(A) Ki67 immunofluorescence for the detection of proliferating cells in ad libitum (AL), 1- and 3-week IF-treated livers. IF-treated livers were analyzed 30 min after re-feeding cycle. (B, C) …
(A) Schematic of unbiased system to trace cell proliferation during AL feeding and intermittent fasting (IF). R26-CreER mice were crossed to R26-Confetti mice enabling permanent cell labeling and …
(A) Violin plots, from scRNA-seq, demonstrating zonal marker gene expression used to classify single hepatocytes from AL and intermittent fasting (IF) livers as pericentral (PC), midlobular (Mid), …
(A) Quantitative real-time PCR analysis highlighting rapid increase in Fgf15 expression in ileum 30 min after re-feeding in 1-week IF-treated livers. One-way analysis of variance (ANOVA), comparison …
(A) Method to constitutively activate WNT signaling in midlobular, periportal cells. AAV8-U6-sgAPC was injected into the tail vein of Rosa26-Cas9 mice. Animals were IF treated for 1 week before …
(A) Liver-to-body weight ratio in wild-type livers during 2 days, 1 week, and 3 weeks of IF and ad libitum (AL) feeding. (B–K) Liver analyses after 3 weeks of IF treatment in control, Klb KO, and Tbx…
A-H AL Klb KO, AL Tbx3 KO, and control AL livers were assessed at the same time point in Figure 4 (3 weeks after AL feeding). (A) Liver-to-body weight ratio. (B, C) Hepatocyte cell and nuclear area. …
(A, B) Sirius red staining and quantification to assess for liver fibrosis. (C) TUNEL stains on livers. All statistics were performed on N=3-5 animals using one-way analysis of variance (ANOVA). *p <…
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
gene (Mus musculus) | Fgf15 | GenBank | BC021328 cloneID 5066286 | Male |
Strain, strain background (Mus musculus, male) | C57BL/6 J | The Jackson Laboratory | Cat# 000664 RRID:IMSR_JAX:000664 | |
Strain, strain background (Mus musculus, male) | Rosa26-CreERT2 | The Jackson Laboratory | Cat# 008463 RRID:IMSR_JAX:00846 | |
Strain, strain background (Mus musculus, male) | Rosa26-Confetti | The Jackson Laboratory | Cat# 017492 RRID:IMSR_JAX:008463 | |
Strain, strain background (Mus musculus, male) | Axin2-rtTA | The Jackson Laboratory | Cat# 016997 RRID:IMSR_JAX:016997 | |
Strain, strain background (Mus musculus, male) | TetO-H2B-GFP | The Jackson Laboratory | Cat# 005104 RRID:IMSR_JAX: 005104 | |
Strain, strain background (Mus musculus, male) | TetO-Cre | The Jackson Laboratory | Cat#006234 RRID:IMSR_JAX:006234 | |
Strain, strain background (Mus musculus, male) | Rosa26-mTmG | The Jackson Laboratory | Cat# 037456 RRID:IMSR_JAX: 037456 | |
Strain, strain background (Mus musculus, male) | Rosa26-Cas9 | The Jackson Laboratory | Cat# 026179 RRID:IMSR_JAX: 026179 | |
Strain, strain background (Mus musculus, male) | Tbx3 flox | Dr. Anne Moon | N/A | |
Strain, strain background (Mus musculus, male) | Klb flox | Dr. David Mangelsdorf | N/A | |
antibody | anti-GFP (Chicken polyclonal) | Abcam | Cat# ab13970 RRID:AB_300798 | 1:500 IF |
antibody | Anti-RFP (Rabbit polyclonal) | Rockland | Cat# 600-401-379 RRID:AB_2209751 | 1:500 IF |
antibody | Anti-Hnf4 (Mouse monoclonal) | Abcam | Cat# ab41898 RRID:AB_732976 | 1:500 IF; 50 IHC |
antibody | Anti-Klotho (Rat monoclonal) | DSHB | Klotho KL-115 RRID:AB_2618099 | 1:50 IF |
antibody | Anti-FGF15 (Mouse monoclonal, IgG2a) | Santa Cruz | sc-514647 RRID NA | 1:50 IF |
antibody | Anti-Phospho-Tryosine (mouse monoclonal) | Cell Signaling Technology | Cat# 9411 RRID:AB_331228 | 1:50 IF |
antibody | Anti-Phospho-c-Jun (Ser73) (rabbit monoclonal) | Cell Signaling Technology | Cat# 3270, RRID:AB_2129575 | 1:50 IF |
antibody | Anti-Tbx3 (Goat polyclonal) | Santa Cruz Biotechnology | Cat# sc-17871 RRID:AB_661666 | 1:50 IHC |
antibody | Anti-Goat IgG (Donkey polyclonal) | Jackson Immuno Research Labs | Cat# 705-065-147 RRID:AB_2340397 | 1:200 IHC |
antibody | Anti-Glutamine Synthetase (Mouse monoclonal) | Millipore | Cat# MAB302 RRID:AB_2110656 | 1:500 IHC |
antibody | Anti-Catenin, beta (mouse monoclonal) | BD Biosciences | Cat# 610154 RRID:AB_397555 | 1:50 IHC |
antibody | Anti-Hnf4 (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc-8987 RRID:AB_2116913 | 1:50 IHC |
antibody | KI67(SolA15) (Rat, monoclonal) | Thermo Fisher Scientific | Cat# 14-5698-82 RRID:AB_10854564 | 1:50 IHC |
recombinant DNA reagent | pAAV-Guide-it-Down | Clontech Laboratories Inc. | Cat# 041315 | |
recombinant DNA reagent | pscAAV-TTR-mFgf15 | This paper and Addgene | Currently Deposit 81516 | |
sequence-based reagent | sgAPC_F | This paper | Assembly primers for pAAV-Guide-it-Down targeting | CCGGAGGCTGCATGAGAGCACTTG3 |
sequence-based reagent | sgAPC_F | This paper | Assembly primers for pAAV-Guide-it-Down targeting | AAACCAAGTGCTCTCATGCAGCCT3 |
sequence-based reagent | sgRNA: targeting Apc | This paper | Targeting sequence | AGGCTGCATGAGAGCACTTG |
commercial assay or kit | In-Fusion HD Cloning | Clontech | Cat# 639647 | |
commercial assay or kit | RNAscope probe-Mm-Cyp2f2 | Advanced Cell Diagnostics | Cat# 451851 | target region: 555–169 |
commercial assay or kit | RNAscope probe-Mm-Cyp2e1-C2 | Advanced Cell Diagnostics | Cat# 402781 C2 | target region: 458–1530 |
commercial assay or kit | RNeasy Mini Isolation Kit | Qiagen | Cat# 74004 | |
commercial assay or kit | High Capacity cDNA Reverse Transcription Kit | Life Technologies | Cat# 4368814 | |
commercial assay or kit | Taqman Gene Expression Assay (Gapdh) | ThermoFisher Scientific | Cat# 4331182; Mm99999915_g1 | |
commercial assay or kit | Expression Assay (Klb) | ThermoFisher Scientific | Cat# 4331182; Mm00473122_m1 | |
commercial assay or kit | Expression Assay (Fgf15) | ThermoFisher Scientific | Cat# 4331182; Mm00433278_m1 | |
commercial assay or kit | Expression Assay (Tbx3) | ThermoFisher Scientific | Cat# 4331182; Mm01195719_m1 | |
commercial assay or kit | Chromium Single Cell 3” Reagents Kit V3 | 10 x Genomics | Discontinued | |
commercial assay or kit | NovaSeq S2 v.1.5 Reagent Kits | Illumnina | NA | Discontinued |
commercial assay or kit | Filter Microplates | Agilent Technologies | Cat#203980–100 | |
chemical compound, drug | Tamoxifen | Sigma Aldrich | Cat# T5648-1G | |
chemical compound, drug | Doxycycline hyclate | Sigma-Aldrich | Cat# D9891 | |
chemical compound, drug | HistoClear | Natural Diagnostics | Cat# HS2001GLL | |
chemical compound, drug | Antigen Unmasking Solution, Tris-Based | Vector Labs | Cat# H-3301 | |
chemical compound, drug | Avidin/Biotin Blocking Kit | Vector Labs | Cat# SP-2001 | |
chemical compound, drug | Click-iT Plus TUNEL Assay Kits for In Situ Apoptosis Detection | ThermoFisher Scientific | Cat# C10619 | |
chemical compound, drug | FxCycle PI/RNase | ThermoFisher Scientific | Cat# F10797 | |
chemical compound, drug | TRIzol Reagent | Invitrogen | Cat# 15596026 | |
software, algorithm | ImageJ | NIH https://imagej.net/ | RRID:SCR_003070 | |
software, algorithm | GraphPad Prism 5.0 software | GraphPad Software; http://www.graphpad.com | RRID:SCR_002798 | |
software, algorithm | Cell Ranger Software (v3.1.0, mm10 ref genome) | 10 x Genomics Software; https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger | RRID:SCR_017344 | |
software, algorithm | Seraut Software (v3.0, R package) | Seurat Software; https://satijalab.org/seurat/get_started.htm | RRID:SCR_016341 | |
software, algorithm | BD FACS Diva 8.0 software (BD) | BD FACS Diva software; http://www.bdbiosciences.com/instruments/software/facsdiva/index.jsp | RRID:SCR_001456 | |
software, algorithm | MS-DIAL v4.60 software | MS-DIAL software; (Tsugawa et al., 2020) | NA | |
software, algorithm | MetaboAnalyst 5.0 software | MetaboAnalyst software; https://www.metaboanalyst.ca/ | RRID:SCR_015539 | |
Other | AAV/DJ8-Ttr-Cre | Vector Bio Labs | 7102 | AAV-DJ8 virus that expresses an improved Cre under a liver-specific Ttr promoter |
Other | AAV8-Null | Vector Bio Labs | 7077 | AAV serotype 8 virus that has a CMV promoter with no transgene. It's used as control AAV in the paper. |
Metabolomics intermittent fasting (IF) versus ad libitum (AL significantly changed metabolites between IF and AL samples from metabolomic studies).