Postsynaptic plasticity of cholinergic synapses underlies the induction and expression of appetitive and familiarity memories in Drosophila
- Institute of Neurophysiology, Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin, and Berlin Institute of Health, Germany
- Einstein Center for Neurosciences Berlin, Germany
- NeuroCure, Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin, and Berlin Institute of Health, Germany
- Institut für Biologie, Freie Universität Berlin, Germany
- NWFZ, Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin, and Berlin Institute of Health, Germany
- Universitätsmedizin Greifswald, Department of Anesthesia, Critical Care, Emergency and Pain Medicine, Germany
Figures
Figure 1 with 1 supplement
Kenyon cell (KC) neurotransmitter release is required for the acquisition of appetitive memories.
(a–c) Flies expressing temperature-sensitive Shibire (Shi) within KCs or mushroom bodies output neurons (MBONs) are trained at restrictive temperature (32°C), and subsequently placed at permissive …
Figure 1—figure supplement 1
Permissive temperature controls accompanying Figure 1.
(a) Permissive temperature control for experiments shown in Figure 1a. A 30-min aversive memory performance when training at 23°C (driver line R13F02-Gal4). Bar graphs: mean ± SEM; n=7–9; …
Figure 2 with 2 supplements
Specific nicotinic acetylcholine receptor (nAChR) α subunits are needed for specific memories in M4/6 neurons.
Training and testing protocols indicated schematically. A and B indicate different odors. (a) Immediate appetitive memories are impaired following RNAi knockdown of the α5 nAChR subunit in M4/6 …
Figure 2—figure supplement 1
Genetic controls and alternate data display of data presented in Figure 2.
(a) Immediate appetitive memory is not impaired in genetic control groups. Bar graphs: mean ± SEM; n=7–11, for controls: n=16, one-way ANOVA followed by Tukey’s test (p>0.05). (b) 3-hr appetitive …
Figure 2—figure supplement 2
Genetic controls and alternate data display of data presented in Figure 2.
(a) RNAi knockdown of the α5 subunit in M4/6 mushroom bodies output neurons (MBONs; driver line VT1211-Gal4) is suppressed using Gal80ts. Immediate memories are not impaired. Bar graphs: mean ± SEM; …
Figure 3 with 1 supplement
Induction of postsynaptic plasticity bypassing the presynapses.
(a) Left: explant brain experimental configuration. Right: connectivity scheme of mushroom bodies (MB) output synapses. Cholinergic Kenyon cells (KCs) and dopaminergic neurons are presynaptic to M6 …
Figure 3—figure supplement 1
Control experiments and non-normalized data display for Figure 3.
(a) Explant brain configuration and connectivity scheme of mushroom bodies (MB) output synapses. Also shown in Figure 3. (b) Training scheme. (c) Control experiments for Figure 3f–h. Paired training …
Figure 4 with 1 supplement
Nicotinic acetylcholine receptor (nAChR) α subunit localization throughout the mushroom bodies (MB): MB output neuron (MBON)-specific RNAi alters subunit distribution.
(a) Representative images of the GFP-tagged nAChR subunits α2 and α5 as well as discs large (Dlg). Individual images displayed here are taken from different animals. For other subunits, see Figure …
Figure 4—figure supplement 1
Detailed distribution of α subunits in the mushroom bodies (MB) accompanying Figure 4.
Example image planes of GFP expression at the level of the MB compartments for all α nicotinic acetylcholine receptor subunits (except for α3) and discs large. Pictures are taken from different …
Figure 5 with 1 supplement
α2 is required for learning-associated plasticity in vivo.
(a) Scheme indicating the dendritic imaging area (c–g) at the level of the β’2 compartment. (b) Odor exposure protocol. Five octanol (OCT) stimuli were alternatingly administered with five …
Figure 5—figure supplement 1
Additional data and display of non-normalized data accompanying Figure 5.
(a) Scheme indicating the dendritic imaging area at the level of the β’2 compartment. (b) Averaged traces of GCaMP6f responses to octanol (OCT) from control (black), α2 subunit RNAi (blue), and α5 …
Figure 6 with 1 supplement
α2 nicotinic acetylcholine receptor (nAChR) subunits dynamically rearrange.
(a) In vivo imaging configuration and scheme of site of dopamine (DA) injection during fluorescence recovery after photobleaching (FRAP) experiments at the level of the Kenyon cell to mushroom body …
Figure 6—figure supplement 1
Receptor subunit recovery, accompanying Figure 6.
(a) In vivo imaging configuration (left) and scheme of site of dopamine (DA) injection during fluorescence recovery after photobleaching (FRAP) experiments at the level of the Kenyon cell to …
Figure 7 with 1 supplement
Non-associative plasticity alters postsynaptic α2 subunit receptor dynamics.
(a) Training scheme indicating odor application, bleaching, and imaging time points. MCH was given 10 times for 1 s with a pause of 6 s in-between. Images were taken after training in absence of …
Figure 7—figure supplement 1
Discs large GFP (DlgGFP) fluorescence recovery after photobleaching (FRAP), accompanying Figure 7.
(a) FRAP of DlgGFP in α’3 mushroom body (MBs) output neurons after odor presentation. DlgGFP did not show significant recovery following odor training compared to the controls. Recovery rate is …
Figure 8 with 1 supplement
α2 and α5 nicotinic acetylcholine receptor (nAChR) subunits are required for non-associative familiarity learning at the level of α’3 mushroom body output neurons (MBONs).
(a) Scheme of behavioral responses to novel and familiar odors (right). (Left): Knockdown of α nAChR subunits at the level of α’3 MBONs alters odor familiarity learning and the probability to stop …
Figure 8—figure supplement 1
Additional ethograms, accompanying Figure 8.
(a, b) Ethograms of the behavioral responses of flies shown in Figure 8 with additional behavioral categories of pausing and wandering (when not grooming). Ethograms show pausing (red) (a), which is …
Figure 9
Model of postsynaptic plasticity sequence across compartments.
Top panels (circuit and behavior level): Mushroom body (MB) compartments investigated. Odors elicit high responses in M4 neurons inducing α2 receptor dynamics. High activity in M4 tilts the balance …
Figure 10
Mushroom body (MB) output connectomics (a) Example MB output neuron (MBON; here: M6) with pre- and postsynapses labeled.
(b) Reconstructed example synapses from electron microscopic (EM) volume (neuprint.org): two different Kenyon cells (KCs) connect to the same MBON on the postsynaptic side. (c) EM image (neuprint.org…
Author response image 1
EGFP insertion sites (green arrows).
Author response image 2
No recovery is observed after odor stimulation after bleaching of the full dendritic arbors.
Author response image 3
preliminary experiments demonstrating recovery of signal after three rounds of photo bleaching to a novel odor arguing against significant photo-toxic effects.
Author response image 4
Median and range for data shown in Figure 5d.
Author response image 5
α2 recovery at 10, 20 and 30 min.
Tables
Table 1
Used EGFP positions and gRNA sequences of this study.
| Subunit | EGFP position between AA | gRNA sequence |
|---|---|---|
| nAChRalpha1/CG5610 | 438D and 439L | ACAGATCGTCGTCGGCGCCC[GGG] |
| nAChRalpha2/CG6844 | 456G and 457L | CAGATTCAGCGGCTTGGTGG[GGG] |
| nAChRalpha4/CG12414 | 426M and 427D | AATAGCCGCCGTCCCCGATA[TGG] |
| AChRalpha5/CG32975 | 717G and 718S | CAGCACCCGAATGCCGGATG[CGG] |
| nAChRalpha6/CG4128 | 403T and 404A | TTACGCCGACGAGCCAATGG[CGG] |
| nAChRalpha7/CG32538 | 464G and 465S | GCAAGGGGATGACGGCAGCG[TGG] |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/80445/elife-80445-mdarchecklist1-v2.docx
-
Supplementary file 1
Supplementary statistics.
- https://cdn.elifesciences.org/articles/80445/elife-80445-supp1-v2.xlsx
-
Source data 1
Source data.
- https://cdn.elifesciences.org/articles/80445/elife-80445-data1-v2.zip
