Strain, strain background (E. coli) | MC1061 | Lucigen | Lucigen: 10361012 | bacterial cells used for surface-display screens |
Strain, strain background (E. coli) | DH5α | Invitrogen | Invitrogen: 18265017 | bacterial cells used for general cloning and library cloning |
Strain, strain background (E. coli) | BL21(DE3) | ThermoFisher Scientific | Thermo: C600003 | bacterial cells for general protein-expression; pre-transformed with pCDF-YopH for tyrosine kinase overexpression |
Strain, strain background (E. coli) | C43(DE3) | Lucigen | Lucigen: NC9581214 | bacterial cells used for SH2 domain over-expression; pre-transformed with pCDFDuet-BirA-WT for biotinylation |
Antibody | 4 G10 Platinum, Biotin (mouse monoclonal) | Millipore Sigma | Millipore Sigma: 16–452-MI | biotin conjugated mouse monoclonal pan-phosphotyrosine antibody dilution: (1:1000) |
Antibody | PY20-PerCP-eFluor 710 (mouse monoclonal) | eBioscience | eBioscience: 46-5001-42 | PerCP-eFluor 710-conjugated mouse monoclonal pan-phosphotyrosine antibody, clone PY20 dilution: (1:25) |
Antibody | PY20-biotin (mouse monoclonal) | Exalpha | Exalpha: 50-210-1865 | biotin conjugated mouse monoclonal pan-phosphotyrosine antibody dilution (1:500) |
Antibody | StrepMAB Chromeo 488 (mouse monoclonal) | IBA LifeSciences | IBA: 2-1546-050 | Chromeo 488-conjugated antibody that recognizes the strep-tag dilution: (1:50–100). Discontinued, but can be replaced with IBA LifeSciences StrepMAB-Classic conjugate DY-488 (IBA: 2-1563-050) |
Recombinant DNA reagent | pBAD33-eCPX | PMID:18480093 | Addgene: 23336 | pBAD33 plasmid encoding the eCPX bacterial display gene with flanking 5' and 3' SfiI restriction sites |
Recombinant DNA reagent | pBAD33-eCPX-cStrep | PMID:29547119 |
| pBAD33 plasmid encoding the eCPX bacterial display gene with a 3' sequence encoding a strep-tag and flanking 5' and 3' SfiI restriction sites |
Recombinant DNA reagent | pBAD33-eCPX-cMyc | this paper |
| pBAD33 plasmid encoding the eCPX bacterial display gene with a 3' sequence encoding a myc-tag and flanking 5' and 3' SfiI restriction sites |
Recombinant DNA reagent | X5-Y-X5 Library (myc-tagged) | this paper |
| peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing 1–10 million unique sequences with the structure X5-Y-X5, where X is encoded by an NNS codon. The scaffold protein is encoded to have a C-terminal myc-tag: EQKLISEEDL. |
Recombinant DNA reagent | X5-Y-X5 Library (strep-tagged) | this paper |
| peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing 1–10 million unique sequences with the structure X5-Y-X5, where X is encoded by an NNS codon. The scaffold protein is encoded to have a C-terminal strep-tag: WSHPQFEK. |
Recombinant DNA reagent | pTyr-Var Library (myc-tagged) | this paper |
| peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing ~10,000 unique sequences encoding reference and variant phosphosite pairs deried from the PhosphoSitePlus database. The scaffold protein is encoded to have a C-terminal myc-tag: EQKLISEEDL. |
Recombinant DNA reagent | pTyr-Var Library (strep-tagged) | this paper |
| peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing ~10,000 unique sequences encoding reference and variant phosphosite pairs deried from the PhosphoSitePlus database. The scaffold protein is encoded to have a C-terminal strep-tag: WSHPQFEK. |
Recombinant DNA reagent | pET-23a-His6-TEV-Src(KD) | PMID:29547119 |
| bacterial expression vector encoding the human c-Src kinase domain (residues 260–528), with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-23a-His6-TEV-Fyn(KD) | PMID:29547119 |
| bacterial expression vector encoding the human Fyn kinase domain (residues 261–529) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-23a-His6-TEV-Hck(KD) | PMID:29547119 |
| bacterial expression vector encoding the human Hck kinase domain (residues 252–520) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-23a-His6-TEV-Abl(KD) | PMID:29547119 |
| bacterial expression vector encoding the mouse c-Abl kinase domain (residues 232–502) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-23a-His6-TEV-AncSZ(KD) | DOI: 10.1101/2022.04.24.489292 |
| bacterial expression vector encoding the AncSZ kinase domain (residues 352–627) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET23a-His6-TEV-Fer(KD) | this paper |
| bacterial expression vector encoding the mouse Fer kinase domain (residues 553–823) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-FGFR1(KD) | PMID:30004690 | Addgene: 79719 | bacterial expression vector encoding the human FGFR1 kinase domain (residues 456–763) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-FGFR3(KD) | PMID:30004690 | Addgene: 79731 | bacterial expression vector encoding the human FGFR3 kinase domain (residues 449–759) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-EPHB1(KD) | PMID:30004690 | Addgene: 79694 | bacterial expression vector encoding the human EPHB1 kinase domain (residues 602–896) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-EPHB2(KD) | PMID:30004690 | Addgene: 79697 | bacterial expression vector encoding the human EPHB2 kinase domain (residues 604–898) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-MERTK(KD) | PMID:30004690 | Addgene: 79705 | bacterial expression vector encoding the human MERTK kinase domain (residues 570–864) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pCDF-YopH | PMID:16260764 |
| bacterial expression vector for co-expression of untagged YopH phosphatase with tyrosine kinases |
Recombinant DNA reagent | pET28-His6-TEV-SHP2-C459E-no tail | this paper |
| bacterial expression vector encoding the human SHP2 (residues 1–526) with the C459E mutation, an N-terminal His6-tag, and TEV protease recognition sequence |
Recombinant DNA reagent | pET28-His6-TEV-SHP2-C459E-no tail-D61V | this paper |
| bacterial expression vector encoding the human SHP2 (residues 1–526) with C459E and D61V mutations, an N-terminal His6-tag, and TEV protease recognition sequence |
Recombinant DNA reagent | pET28-His6-TEV-SHP2-C459E-no tail-D61N | this paper |
| bacterial expression vector encoding the human SHP2 (residues 1–526) with C459E and D61N mutations, an N-terminal His6-tag, and TEV protease recognition sequence |
Recombinant DNA reagent | pCDFDuet-BirA-WT | this paper |
| bacterial expression vector encoding BirA biotin ligase, used to coexpress with SH2 domain expression vector for biotinylation of SH2 domain |
Recombinant DNA reagent | pET-His6-SUMO-Src(SH2) | this paper |
| bacterial expression vector encoding the human cSrc SH2 domain (residues 143–250) with an N-terminal His6-SUMO tag |
Recombinant DNA reagent | pET-His6-SUMO-SHP2(CSH2) | this paper |
| bacterial expression vector encoding the human SHP2 CSH2 domain (residues 105–220) with an N-terminal His6-SUMO tag |
Recombinant DNA reagent | pET-His6-SUMO-Grb2(SH2) | this paper |
| bacterial expression vector encoding the human Grb2 SH2 domain (residues 56–152) with an N-terminal His6-SUMO tag |
Recombinant DNA reagent | pULTRA CMF | PMID:28604693 |
| bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-carboxymethyl phenylalanine via Amber suppression |
Recombinant DNA reagent | pEVOL pAzFRS.2.t1 | PMID:26571098 | Addgene: 73546 | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-azido phenylalanine and other Phe derivatives via Amber suppression |
Recombinant DNA reagent | pULTRA chAcKRS3 | PMID:29544052 |
| bacterial expression vector encoding the tRNA/syntetase pair for incorporation of acetyl-lysine via Amber suppression; gift from Abhishek Chatterjee at Boston College |
Recombinant DNA reagent | pULTRA-Amp CMF | this paper |
| bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-carboxymethyl phenylalanine via Amber suppression, altered to have an ampicillin resistance marker |
Recombinant DNA reagent | pULTRA-Amp pAzFRS.2.t1 | this paper |
| bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-azido phenylalanine and other Phe derivatives via Amber suppression, altered to have an ampicillin resistance marker |
Recombinant DNA reagent | pULTRA-Amp chAcKRS3 | this paper |
| bacterial expression vector encoding the tRNA/syntetase pair for incorporation of acetyl-lysine via Amber suppression, altered to have an ampicillin resistance marker |
Sequence-based reagent | X5-Y-X5 library oligo; eCPX-rand-lib | this paper, purchased from Millipore Sigma |
| primer sequence: 5’-GCTGGCCAGTCTGGCCAGNNS NNSNNSNNSNNStatNNSNNSNNSNNSNNSGGAGG GCAGTCTGGGCAGTCTG 3’ |
Sequence-based reagent | Oligopool-fwd-primer | this paper, purchased from Millipore Sigma |
| primer sequence: 5’-GCTGGCCAGTCTG-3’ |
Sequence-based reagent | Oligopool-rev-primer | this paper, purchased from Millipore Sigma |
| primer sequence: 5’-CAGACTGCCCAGACT-3’ |
Sequence-based reagent | link-eCPX-fwd | this paper, purchased from Millipore Sigma |
| 5’-GGAGGGCAGTCTGGGCAGTCTG-3’ |
Sequence-based reagent | link-eCPX-rev | this paper, purchased from Millipore Sigma |
| 5’-GCTTGGCCACCTTGGCCTTATTA-3’ |
Sequence-based reagent | BB-fwd-primer | this paper, purchased from Millipore Sigma |
| 5’-TAATAAGGCCAAGGTGGCCAAGC-3’ |
Sequence-based reagent | BB-rev primer | this paper, purchased from Millipore Sigma |
| 5’-CTGGCCAGACTGGCCAGCTACG-3’ |
Sequence-based reagent | TruSeq-eCPX-Fwd | sequence from PMID:29547119, purchased from Millipore Sigma | round one amplicon PCR primer | primer sequence: 5’-TGACTGGAGTTCAGACGTG TGCTCTTCCGATCTNNNNNNACCGCA GGTACTTCCGTAGCT-3’ |
Sequence-based reagent | TruSeq-eCPX-Rev | sequence from PMID:29547119, purchased from Millipore Sigma | round one amplicon PCR primer | primer sequence: 5’-CACTCTTTCCCTACACGACG CTCTTCCGATCTNNNNNN TTTTGTTGTAGTCACCAGACTG-3’ |
Sequence-based reagent | D701 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGACGG CATACGAGATcgagtaatGTG ACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D702 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGA CGGCATACGAGATtctccgga GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D703 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGA CGGCATACGAGATaatgagcg GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D704 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGAC GGCATACGAGATggaatctcG TGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D705 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGA AGACGGCATACGAGA TttctgaatGTGACTGGAGT TCAGACGTG-3' |
Sequence-based reagent | D706 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGA CGGCATACGAGATacgaattc GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D707 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAG ACGGCATACGAGATagcttcag GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D708 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGACG GCATACGAGATgcgcattaGT GACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D709 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAG ACGGCATACGAGATcatagccg GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D710 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGA AGACGGCATACGAGATttcgcgga GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D711 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGACG GCATACGAGATgcgcgaga GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D712 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAA GACGGCATACGAGATctatcgctGT GACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D501 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCGA CCACCGAGATCTACACtatagcct ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D502 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCG ACCACCGAGATCTACACatagaggc ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D503 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCGA CCACCGAGATCTACACcctatcct ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D504 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCGA CCACCGAGATCTACACggctctga ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D505 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGC GACCACCGAGATCTACACaggcgaag ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D506 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGG CGACCACCGAGATCTACACtaatctta ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D507 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGC GACCACCGAGATCTACACcaggacgt ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D508 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACG GCGACCACCGAGATCTACAC gtactgacACACTCTTTCCCTACACGAC-3' |
Peptide, recombinant protein | Src(KD) | this paper, expressed/purified in-house |
| human c-Src kinase domain (residues 260–528) |
Peptide, recombinant protein | Fyn(KD) | this paper, expressed/purified in-house |
| human Fyn kinase domain (residues 261–529) |
Peptide, recombinant protein | Hck(KD) | this paper, expressed/purified in-house |
| human Hck kinase domain (residues 252–520) |
Peptide, recombinant protein | Abl(KD) | this paper, expressed/purified in-house |
| mouse c-Abl kinase domain (residues 232–502) |
Peptide, recombinant protein | JAK2 Protein, active | Millipore Sigma | Millipore Sigma: 14–640 M | Active, C-terminal His6-tagged, recombinant, human JAK2, amino acids 808-end, expressed by baculo virus in Sf21 cells, for use in Enzyme Assays. |
Peptide, recombinant protein | AncSZ(KD) | this paper, expressed/purified in-house |
| AncSZ kinase domain (residues 352–627) designed by ancestral sequence reconstruction |
Peptide, recombinant protein | Fer(KD) | this paper, expressed/purified in-house |
| mouse Fer kinase domain (residues 553–823) |
Peptide, recombinant protein | FGFR1(KD) | this paper, expressed/purified in-house |
| human FGFR1 kinase domain (residues 456–763) |
Peptide, recombinant protein | FGFR3(KD) | this paper, expressed/purified in-house |
| human FGFR3 kinase domain (residues 449–759) |
Peptide, recombinant protein | EPHB1(KD) | this paper, expressed/purified in-house |
| human EPHB1 kinase domain (residues 602–896) |
Peptide, recombinant protein | EPHB2(KD) | this paper, expressed/purified in-house |
| human EPHB2 kinase domain (residues 604–898) |
Peptide, recombinant protein | MERTK(KD) | this paper, expressed/purified in-house |
| human MERTK kinase domain (residues 570–864) |
Peptide, recombinant protein | Src(SH2) | this paper, expressed/purified in-house |
| human c-Src SH2 domain (residues 143–250) |
Peptide, recombinant protein | SHP2(C-SH2) | this paper, expressed/purified in-house |
| human SHP2 C-SH2 domain (residues 105–220) |
Peptide, recombinant protein | Grb2(SH2) | this paper, expressed/purified in-house |
| human Grb2 SH2 domain (residues 56–152) |
Peptide, recombinant protein | SHP2(PTP; C459E) | this paper, expressed/purified in-house |
| human full-length SHP2 (residues 1–526; C459E) |
Peptide, recombinant protein | SHP2(PTP; C459E, D61V) | this paper, expressed/purified in-house |
| human full-length SHP2 (residues 1–526; C459E, D61V) |
Peptide, recombinant protein | SHP2(PTP; C459E, D61N) | this paper, expressed/purified in-house |
| human full-length SHP2 (residues 1–526; C459E, D61N) |
Peptide, recombinant protein | SHP2(PTP; C459E, G60V) | this paper, expressed/purified in-house |
| human full-length SHP2 (residues 1–526; C459E, G60V) |
Peptide, recombinant protein | Src Consensus | this paper, synthesized in-house |
| peptide sequence: Ac-GPDECIYDMFPFKKKG-NH2 |
Peptide, recombinant protein | Src Consensus (P-5C, D+1 G) | this paper, synthesized in-house |
| peptide sequence: Ac-GCDECIYGMFPFRRRG-NH2 |
Peptide, recombinant protein | Abl Consensus | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIYAVPPIKKKG-NH2 |
Peptide, recombinant protein | Fer Consensus | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIYEWWWIKKKG-NH2 |
Peptide, recombinant protein | EPHB1 Consensus | this paper, synthesized in-house |
| peptide sequence: Ac-GPPEPNYEVIPPKKKG-NH2 |
Peptide, recombinant protein | EPHB2 Consensus | this paper, synthesized in-house |
| peptide sequence: Ac-GPPEPIYEVPPPKKKG-NH2 |
Peptide, recombinant protein | SrcTide (1995) | sequence from PMID:7845468, synthesized in-house |
| peptide sequence: Ac-GAEEEIYGEFEAKKKG-NH2 |
Peptide, recombinant protein | SrcTide (2014) | sequence from PMID:25164267, purchased from Synpeptide |
| peptide sequence: Ac-GAEEEIYGIFGAKKKG-NH2 |
Peptide, recombinant protein | AblTide (2014) | sequence from PMID:7845468, synthesized in-house |
| peptide sequence: Ac-GAPEVIYATPGAKKKG-NH2 |
Peptide, recombinant protein | HRAS_Y64 | sequence from PMID:35606422, purchased from Synpeptide |
| peptide sequence: Ac-AGQEEYSAMRD-NH2 |
Peptide, recombinant protein | HRAS_Y64_E63K | sequence from PMID:35606422, purchased from Synpeptide |
| peptide sequence: Ac-AGQEKYSAMRD-NH2 |
Peptide, recombinant protein | CDK13_Y716_YF | this paper, synthesized in-house |
| peptide sequence: Ac-IGEGTYGQVFK-NH2 |
Peptide, recombinant protein | CDK13_Y716_G717R_YF | this paper, synthesized in-house |
| peptide sequence: Ac-IGEGTYRQVFK-NH2 |
Peptide, recombinant protein | CDK5_Y15 | sequence from PMID:35606422, purchased from Synpeptide |
| peptide sequence: Ac-IGEGTYGTVFK-NH2 |
Peptide, recombinant protein | CDK5_Y15_G16R | sequence from PMID:35606422, purchased from Synpeptide |
| peptide sequence: Ac-IGEGTYRTVFK-NH2 |
Peptide, recombinant protein | PLCG1_Y210 | this paper, synthesized in-house |
| peptide sequence: Ac-SGDITYGQFAQ-NH2 |
Peptide, recombinant protein | PLCG1_Y210_T209N | this paper, synthesized in-house |
| peptide sequence: Ac-SGDINYGQFAQ-NH2 |
Peptide, recombinant protein | GLB1_Y294 | this paper, synthesized in-house |
| peptide sequence: Ac-VASSLYDILAR-NH2 |
Peptide, recombinant protein | GLB1_Y294_L297F | this paper, synthesized in-house |
| peptide sequence: Ac-VASSLYDIFAR-NH2 |
Peptide, recombinant protein | MISP_Y95 | this paper, synthesized in-house |
| peptide sequence: Ac-EGWQVYRLGAR-NH2 |
Peptide, recombinant protein | HLA-DPB1_Y59_F64L_YF | this paper, synthesized in-house |
| peptide sequence: Ac-LERFIYNREEL-NH2 |
Peptide, recombinant protein | PEAK1_Y797 | this paper, synthesized in-house |
| peptide sequence: Ac-SVEELYAIPPD-NH2 |
Peptide, recombinant protein | SIRPA_Y496_P491L | this paper, synthesized in-house |
| peptide sequence: Ac-LFSEYASVQV-NH2 |
Peptide, recombinant protein | HGD_Y166_F169L | this paper, synthesized in-house |
| peptide sequence: Ac-GNLLIYTELGK-NH2 |
Peptide, recombinant protein | ITGA3_Y237_YF | this paper, synthesized in-house |
| peptide sequence: Ac-WDLSEYSFKDP-NH2 |
Peptide, recombinant protein | ITGA3_Y237_S235P_YF | this paper, synthesized in-house |
| peptide sequence: Ac-WDLPEYSFKDP-NH2 |
Peptide, recombinant protein | Src Consensus (C-2S) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDESIYDMFPFKKKG-NH2 |
Peptide, recombinant protein | Src Consensus (C-2P) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIYDMFPFKKKG-NH2 |
Peptide, recombinant protein | ACTA1_Y171_YF | this paper, synthesized in-house |
| peptide sequence: Ac-QPIFEG(pY)ALPHAG-NH2 |
Peptide, recombinant protein | ACTA1_Y171_A172G_YF | this paper, synthesized in-house |
| peptide sequence: Ac-QPIFEG(pY)GLPHAG-NH2 |
Peptide, recombinant protein | ACTB_Y240 | this paper, synthesized in-house |
| peptide sequence: Ac-QSLEKS(pY)ELPDGG-NH2 |
Peptide, recombinant protein | ACTB_Y240_P243L | this paper, synthesized in-house |
| peptide sequence: Ac-QSLEKS(pY)ELLDGG-NH2 |
Peptide, recombinant protein | CCDC39_Y593 | this paper, synthesized in-house |
| peptide sequence: Ac-QRKQQL(pY)TAMEEG-NH2 |
Peptide, recombinant protein | CLIP2_Y972 | this paper, synthesized in-house |
| peptide sequence: Ac-QSDQRR(pY)SLIDRG-NH2 |
Peptide, recombinant protein | CLIP2_Y972_R977P | this paper, synthesized in-house |
| peptide sequence: Ac-QSDQRR(pY)SLIDPG-NH2 |
Peptide, recombinant protein | CBS_Y308 | this paper, synthesized in-house |
| peptide sequence: Ac-QVEGIG(pY)DFIPTG-NH2 |
Peptide, recombinant protein | CBS_Y308_G307S | this paper, synthesized in-house |
| peptide sequence: Ac-QVEGIS(pY)DFIPTG-NH2 |
Peptide, recombinant protein | fluorescently-labeled c-Src-SH2 consensus peptide | sequence from PMID:7680959 |
| peptide sequence: FITC-Ahx-GDG(pY)EEISPLLL-NH2; gift from Jeanine Amacher at Western Washignton University |
Peptide, recombinant protein | Src Consensus (D+1 K) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDECIYKMFPFKKKG-NH2 |
Peptide, recombinant protein | Src Consensus (D1AcK) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDECIY(AcK)MFPFKKKG-NH2 |
Peptide, recombinant protein | Src Consensus (C-2K) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEKIYDMFPFKKKG-NH2 |
Peptide, recombinant protein | Src Consensus (C-2AcK) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDE(AcK)IYDMFPFKKKG-NH2 |
Peptide, recombinant protein | Abl Consensus (A+1 K) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIYKVPPIKKKG-NH2 |
Peptide, recombinant protein | Abl Consensus (A+1 AcK) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIY(AcK)VPPIKKKG-NH2 |
Peptide, recombinant protein | Abl Consensus (I+5 K) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIYAVPPKKKKG-NH2 |
Peptide, recombinant protein | Abl Consensus (I+5 AcK) | this paper, synthesized in-house |
| peptide sequence: Ac-GPDEPIYAVPP(AcK)KKKG-NH2 |
Commercial assay or kit | MiSeq Reagent Kit v3 (150 cycles) | Illumina | Illumina: MS-102–3001 |
|
Commercial assay or kit | NextSeq 500 Mid-Output v2 Kit (150 cycles) | Illumina | Illumina: FC-404–2001 |
|
Commercial assay or kit | Promega QuantiFluor dsDNA Sample Kit | Promega | Promega: E2671 |
|
Commercial assay or kit | ADP Quest Assay Kit | Eurofins Discoverx | Eurofins Discoverx: 90–0071 |
|
Commercial assay or kit | Dynabeads FlowComp Flexi Kit | ThermoFisher Scientific | ThermoFisher Scientific: 11061D |
|
Chemical compound, drug | 4-carboxymethyl phenylalanine (CMF) | Millipore Sigma | Millipore Sigma: ENA423210770 |
|
Chemical compound, drug | 4-azido-L-phenylalanine (AzF) | Chem-Impex International | Chem-Impex: 06162 |
|
Chemical compound, drug | N-ε-Acetyl-L-Lysine (AcK) | MP Biomedicals | MP Biomedicals: 02150235.2 |
|
Chemical compound, drug | Click-iT sDIBO -Alexa fluor 555 | ThermoFisher | Thermo: C20021 |
|
Other | Creatine Phosphokinase from rabbit muscle | Millipore Sigma | Millipore Sigma: C3755-500UN | purified enzyme extracted from rabbit muscle |
Software, algorithm | FLASH (version FLASH2-2.2.00) | PMID:21903629 |
| https://ccb.jhu.edu/software/FLASH/ |
Software, algorithm | Cutadapt (version 3.5) | DOI:10.14806/ej.17.1.200 |
| https://cutadapt.readthedocs.io/en/stable/ |
Software, algorithm | Python scripts for processing and analysis of adeep sequencing data | this paper (Li et al., 2023) |
| https://github.com/nshahlab/2022_Li-et-al_peptide-display |
Software, algorithm | Logomaker | PMID:31821414 |
| https://logomaker.readthedocs.io/en/latest/index.html |