T follicular helper 17 (Tfh17) cells are superior for immunological memory maintenance
- Immunology and Infectious Disease Division, John Curtin School of Medical Research, The Australian National University, Australia
- China-Australia Centre for Personalised Immunology, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, China
- Department of Occupational and Environmental Health and the Ministry of Education Key Lab of Hazard Assessment and Control in Special Operational Environment, School of Public Health, Fourth Military Medical University, China
- Laboratory of Immunology for Environment and Health, Shandong Analysis and Test Center, Qilu University of Technology, Shandong Academy of Sciences, China
- Department of Otolaryngology-Head and Neck Surgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, China
- Frazer Institute, Faculty of Medicine, University of Queensland, Australia
- Department of Rheumatology, Shanghai Institute of Rheumatology, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, China
- Department of Laboratory Medicine, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, China
- Shanghai Children's Medical Centre, Shanghai Jiao Tong University, China
- Obstetrics and Gynecology Hospital of Fudan University (Shanghai Red House Obstetrics and Gynecology Hospital), China
- Department of Microbiology and Immunology, Peter Doherty Institute for Infection and Immunity, University of Melbourne, Australia
- Ian Frazer Centre for Children’s Immunotherapy Research, Children’s Health Research Centre, Faculty of Medicine, University of Queensland, Australia
Figures
Figure 1 with 1 supplement
The in vitro differentiation of induced Tfh1, Tfh2 and Tfh17-like (iTfh1, iTfh2, iTfh17) cells.
(A) Splenocytes from WT mice were analyzed and representative FACS plot for Tfh1, Tfh17, and Tfh2 cells was shown. (B–H) OT-II cells were co-cultured with WT splenocytes as antigen-presenting cells …
-
Figure 1—source data 1
Source data file of statistics in Figure 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
iTfh1/2/17 cells show lower BCL6 expression than GC-Tfh cells.
OT-II cells were transferred into congenic WT mice followed by OVA in alum immunization. On day7, the BCL6 expressions for splenic OT-II Non-Tfh (CD44+CXCR5-PD-1-) and GC-Tfh cells (CD44+CXCR5highPD-…
-
Figure 1—figure supplement 1—source data 1
Source data file of statistics in Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig1-figsupp1-data1-v2.xlsx
Figure 2
iTfh17 cells are superior in memory maintenance.
(A–H) 5×104 FACS-purified OT-II iTfh1, iTfh17, or iTfh2 cells were separately transferred to CD28KO recipients. The early immunization group was immunized by OVA or NP-OVA in alum one day after the …
-
Figure 2—source data 1
Source data file of statistics in Figure 2.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig2-data1-v2.xlsx
Figure 3
Human cTfhCM and cTfhEM subsets phenotypically and functionally resemble TCM and TEM subsets respectively.
(A–E) Naive, TCM, TEM, cTfhCM , and cTfhEM cells were FACS-purified from PBMC of two healthy donors and bulk RNA-seq was performed for differentially expressed genes analysis and gene set enrichment …
-
Figure 3—source data 1
Source data file of statistics in Figure 3.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig3-data1-v2.xlsx
Figure 4
Human cTfhCM cells are enriched with the cTfh17 subset whereas cTfhEM cells are enriched with the cTfh1 subset.
(A–C) Human PBMC samples from 33 healthy blood donors were analyzed. Representative FACS plots and statistics showing the percentages of cTfh1, cTfh2, and cTfh17 cells in cTfhCM (A) or cTfhEM (B) …
-
Figure 4—source data 1
Source data file of statistics in Figure 4.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig4-data1-v2.xlsx
Figure 5 with 2 supplements
HBV antigen-specific cTfh17 cells are preferentially maintained in memory phase.
Blood samples from HBV vaccinated healthy individuals (N=38) were collected on indicated time points before/after HBV vaccination, and serum was diluted 10 times to analyse the anti-HBVSA antibody …
-
Figure 5—source data 1
Source data file of statistics in Figure 5.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
AIM assays to identify antigen-specific cTfh cells.
(A–C) FACS-purified cTfh1/2/17 cells from five individuals were stimulated by αCD3/CD28 for 18 hr and were analysed by FACS. Statistics (A) showing the cellular sizes before/after αCD3/CD28 …
-
Figure 5—figure supplement 1—source data 1
Source data file of statistics in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig5-figsupp1-data1-v2.xlsx
Figure 5—figure supplement 2
The cTfh responses in HBV vaccinated individuals.
(A) Blood samples were obtained from 38 individuals who received HBV vaccines on day –7, day 7, and day 28 before/after HBV vaccination. ELISA was performed to determine the titer of anti-HBVSA IgG …
-
Figure 5—figure supplement 2—source data 1
Source data file of statistics in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig5-figsupp2-data1-v2.xlsx
Figure 6 with 1 supplement
Influenza virus-specific cTfh cells show cTfh1 signatures in effector phase but cTfh17 signatures in memory phase.
The single-cell RNA-seq dataset (GSE152522, the experiment design A) was analyzed to identify CXCR5-expressing cTfh clusters (B), which contain 12 major clones with a total of 249 cells. Comparison …
-
Figure 6—source data 1
Source data file of statistics in Figure 6.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
scRNA-seq analysis for influenza-specific cTfh cells.
(A) Top 100 signature genes for cTfh1 and cTfh17 were generated by Limma package based on bulk RNA-seq dataset GSE123812. The heatmap showing the expressions of cTfh1 and cTfh17 signature genes in …
-
Figure 6—figure supplement 1—source data 1
Source data file of statistics in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig6-figsupp1-data1-v2.xlsx
Figure 7 with 1 supplement
cTfh17 cells are long-lived and accumulate with aging.
(A–C) PBMC samples from 20 healthy individuals were cultured for 18 hr with or without indicated antigens, followed by FACS to detect the phenotype of antigen-specific cTfh cells. Experiment design …
-
Figure 7—source data 1
Source data file of statistics in Figure 7.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
SARS-CoV-2-specific cTfh17 cells have superior persistence.
Peripheral blood was collected from 14 healthy donors and 13 convalescent Covid-19 patients at 10–12 months post the infection, and ELISA or AIM assays were performed. The SARS-CoV-2specific IgG …
-
Figure 7—figure supplement 1—source data 1
Source data file of statistics in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig7-figsupp1-data1-v2.xlsx
Figure 8 with 1 supplement
iTfh17 cells are superior in survival and differentiation into GC-Tfh cells after resting.
(A–C) 5×104 FACS-purified OT-II iTfh1, iTfh17, or iTfh2 cells were separately transferred to CD28KO recipients, and the spleens were FACS analysed on day1 and day35. Experimental design (A), …
-
Figure 8—source data 1
Source data file of statistics in Figure 8.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig8-data1-v2.xlsx
Figure 8—figure supplement 1
iTfh1/2 cells retain polarized Th1/2 cytokine profiles and promote specific isotype class switching.
FACS-purified 1×104 B1-8 B cells and 5×104 OT-II iTfh1, iTfh17 or iTfh2 cells were co-transferred to CD28KO recipients. The early immunization group was immunized by NP-OVA in alum 1 day after the …
-
Figure 8—figure supplement 1—source data 1
Source data file of statistics in Figure 8—figure supplement 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-fig8-figsupp1-data1-v2.xlsx
Tables
Table 1
Summary of the Tfh populations in this study.
| Name | Species | Origin | Description |
|---|---|---|---|
| Tfh1 | Human, mouse | Lymphoid tissues, blood, in vitro culture | General nomenclature, refers to Th1-featured CXCR5-expressing CD4+ T cells from all origins |
| Tfh2 | Human, mouse | Lymphoid tissues, blood, in vitro culture | General nomenclature, refers to Th2-featured CXCR5-expressing CD4+ T cells from all origins |
| Tfh17 | Human, mouse | Lymphoid tissues, blood, in vitro culture | General nomenclature, refers to Th17-featured CXCR5-expressing CD4+ T cells from all origins |
| Tfh | Human, mouse | Lymphoid tissues | Effector cells in the B cell follicle (CD4+ CXCR5+ PD-1+) |
| GC-Tfh | Human, mouse | Lymphoid tissues | Effector cells in the germinal centre (CD4+ CXCR5high PD-1highBCL6high) |
| iTfh1 | Mouse | In vitro culture | Culture induced Tfh1-like cells (CD44+ PD-1+ CXCR5+ BCL6+ T-bet+) |
| iTfh2 | Mouse | In vitro culture | Culture induced Tfh2-like cells (CD44+ PD-1+ CXCR5+ BCL6+ GATA3 +) |
| iTfh17 | Mouse | In vitro culture | Culture induced Tfh17-like cells (CD44+ PD-1+ CXCR5+ BCL6+ RORγt +) |
| cTfh | Human | Blood | Circulating memory Tfh cells (CD4+ CD45RA- CXCR5+) |
| cTfhCM | Human | Blood | Circulating memory Tfh cells with central memory features (CD4+ CXCR5+ CCR7high PD-1low) |
| cTfhEM | Human | Blood | Circulating memory Tfh cells with effector memory features (CD4+ CXCR5+ CCR7low PD-1high) |
| cTfh1 | Human | Blood | Circulating memory Tfh1 cells (CD4+ CD45RA- CXCR5+ CXCR3+ CCR6-) |
| cTfh2 | Human | Blood | Circulating memory Tfh2 cells (CD4+ CD45RA- CXCR5+ CXCR3- CCR6-) |
| cTfh17 | Human | Blood | Circulating memory Tfh17 cells (CD4+ CD45RA- CXCR5+ CXCR3- CCR6+) |
Table 2
Demographics for all human samples included in the research.
| Cohort description | Number | Gender(female, male) | Age(median, range) | CorrespondingFigures |
|---|---|---|---|---|
| Healthy individuals for cTfh phenotyping | 33 | 26/7 | 35 (21–71) | Figure 4A–C Figure 7D–E Figure 5—figure supplement 1A–C |
| Healthy individuals received HBV vaccines | 38 | 8/29 | 19 (18–20) | Figure 5 Figure 7D–E Figure 5—figure supplement 1D–E Figure 5—figure supplement 2 |
| Healthy individuals for measles and TT AIM assay | 20 | 11/9 | 24 (18–32) | Figure 7D–E |
| Healthy children | 18 | 14/4 | 6 (0.5–12) | Figure 7D–E |
| Cord blood | 5 | 2/3 | 0 (0–0) | Figure 7D–E |
| Recovered Covid-19 patients | 13 | 9/4 | 33 (23–52) | Figure 7—figure supplement 1A–C |
| Healthy individuals for qPCR and cytokine assay | 14 | 9/5 | 42.5 (27-51) | Figure 4D–G Figure 7—figure supplement 1A |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Sequence-based reagent | TBX21-F | IDT | PCR primers | CACTACAGGATGTTTGTGGACGTG |
| Sequence-based reagent | TBX21-R | IDT | PCR primers | CCCCTTGTTGTTTGTGAGCTTTAG |
| Sequence-based reagent | GATA3-F | IDT | PCR primers | TGTCTGCAGCCAGGAGAGC |
| Sequence-based reagent | GATA3-R | IDT | PCR primers | ATGCATCAAACAACTGTGGCCA |
| Sequence-based reagent | RORC -F | IDT | PCR primers | TCTGGAGCTGGCCTTTCATCATCA |
| Sequence-based reagent | RORC -R | IDT | PCR primers | TCTGCTCACTTCCAAAGAGCTGGT |
| Sequence-based reagent | GAPDH -F | IDT | PCR primers | TGCACCACCAACTGCTTAG |
| Sequence-based reagent | GAPDH -R | IDT | PCR primers | GGATGCAGGGATGATGTTC |
| Sequence-based reagent | Pdcd1-F | IDT | PCR primers | CGGTTTCAAGGCATGGTCATTGG |
| Sequence-based reagent | Pdcd1-R | IDT | PCR primers | TCAGAGTGTCGTCCTTGCTTCC |
| Sequence-based reagent | Cxcr5-F | IDT | PCR primers | ATCGTCCATGCTGTTCACGCCT |
| Sequence-based reagent | Cxcr5-R | IDT | PCR primers | CAACCTTGGCAAAGAGGAGTTCC |
| Sequence-based reagent | Icos-F | IDT | PCR primers | GCAGCTTTCGTTGTGGTACTCC |
| Sequence-based reagent | Icos-R | IDT | PCR primers | TGTGTTGACTGCCGCCATGAAC |
| Sequence-based reagent | Cd40lg-F | IDT | PCR primers | GAACTGTGAGCAGATGAGAAGGC |
| Sequence-based reagent | Cd40lg-R | IDT | PCR primers | TGGCTTCGCTTACAACGTGTGC |
| Sequence-based reagent | Il21-F | IDT | PCR primers | GCCTCCTGATTAGACTTCGTCAC |
| Sequence-based reagent | Il21-R | IDT | PCR primers | CAGGCAAAAGCTGCATGCTCAC |
| Sequence-based reagent | Bcl6-F | IDT | PCR primers | CAGAGATGTGCCTCCATACTGC |
| Sequence-based reagent | Bcl6-R | IDT | PCR primers | CTCCTCAGAGAAACGGCAGTCA |
| Sequence-based reagent | Ifng-F | IDT | PCR primers | CAGCAACAGCAAGGCGAAAAAGG |
| Sequence-based reagent | Ifng-R | IDT | PCR primers | TTTCCGCTTCCTGAGGCTGGAT |
| Sequence-based reagent | Il4-F | IDT | PCR primers | ATCATCGGCATTTTGAACGAGGTC |
| Sequence-based reagent | Il4-R | IDT | PCR primers | ACCTTGGAAGCCCTACAGACGA |
| Sequence-based reagent | Il17a-F | IDT | PCR primers | CAGACTACCTCAACCGTTCCAC |
| Sequence-based reagent | Il17a-R | IDT | PCR primers | TCCAGCTTTCCCTCCGCATTGA |
| Sequence-based reagent | Ubc-F | IDT | PCR primers | GCCCAGTGTTACCACCAAGA |
| Sequence-based reagent | Ubc-R | IDT | PCR primers | CCCATCACACCCAAGAACA |
| Antibody | Anti-human-CD4, mouse monoclonal | Biolegend | Clone: RPA-T4 | 1:200 |
| Antibody | Anti-human- CD45RA, mouse monoclonal | Biolegend | Clone: HI100 | 1:200 |
| Antibody | Anti-human- CXCR5, mouse monoclonal | Biolegend | Clone: J252D4 | 1:100 |
| Antibody | Anti-human- CXCR3, mouse monoclonal | Biolegend | Clone: G025H7 | 1:100 |
| Antibody | Anti-human- CCR6, mouse monoclonal | Biolegend | Clone: G034E3 | 1:50 |
| Antibody | Anti-human- CCR7, mouse monoclonal | Biolegend | Clone: G043H7 | 1:100 |
| Antibody | Anti-human- PD-1, mouse monoclonal | Biolegend | Clone: A17188B | 1:50 |
| Antibody | Anti-human- PD-L1, mouse monoclonal | Biolegend | Clone: 29E.2A3 | 1:30 |
| Antibody | Anti-human- OX40, mouse monoclonal | Biolegend | Clone: Ber-ACT35 (ACT35) | 1:200 |
| Antibody | Anti-human- CD25, mouse monoclonal | Biolegend | Clone: BC96 | 1:100 |
| Antibody | Anti-human- CD19, mouse monoclonal | Biolegend | Clone: HIB19 | 1:200 |
| Antibody | Anti-human- IFN-γ, mouse monoclonal | Biolegend | Clone: B27 | 1;100 |
| Antibody | Anti-human- IL-4, mouse monoclonal | Biolegend | Clone: MP4-25D2 | 1:50 |
| Antibody | Anti-human- IL-17A, mouse monoclonal | Biolegend | Clone: BL168 | 1:100 |
| Antibody | Anti-mouse- B220, rat monoclonal | Biolegend | Clone: RA3-6B2 | 1:500 |
| Antibody | Anti-mouse- CD38, rat monoclonal | Biolegend | Clone: 90 | 1:200 |
| Antibody | Anti-mouse- CCR7, rat monoclonal | Biolegend | Clone: 4B12 | 1:50 |
| Antibody | GL7, rat monoclonal | Biolegend | Clone: GL7 | 1:500 |
| Antibody | Anti-mouse- CD4, rat monoclonal | Biolegend | Clone: RM4-4 | 1:500 |
| Antibody | Anti-mouse- CD44, rat monoclonal | Biolegend | Clone: IM7 | 1:200 |
| Antibody | Anti-mouse- CXCR5, rat monoclonal | Biolegend | Clone: L138D7 | 1:100 |
| Antibody | Anti-mouse- PD-1, rat monoclonal | Biolegend | Clone: 29 F.1A12 | 1:200 |
| Antibody | Anti-mouse- CXCR3, Armenian hamster monoclonal | Biolegend | Clone: CXCR3-173 | 1:100 |
| Antibody | Anti-mouse- CCR6, Armenian hamster monoclonal | Biolegend | Clone: 29–2 L17 | 1:50 |
| Antibody | Anti-T-bet, mouse monoclonal | Biolegend | Clone: 4B10 | 1:200 |
| Antibody | Anti-GATA3, mouse monoclonal | Biolegend | Clone: 16E10A23 | 1:50 |
| Antibody | Anti-RORγt, mouse monoclonal | Biolegend | Clone: Q31-378 | 1:100 |
| Antibody | Anti-mouse- CD45.2, rat monoclonal | Biolegend | Clone: 104 | 1:100 |
| Antibody | Anti-BCL6, mouse monoclonal | Biolegend | Clone: 7D1 | 1:50 |
| Antibody | Anti-mouse-IgG1, rat monoclonal | Biolegend | Clone: RMG1-1 | 1:200 |
| Antibody | Anti-mouse-IgG2a, rat monoclonal | BD | Clone: R19-15 | 1:200 |
| Antibody | Anti-mouse-IgG3, rat monoclonal | BD | Clone: R40-82 | 1:200 |
| Antibody | Anti-mouse-IgE, rat monoclonal | BD | Clone: R35-72 | 1:200 |
| Antibody | Anti-mouse-IgA, rat monoclonal | BD | Clone: C10-1 | 1:200 |
Table 3
Conditions for differentiating iTfh0, iTfh1, iTfh2, and iTfh17 Cells.
| Cell type | Cytokines | Neutralizing antibodies |
|---|---|---|
| iTh0 | No cytokines | No antibodies |
| iTh1 | 20 ng/ml IL-12 | Anti-IL-4, anti-TGF-β |
| iTh2 | 50 ng/ml IL-4 | Anti-IFN-γ, anti-TGF-β |
| iTh17 | 50 ng/ml IL-6, 2 ng/ml TGF-β | Anti-IFN-γ, anti-IL-4 |
| iTfh1 | 100 ng/ml IL-6, 50 ng/ml IL-21, 1 ng/ml IL-12 | Anti-IL-4, anti-TGF-β |
| iTfh2 | 100 ng/ml IL-6, 50 ng/ml IL-21, 20 ng/ml IL-4 | Anti-IFN-γ, anti-TGF-β |
| iTfh17 | 100 ng/ml IL-6, 50 ng/ml IL-21, 0.1 ng/ml TGF-β | Anti-IFN-γ, anti-IL-4 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/82217/elife-82217-mdarchecklist1-v2.pdf
-
Source code 1
The code (R) for scRNA-seq.
The original R code to generate the signature scores in Figure 6 and Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/82217/elife-82217-code1-v2.zip
