-based reagent | MX1-R | This paper | RT qPCR primer | 5’TCCTGGTAACTGACCTTGCC |
| Sequence-based reagent | OAS1-F | This paper | RT qPCR primer | 5’AGCTGGAAGCCTGTCAAAGA |
| Sequence-based reagent | OAS1-R | This paper | RT qPCR primer | 5’AGGTTTATAGCCGCCAGTCA |
| Sequence-based reagent | PML-F | This paper | RT qPCR primer | 5’CAGGGACCCTATTGACGTTG |
| Sequence-based reagent | PML-R | This paper | RT qPCR primer | 5’ATGGAGAAGGCGTACACTGG |
| Sequence-based reagent | SP100-F | This paper | RT qPCR primer | 5'CACTGACGTTGATGAGCCCT |
| Sequence-based reagent | SP100-R | This paper | RT qPCR primer | 5'AATCTGGGGTCGTGAGCAAG |
| Peptide, recombinant protein | IFNβ | Peprotech | 300-02BC | Human Final concentration: 100 or 1000 U/mL |
| Peptide, recombinant protein | IFNα | PBL assay science | 12105–1 | Mouse Final concentration: 1000 U/mL |
| Peptide, recombinant protein | IL-6 | Peprotech | 200–06 | Human Final concentration: 200 ng/mL |
| Peptide, recombinant protein | IL-8 | Peprotech | 200–08 | Human Final concentration: 200 ng/mL |
| Peptide, recombinant protein | TNF-α | Invivogen | rcyc-htnfa | Human Final concentration: 100 ng/mL |
| Chemical compound, drug | Blasticidin | Invivogen | ant-bl | Final concentration: 5 μg/mL |
| Chemical compound, drug | Doxycycline | Sigma Aldrich | D9891 | Final concentration: 100 ng/mL |
| Chemical compound, drug | EdU | Invitrogen | C10338 | Final concentration: 10 μM |
| Chemical compound, drug | PolyI:C | Invivogen | trlr-pic | Final concentration: 10 μg/mL |
| Chemical compound, drug | Puromycin | Invivogen | ant-pr | Final concentration: 1 μg/mL |
| Chemical compound, drug | Ruxolitinib | Invivogen | trlr-rux | Final concentration: 2 μM |
| Commercial assay or kit | Duolink In Situ Red Starter Kit Mouse/Rabbit | Sigma Aldrich | DUO092101 | For PLA |
| Software, algorithm | Homer | http://homer.ucsd.edu/homer/download.html | ChIP seq analysis | |
| Software, algorithm | MACS2 | Zhang et al., 2008 | ChIP seq analysis | |
| Software, algorithm | Bowtie2 | Langmead and Salzberg, 2012 | ChIP seq analysis | |
| Software, algorithm | DeepTools suite | https://deeptools.readthedocs.io/en/develop/ | ChIP seq visualization | |
| Software, algorithm | enrichR | Kuleshov et al., 2016 | GO analysis | |
| Software, algorithm | IGV | https://software.broadinstitute.org/software/igv/ | Genome browser | |
| Software, algorithm | Fiji | https://imagej.net/imagej-wiki-static/Fiji/Downloads | Image analysis | |
| Software, algorithm | Photoshop | https://www.adobe.com/products/photoshop.html | Image analysis | |
| Software, algorithm | GraphPad Prism 6 | https://www.graphpad.com/scientific-software/prism/ | Statistical analysis and graphics | |
| Software, algorithm | Biorender | biorender.com | figure creation |
