(A) Schematic representation of the workflow for kinase specificity profiling. (B) Heatmap depicting the specificity of the c-Src kinase domain, measured using the X5-Y-X5 library. Enrichment scores …
(A) Table showing the read counts for all amino acids and the stop codon across all positions in the strep-tagged X5-Y-X5 library, from one sequencing run with an unselected (input) library. (B) …
Counts table corresponding to one sequence run from an input X5-Y-X5 library.
Flow cytometry analysis monitoring the distribution of phosphotyrosine levels over time (left). The mean fluorescence intensities, which represent phosphorylation levels, plotted as a function of …
Only peptides with one central tyrosine were considered in this analysis. Enrichment scores were log2-transformed and are displayed on a color scale from blue (disfavored sequence features, negative …
(A) Heatmaps depicting the specificities of c-Abl, Fer, EPHB1, and EPHB2. Enrichment scores were log2-transformed and are displayed on a color scale from blue (disfavored sequence features, negative …
Position-specific amino acid enrichment matrices from the tyrosine kinase X5-Y-X5 library screens.
Matrices calculated with and without inclusion of multi-tyrosine sequences are provided.
Only peptides with one central tyrosine were considered in this analysis. Enrichment scores were log2-transformed and are displayed on a color scale from blue (disfavored sequence features, negative …
Initial rates measured for each kinase were normalized to the rate of the corresponding consensus peptide. All peptides were used at a concentration of 20 μM, and the kinases were used at a …
(A) Correlation between measured phosphorylation rates and X5-Y-X5 predictions for 12 peptides with c-Src. All peptides were used at a concentration of 100 μM, and c-Src was used at a concentration …
Phosphorylation of the CDK5_Y15 peptide (100 μM) by c-Src (500 nM), monitored by RP-HPLC of selected time points. The HPLC chromatogram shows the formation of a phosphorylated species over time, …
(A) Distribution of enrichment scores from pTyr-Var screens with 13 tyrosine kinases. Each point represents a peptide sequence in the pTyr-Var library. Data points in orange-red represent sequences …
Enrichment scores from tyrosine kinase pTyr-Var screens.
Data are provided in a flat sheet with average and standard deviation values for all kinase-substrate pairs. Data are also provided for each kinase as a side-by-side comparison of enrichment scores reference and variant sequences and whether the mutation was considered a significant in our analysis. Three sheets are provided listing substrates for c-Src, Fyn, and c-Abl that are also found in a curated list of kinase-substrate pairs in the PhosphositePlus database.
Position-specific amino acid enrichment matrices from the tyrosine kinase pTyr-Var library screens for sequences containing a single central tyrosine residue.
(A) Frequency of sequences in the library with different numbers of tyrosine residues. (B) Positions of mutations across the library relative to the central tyrosine (zero-position). (C) Frequency …
Kinases (25 μM) were incubated with ATP (5 mM) in a magnesium-containing neutral pH buffer for 0.5–2 hr, then desalted and concentrated to remove excess ATP. Proteins were analyzed by …
These graphs assess what fraction of the sequences containing no Tyr residue (out of 370 sequences) and what fraction of the sequences containing 1 Tyr residue (out of 7468 sequences) have an …
Only sequences with a single central tyrosine were considered in this analysis. Position-specific amino acid enrichment scores were calculated by taking the average log2-transformed enrichment of …
Datasets are the average of three to five replicates. Significant hits are colored in orange-red.
Mutations that added or removed a tyrosine residue were excluded from these counts.
Error bars represent the standard deviations from three to five replicates.
Error bars represent the standard deviations from three to five replicates.
(A) Correlation of enrichment scores measured for c-Src in the pTyr-Var library screen with scores predicted from the X5-Y-X5 library using a position-specific scoring matrix. (B) Correlation …
Peptide sequences and their phosphorylation rates by c-Src or c-Abl, measured using the RP-HPLC kinetic assay.
Mutational effects measured from the pTyr-Var library screens and their corresponding predictions based on the X5-Y-X5 library screening data.
Only those sequence pairs with high-quality sequencing data (read counts >100) and a single central tyrosine were included in the analysis.
(A) Correlation of enrichment scores measured for c-Abl in the pTyr-Var library screen with scores predicted from the X5-Y-X5 library using a position-specific scoring matrix. (B) Correlation …
Several points lie in the top-left and bottom-right quadrant, indicating a discrepancy between the measured mutational effect in the pTyr-Var screen and the predicted mutational effect from the X5-Y-…
(A) Schematic representation of the workflow for SH2 domain specificity profiling. (B) Heatmaps depicting the specificities of the c-Src, SHP2-C, and Grb2 SH2 domains, measured using the X5-Y-X5 …
Position-specific amino acid enrichment matrices from the SH2 domain X5-Y-X5 library screens.
Matrices calculated with and without inclusion of multi-tyrosine sequences are provided.
Enrichment scores from SH2 domain pTyr-Var screens.
Data are provided in a flat sheet with average and standard deviation values for all SH2-ligand pairs. Data are also provided for each SH2 domain as a side-by-side comparison of enrichment scores reference and variant sequences and whether the mutation was considered a significant in our analysis.
Position-specific amino acid enrichment matrices from the SH2 domain pTyr-Var library screens for sequences containing a single central tyrosine residue.
Proteins were analyzed by electrospray-ionization mass spectrometry. The envelope of multiply-charged states was deconvoluted using the instrument software, and the deconvoluted spectra are shown.
Cells displaying the X5-Y-X5 library were treated with a kinase cocktail containing c-Src, c-Abl, AncSZ, and EPHB1 for 3 hr, then labeled with a pan-phosphotyrosine antibody (PY20 PerCP-eFluor 710) …
Only peptides with one central tyrosine were considered in this analysis. Enrichment scores were log2-transformed and are displayed on a color scale from blue (disfavored sequence features, negative …
Datasets are the average of three replicates. Hits are colored in orange-red.
Mutations that added or removed a tyrosine residue are excluded from these counts.
Kinase domain data are the average of four replicates, and SH2 data are the average of three replicates.
The graph on the left shows the effects of mutations that were significant for the kinase domain (gray) or the SH2 domain (orange-red). The graph on the right shows examples of phosphosite-proximal …
(A) Non-canonical amino acids used in this study. CMF = 4-carboxymethyl phenylalanine, AzF = 4-azido phenylalanine, and AcK = N-ε-acetyl-L-lysine. (B) Amber suppression in the strep-tagged X5-Y-X5 …
Error bars represent the standard deviations from three screens.
In each plot, the enrichment of specific amino acids or a stop codon, after phosphorylation by c-Src and bead-based selection, were calculated using two different methods. X-values indicate …
Initial rates measured for each kinase were normalized to the rate of the corresponding cognate consensus peptide. Peptides were used at a concentration of 100 or 20 μM, and the kinases were used at …
All measurements were carried out using the ADP-Quest assay in three to five replicates. Errors represent the standard error in global fits of all replicates to the Michaelis-Menten equation.
Entry | Kinase | Peptide name | Peptide sequence | kcat (s–1) | KM (μM) |
---|---|---|---|---|---|
1 | c-Src | Src Consensus | GPDECIYDMFPFKKKG | 4.9±0.4 | 196±38 |
2 | c-Src | Src Consensus (P-5C, D+1 G) | GCDECIYGMFPFKKKG | 4.4±0.2 | 97±10 |
3 | c-Src | SrcTide (1995) | GAEEEIYGEFEAKKKG | 3.1±0.2 | 64±10 |
4 | c-Src | SrcTide (2014) | GAEEEIYGIFGAKKKG | 1.8±0.1 | 7±3 |
5 | c-Src | Fer Consensus | GPDEPIYEWWWIKKKG | 0.4±0.1 | 8±4 |
6 | c-Src | Abl Consensus | GPDEPIYAVPPIKKKG | 2.0±0.2 | 159±31 |
7 | c-Abl | Abl Consensus | GPDEPIYAVPPIKKKG | 3.0±0.2 | 6±2 |
8 | c-Abl | AblTide (2014) | GAPEVIYATPGAKKKG | 2.5±0.2 | 35±8 |
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (E. coli) | MC1061 | Lucigen | Lucigen: 10361012 | bacterial cells used for surface-display screens |
Strain, strain background (E. coli) | DH5α | Invitrogen | Invitrogen: 18265017 | bacterial cells used for general cloning and library cloning |
Strain, strain background (E. coli) | BL21(DE3) | ThermoFisher Scientific | Thermo: C600003 | bacterial cells for general protein-expression; pre-transformed with pCDF-YopH for tyrosine kinase overexpression |
Strain, strain background (E. coli) | C43(DE3) | Lucigen | Lucigen: NC9581214 | bacterial cells used for SH2 domain over-expression; pre-transformed with pCDFDuet-BirA-WT for biotinylation |
Antibody | 4 G10 Platinum, Biotin (mouse monoclonal) | Millipore Sigma | Millipore Sigma: 16–452-MI | biotin conjugated mouse monoclonal pan-phosphotyrosine antibody dilution: (1:1000) |
Antibody | PY20-PerCP-eFluor 710 (mouse monoclonal) | eBioscience | eBioscience: 46-5001-42 | PerCP-eFluor 710-conjugated mouse monoclonal pan-phosphotyrosine antibody, clone PY20 dilution: (1:25) |
Antibody | PY20-biotin (mouse monoclonal) | Exalpha | Exalpha: 50-210-1865 | biotin conjugated mouse monoclonal pan-phosphotyrosine antibody dilution (1:500) |
Antibody | StrepMAB Chromeo 488 (mouse monoclonal) | IBA LifeSciences | IBA: 2-1546-050 | Chromeo 488-conjugated antibody that recognizes the strep-tag dilution: (1:50–100). Discontinued, but can be replaced with IBA LifeSciences StrepMAB-Classic conjugate DY-488 (IBA: 2-1563-050) |
Recombinant DNA reagent | pBAD33-eCPX | PMID:18480093 | Addgene: 23336 | pBAD33 plasmid encoding the eCPX bacterial display gene with flanking 5' and 3' SfiI restriction sites |
Recombinant DNA reagent | pBAD33-eCPX-cStrep | PMID:29547119 | pBAD33 plasmid encoding the eCPX bacterial display gene with a 3' sequence encoding a strep-tag and flanking 5' and 3' SfiI restriction sites | |
Recombinant DNA reagent | pBAD33-eCPX-cMyc | this paper | pBAD33 plasmid encoding the eCPX bacterial display gene with a 3' sequence encoding a myc-tag and flanking 5' and 3' SfiI restriction sites | |
Recombinant DNA reagent | X5-Y-X5 Library (myc-tagged) | this paper | peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing 1–10 million unique sequences with the structure X5-Y-X5, where X is encoded by an NNS codon. The scaffold protein is encoded to have a C-terminal myc-tag: EQKLISEEDL. | |
Recombinant DNA reagent | X5-Y-X5 Library (strep-tagged) | this paper | peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing 1–10 million unique sequences with the structure X5-Y-X5, where X is encoded by an NNS codon. The scaffold protein is encoded to have a C-terminal strep-tag: WSHPQFEK. | |
Recombinant DNA reagent | pTyr-Var Library (myc-tagged) | this paper | peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing ~10,000 unique sequences encoding reference and variant phosphosite pairs deried from the PhosphoSitePlus database. The scaffold protein is encoded to have a C-terminal myc-tag: EQKLISEEDL. | |
Recombinant DNA reagent | pTyr-Var Library (strep-tagged) | this paper | peptide display library in the pBAD33 vector, fused to the eCPX scaffold, containing ~10,000 unique sequences encoding reference and variant phosphosite pairs deried from the PhosphoSitePlus database. The scaffold protein is encoded to have a C-terminal strep-tag: WSHPQFEK. | |
Recombinant DNA reagent | pET-23a-His6-TEV-Src(KD) | PMID:29547119 | bacterial expression vector encoding the human c-Src kinase domain (residues 260–528), with an N-terminal His6-tag and TEV protease recognition sequence | |
Recombinant DNA reagent | pET-23a-His6-TEV-Fyn(KD) | PMID:29547119 | bacterial expression vector encoding the human Fyn kinase domain (residues 261–529) with an N-terminal His6-tag and TEV protease recognition sequence | |
Recombinant DNA reagent | pET-23a-His6-TEV-Hck(KD) | PMID:29547119 | bacterial expression vector encoding the human Hck kinase domain (residues 252–520) with an N-terminal His6-tag and TEV protease recognition sequence | |
Recombinant DNA reagent | pET-23a-His6-TEV-Abl(KD) | PMID:29547119 | bacterial expression vector encoding the mouse c-Abl kinase domain (residues 232–502) with an N-terminal His6-tag and TEV protease recognition sequence | |
Recombinant DNA reagent | pET-23a-His6-TEV-AncSZ(KD) | DOI: 10.1101/2022.04.24.489292 | bacterial expression vector encoding the AncSZ kinase domain (residues 352–627) with an N-terminal His6-tag and TEV protease recognition sequence | |
Recombinant DNA reagent | pET23a-His6-TEV-Fer(KD) | this paper | bacterial expression vector encoding the mouse Fer kinase domain (residues 553–823) with an N-terminal His6-tag and TEV protease recognition sequence | |
Recombinant DNA reagent | pET-His6-TEV-FGFR1(KD) | PMID:30004690 | Addgene: 79719 | bacterial expression vector encoding the human FGFR1 kinase domain (residues 456–763) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-FGFR3(KD) | PMID:30004690 | Addgene: 79731 | bacterial expression vector encoding the human FGFR3 kinase domain (residues 449–759) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-EPHB1(KD) | PMID:30004690 | Addgene: 79694 | bacterial expression vector encoding the human EPHB1 kinase domain (residues 602–896) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-EPHB2(KD) | PMID:30004690 | Addgene: 79697 | bacterial expression vector encoding the human EPHB2 kinase domain (residues 604–898) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pET-His6-TEV-MERTK(KD) | PMID:30004690 | Addgene: 79705 | bacterial expression vector encoding the human MERTK kinase domain (residues 570–864) with an N-terminal His6-tag and TEV protease recognition sequence |
Recombinant DNA reagent | pCDF-YopH | PMID:16260764 | bacterial expression vector for co-expression of untagged YopH phosphatase with tyrosine kinases | |
Recombinant DNA reagent | pET28-His6-TEV-SHP2-C459E-no tail | this paper | bacterial expression vector encoding the human SHP2 (residues 1–526) with the C459E mutation, an N-terminal His6-tag, and TEV protease recognition sequence | |
Recombinant DNA reagent | pET28-His6-TEV-SHP2-C459E-no tail-D61V | this paper | bacterial expression vector encoding the human SHP2 (residues 1–526) with C459E and D61V mutations, an N-terminal His6-tag, and TEV protease recognition sequence | |
Recombinant DNA reagent | pET28-His6-TEV-SHP2-C459E-no tail-D61N | this paper | bacterial expression vector encoding the human SHP2 (residues 1–526) with C459E and D61N mutations, an N-terminal His6-tag, and TEV protease recognition sequence | |
Recombinant DNA reagent | pCDFDuet-BirA-WT | this paper | bacterial expression vector encoding BirA biotin ligase, used to coexpress with SH2 domain expression vector for biotinylation of SH2 domain | |
Recombinant DNA reagent | pET-His6-SUMO-Src(SH2) | this paper | bacterial expression vector encoding the human cSrc SH2 domain (residues 143–250) with an N-terminal His6-SUMO tag | |
Recombinant DNA reagent | pET-His6-SUMO-SHP2(CSH2) | this paper | bacterial expression vector encoding the human SHP2 CSH2 domain (residues 105–220) with an N-terminal His6-SUMO tag | |
Recombinant DNA reagent | pET-His6-SUMO-Grb2(SH2) | this paper | bacterial expression vector encoding the human Grb2 SH2 domain (residues 56–152) with an N-terminal His6-SUMO tag | |
Recombinant DNA reagent | pULTRA CMF | PMID:28604693 | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-carboxymethyl phenylalanine via Amber suppression | |
Recombinant DNA reagent | pEVOL pAzFRS.2.t1 | PMID:26571098 | Addgene: 73546 | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-azido phenylalanine and other Phe derivatives via Amber suppression |
Recombinant DNA reagent | pULTRA chAcKRS3 | PMID:29544052 | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of acetyl-lysine via Amber suppression; gift from Abhishek Chatterjee at Boston College | |
Recombinant DNA reagent | pULTRA-Amp CMF | this paper | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-carboxymethyl phenylalanine via Amber suppression, altered to have an ampicillin resistance marker | |
Recombinant DNA reagent | pULTRA-Amp pAzFRS.2.t1 | this paper | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of 4-azido phenylalanine and other Phe derivatives via Amber suppression, altered to have an ampicillin resistance marker | |
Recombinant DNA reagent | pULTRA-Amp chAcKRS3 | this paper | bacterial expression vector encoding the tRNA/syntetase pair for incorporation of acetyl-lysine via Amber suppression, altered to have an ampicillin resistance marker | |
Sequence-based reagent | X5-Y-X5 library oligo; eCPX-rand-lib | this paper, purchased from Millipore Sigma | primer sequence: 5’-GCTGGCCAGTCTGGCCAGNNS NNSNNSNNSNNStatNNSNNSNNSNNSNNSGGAGG GCAGTCTGGGCAGTCTG 3’ | |
Sequence-based reagent | Oligopool-fwd-primer | this paper, purchased from Millipore Sigma | primer sequence: 5’-GCTGGCCAGTCTG-3’ | |
Sequence-based reagent | Oligopool-rev-primer | this paper, purchased from Millipore Sigma | primer sequence: 5’-CAGACTGCCCAGACT-3’ | |
Sequence-based reagent | link-eCPX-fwd | this paper, purchased from Millipore Sigma | 5’-GGAGGGCAGTCTGGGCAGTCTG-3’ | |
Sequence-based reagent | link-eCPX-rev | this paper, purchased from Millipore Sigma | 5’-GCTTGGCCACCTTGGCCTTATTA-3’ | |
Sequence-based reagent | BB-fwd-primer | this paper, purchased from Millipore Sigma | 5’-TAATAAGGCCAAGGTGGCCAAGC-3’ | |
Sequence-based reagent | BB-rev primer | this paper, purchased from Millipore Sigma | 5’-CTGGCCAGACTGGCCAGCTACG-3’ | |
Sequence-based reagent | TruSeq-eCPX-Fwd | sequence from PMID:29547119, purchased from Millipore Sigma | round one amplicon PCR primer | primer sequence: 5’-TGACTGGAGTTCAGACGTG TGCTCTTCCGATCTNNNNNNACCGCA GGTACTTCCGTAGCT-3’ |
Sequence-based reagent | TruSeq-eCPX-Rev | sequence from PMID:29547119, purchased from Millipore Sigma | round one amplicon PCR primer | primer sequence: 5’-CACTCTTTCCCTACACGACG CTCTTCCGATCTNNNNNN TTTTGTTGTAGTCACCAGACTG-3’ |
Sequence-based reagent | D701 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGACGG CATACGAGATcgagtaatGTG ACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D702 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGA CGGCATACGAGATtctccgga GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D703 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGA CGGCATACGAGATaatgagcg GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D704 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGAC GGCATACGAGATggaatctcG TGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D705 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGA AGACGGCATACGAGA TttctgaatGTGACTGGAGT TCAGACGTG-3' |
Sequence-based reagent | D706 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGA CGGCATACGAGATacgaattc GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D707 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAG ACGGCATACGAGATagcttcag GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D708 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGACG GCATACGAGATgcgcattaGT GACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D709 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAG ACGGCATACGAGATcatagccg GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D710 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGA AGACGGCATACGAGATttcgcgga GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D711 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAAGACG GCATACGAGATgcgcgaga GTGACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D712 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-CAAGCAGAA GACGGCATACGAGATctatcgctGT GACTGGAGTTCAGACGTG-3' |
Sequence-based reagent | D501 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCGA CCACCGAGATCTACACtatagcct ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D502 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCG ACCACCGAGATCTACACatagaggc ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D503 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCGA CCACCGAGATCTACACcctatcct ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D504 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGCGA CCACCGAGATCTACACggctctga ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D505 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGC GACCACCGAGATCTACACaggcgaag ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D506 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGG CGACCACCGAGATCTACACtaatctta ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D507 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACGGC GACCACCGAGATCTACACcaggacgt ACACTCTTTCCCTACACGAC-3' |
Sequence-based reagent | D508 | sequence from Illumina, purchased from Millipore Sigma | round two amplicon/indexing PCR primer | primer sequence: 5'-AATGATACG GCGACCACCGAGATCTACAC gtactgacACACTCTTTCCCTACACGAC-3' |
Peptide, recombinant protein | Src(KD) | this paper, expressed/purified in-house | human c-Src kinase domain (residues 260–528) | |
Peptide, recombinant protein | Fyn(KD) | this paper, expressed/purified in-house | human Fyn kinase domain (residues 261–529) | |
Peptide, recombinant protein | Hck(KD) | this paper, expressed/purified in-house | human Hck kinase domain (residues 252–520) | |
Peptide, recombinant protein | Abl(KD) | this paper, expressed/purified in-house | mouse c-Abl kinase domain (residues 232–502) | |
Peptide, recombinant protein | JAK2 Protein, active | Millipore Sigma | Millipore Sigma: 14–640 M | Active, C-terminal His6-tagged, recombinant, human JAK2, amino acids 808-end, expressed by baculo virus in Sf21 cells, for use in Enzyme Assays. |
Peptide, recombinant protein | AncSZ(KD) | this paper, expressed/purified in-house | AncSZ kinase domain (residues 352–627) designed by ancestral sequence reconstruction | |
Peptide, recombinant protein | Fer(KD) | this paper, expressed/purified in-house | mouse Fer kinase domain (residues 553–823) | |
Peptide, recombinant protein | FGFR1(KD) | this paper, expressed/purified in-house | human FGFR1 kinase domain (residues 456–763) | |
Peptide, recombinant protein | FGFR3(KD) | this paper, expressed/purified in-house | human FGFR3 kinase domain (residues 449–759) | |
Peptide, recombinant protein | EPHB1(KD) | this paper, expressed/purified in-house | human EPHB1 kinase domain (residues 602–896) | |
Peptide, recombinant protein | EPHB2(KD) | this paper, expressed/purified in-house | human EPHB2 kinase domain (residues 604–898) | |
Peptide, recombinant protein | MERTK(KD) | this paper, expressed/purified in-house | human MERTK kinase domain (residues 570–864) | |
Peptide, recombinant protein | Src(SH2) | this paper, expressed/purified in-house | human c-Src SH2 domain (residues 143–250) | |
Peptide, recombinant protein | SHP2(C-SH2) | this paper, expressed/purified in-house | human SHP2 C-SH2 domain (residues 105–220) | |
Peptide, recombinant protein | Grb2(SH2) | this paper, expressed/purified in-house | human Grb2 SH2 domain (residues 56–152) | |
Peptide, recombinant protein | SHP2(PTP; C459E) | this paper, expressed/purified in-house | human full-length SHP2 (residues 1–526; C459E) | |
Peptide, recombinant protein | SHP2(PTP; C459E, D61V) | this paper, expressed/purified in-house | human full-length SHP2 (residues 1–526; C459E, D61V) | |
Peptide, recombinant protein | SHP2(PTP; C459E, D61N) | this paper, expressed/purified in-house | human full-length SHP2 (residues 1–526; C459E, D61N) | |
Peptide, recombinant protein | SHP2(PTP; C459E, G60V) | this paper, expressed/purified in-house | human full-length SHP2 (residues 1–526; C459E, G60V) | |
Peptide, recombinant protein | Src Consensus | this paper, synthesized in-house | peptide sequence: Ac-GPDECIYDMFPFKKKG-NH2 | |
Peptide, recombinant protein | Src Consensus (P-5C, D+1 G) | this paper, synthesized in-house | peptide sequence: Ac-GCDECIYGMFPFRRRG-NH2 | |
Peptide, recombinant protein | Abl Consensus | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIYAVPPIKKKG-NH2 | |
Peptide, recombinant protein | Fer Consensus | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIYEWWWIKKKG-NH2 | |
Peptide, recombinant protein | EPHB1 Consensus | this paper, synthesized in-house | peptide sequence: Ac-GPPEPNYEVIPPKKKG-NH2 | |
Peptide, recombinant protein | EPHB2 Consensus | this paper, synthesized in-house | peptide sequence: Ac-GPPEPIYEVPPPKKKG-NH2 | |
Peptide, recombinant protein | SrcTide (1995) | sequence from PMID:7845468, synthesized in-house | peptide sequence: Ac-GAEEEIYGEFEAKKKG-NH2 | |
Peptide, recombinant protein | SrcTide (2014) | sequence from PMID:25164267, purchased from Synpeptide | peptide sequence: Ac-GAEEEIYGIFGAKKKG-NH2 | |
Peptide, recombinant protein | AblTide (2014) | sequence from PMID:7845468, synthesized in-house | peptide sequence: Ac-GAPEVIYATPGAKKKG-NH2 | |
Peptide, recombinant protein | HRAS_Y64 | sequence from PMID:35606422, purchased from Synpeptide | peptide sequence: Ac-AGQEEYSAMRD-NH2 | |
Peptide, recombinant protein | HRAS_Y64_E63K | sequence from PMID:35606422, purchased from Synpeptide | peptide sequence: Ac-AGQEKYSAMRD-NH2 | |
Peptide, recombinant protein | CDK13_Y716_YF | this paper, synthesized in-house | peptide sequence: Ac-IGEGTYGQVFK-NH2 | |
Peptide, recombinant protein | CDK13_Y716_G717R_YF | this paper, synthesized in-house | peptide sequence: Ac-IGEGTYRQVFK-NH2 | |
Peptide, recombinant protein | CDK5_Y15 | sequence from PMID:35606422, purchased from Synpeptide | peptide sequence: Ac-IGEGTYGTVFK-NH2 | |
Peptide, recombinant protein | CDK5_Y15_G16R | sequence from PMID:35606422, purchased from Synpeptide | peptide sequence: Ac-IGEGTYRTVFK-NH2 | |
Peptide, recombinant protein | PLCG1_Y210 | this paper, synthesized in-house | peptide sequence: Ac-SGDITYGQFAQ-NH2 | |
Peptide, recombinant protein | PLCG1_Y210_T209N | this paper, synthesized in-house | peptide sequence: Ac-SGDINYGQFAQ-NH2 | |
Peptide, recombinant protein | GLB1_Y294 | this paper, synthesized in-house | peptide sequence: Ac-VASSLYDILAR-NH2 | |
Peptide, recombinant protein | GLB1_Y294_L297F | this paper, synthesized in-house | peptide sequence: Ac-VASSLYDIFAR-NH2 | |
Peptide, recombinant protein | MISP_Y95 | this paper, synthesized in-house | peptide sequence: Ac-EGWQVYRLGAR-NH2 | |
Peptide, recombinant protein | HLA-DPB1_Y59_F64L_YF | this paper, synthesized in-house | peptide sequence: Ac-LERFIYNREEL-NH2 | |
Peptide, recombinant protein | PEAK1_Y797 | this paper, synthesized in-house | peptide sequence: Ac-SVEELYAIPPD-NH2 | |
Peptide, recombinant protein | SIRPA_Y496_P491L | this paper, synthesized in-house | peptide sequence: Ac-LFSEYASVQV-NH2 | |
Peptide, recombinant protein | HGD_Y166_F169L | this paper, synthesized in-house | peptide sequence: Ac-GNLLIYTELGK-NH2 | |
Peptide, recombinant protein | ITGA3_Y237_YF | this paper, synthesized in-house | peptide sequence: Ac-WDLSEYSFKDP-NH2 | |
Peptide, recombinant protein | ITGA3_Y237_S235P_YF | this paper, synthesized in-house | peptide sequence: Ac-WDLPEYSFKDP-NH2 | |
Peptide, recombinant protein | Src Consensus (C-2S) | this paper, synthesized in-house | peptide sequence: Ac-GPDESIYDMFPFKKKG-NH2 | |
Peptide, recombinant protein | Src Consensus (C-2P) | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIYDMFPFKKKG-NH2 | |
Peptide, recombinant protein | ACTA1_Y171_YF | this paper, synthesized in-house | peptide sequence: Ac-QPIFEG(pY)ALPHAG-NH2 | |
Peptide, recombinant protein | ACTA1_Y171_A172G_YF | this paper, synthesized in-house | peptide sequence: Ac-QPIFEG(pY)GLPHAG-NH2 | |
Peptide, recombinant protein | ACTB_Y240 | this paper, synthesized in-house | peptide sequence: Ac-QSLEKS(pY)ELPDGG-NH2 | |
Peptide, recombinant protein | ACTB_Y240_P243L | this paper, synthesized in-house | peptide sequence: Ac-QSLEKS(pY)ELLDGG-NH2 | |
Peptide, recombinant protein | CCDC39_Y593 | this paper, synthesized in-house | peptide sequence: Ac-QRKQQL(pY)TAMEEG-NH2 | |
Peptide, recombinant protein | CLIP2_Y972 | this paper, synthesized in-house | peptide sequence: Ac-QSDQRR(pY)SLIDRG-NH2 | |
Peptide, recombinant protein | CLIP2_Y972_R977P | this paper, synthesized in-house | peptide sequence: Ac-QSDQRR(pY)SLIDPG-NH2 | |
Peptide, recombinant protein | CBS_Y308 | this paper, synthesized in-house | peptide sequence: Ac-QVEGIG(pY)DFIPTG-NH2 | |
Peptide, recombinant protein | CBS_Y308_G307S | this paper, synthesized in-house | peptide sequence: Ac-QVEGIS(pY)DFIPTG-NH2 | |
Peptide, recombinant protein | fluorescently-labeled c-Src-SH2 consensus peptide | sequence from PMID:7680959 | peptide sequence: FITC-Ahx-GDG(pY)EEISPLLL-NH2; gift from Jeanine Amacher at Western Washignton University | |
Peptide, recombinant protein | Src Consensus (D+1 K) | this paper, synthesized in-house | peptide sequence: Ac-GPDECIYKMFPFKKKG-NH2 | |
Peptide, recombinant protein | Src Consensus (D1AcK) | this paper, synthesized in-house | peptide sequence: Ac-GPDECIY(AcK)MFPFKKKG-NH2 | |
Peptide, recombinant protein | Src Consensus (C-2K) | this paper, synthesized in-house | peptide sequence: Ac-GPDEKIYDMFPFKKKG-NH2 | |
Peptide, recombinant protein | Src Consensus (C-2AcK) | this paper, synthesized in-house | peptide sequence: Ac-GPDE(AcK)IYDMFPFKKKG-NH2 | |
Peptide, recombinant protein | Abl Consensus (A+1 K) | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIYKVPPIKKKG-NH2 | |
Peptide, recombinant protein | Abl Consensus (A+1 AcK) | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIY(AcK)VPPIKKKG-NH2 | |
Peptide, recombinant protein | Abl Consensus (I+5 K) | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIYAVPPKKKKG-NH2 | |
Peptide, recombinant protein | Abl Consensus (I+5 AcK) | this paper, synthesized in-house | peptide sequence: Ac-GPDEPIYAVPP(AcK)KKKG-NH2 | |
Commercial assay or kit | MiSeq Reagent Kit v3 (150 cycles) | Illumina | Illumina: MS-102–3001 | |
Commercial assay or kit | NextSeq 500 Mid-Output v2 Kit (150 cycles) | Illumina | Illumina: FC-404–2001 | |
Commercial assay or kit | Promega QuantiFluor dsDNA Sample Kit | Promega | Promega: E2671 | |
Commercial assay or kit | ADP Quest Assay Kit | Eurofins Discoverx | Eurofins Discoverx: 90–0071 | |
Commercial assay or kit | Dynabeads FlowComp Flexi Kit | ThermoFisher Scientific | ThermoFisher Scientific: 11061D | |
Chemical compound, drug | 4-carboxymethyl phenylalanine (CMF) | Millipore Sigma | Millipore Sigma: ENA423210770 | |
Chemical compound, drug | 4-azido-L-phenylalanine (AzF) | Chem-Impex International | Chem-Impex: 06162 | |
Chemical compound, drug | N-ε-Acetyl-L-Lysine (AcK) | MP Biomedicals | MP Biomedicals: 02150235.2 | |
Chemical compound, drug | Click-iT sDIBO -Alexa fluor 555 | ThermoFisher | Thermo: C20021 | |
Other | Creatine Phosphokinase from rabbit muscle | Millipore Sigma | Millipore Sigma: C3755-500UN | purified enzyme extracted from rabbit muscle |
Software, algorithm | FLASH (version FLASH2-2.2.00) | PMID:21903629 | https://ccb.jhu.edu/software/FLASH/ | |
Software, algorithm | Cutadapt (version 3.5) | DOI:10.14806/ej.17.1.200 | https://cutadapt.readthedocs.io/en/stable/ | |
Software, algorithm | Python scripts for processing and analysis of adeep sequencing data | this paper (Li et al., 2023) | https://github.com/nshahlab/2022_Li-et-al_peptide-display | |
Software, algorithm | Logomaker | PMID:31821414 | https://logomaker.readthedocs.io/en/latest/index.html |