ARPC5 isoforms and their regulation by calcium-calmodulin-N-WASP drive distinct Arp2/3-dependent actin remodeling events in CD4 T cells
- Department of Infectious Diseases, Integrative Virology, University Hospital Heidelberg, Germany
- Department of Infectious Diseases, Virology, University Hospital Heidelberg, Germany
- Cellular Signalling and Cytoskeletal Function Laboratory, The Francis Crick Institute, United Kingdom
- Department of Infectious Disease, Imperial College, United Kingdom
Figures
Figure 1 with 1 supplement
Arp2/3 complex-mediated nuclear and plasma membrane actin polymerization in CD4 T cells.
(A) Schematic representation of the experimental setup to visualize actin dynamics at the immune synapse, as performed for B–D. (B) Shown are representative still images at indicated time points from live-cell visualization of nuclear and plasma membrane actin dynamics in T cells stably expressing nuclear lifeact-GFP (referred to as JNLA) treated with either DMSO (solvent control) or CK869 upon contact with Staphylococcus enterotoxin E (SEE) pulsed Raji B cells. Images were acquired every 70 s for a total of 30 min after adding the Raji B cells. Still images represent the time at which the T and B cells made contact (left panel) to the time they formed an immune synapse (IS) as shown by the accumulation of plasma membrane F-actin at the contact site (right panel). (C) Quantification of nuclear (NFA) and (D) plasma membrane (AR) F-actin dynamics of JNLA cells upon contact with SEE pulsed Raji B cells is shown, respectively. All data points indicate mean ± SD values from three independent experiments with at least 40 cells analyzed per condition per experiment. Scale bar, 7 µm. (E) Schematic representation of the experimental/live-cell imaging setup on stimulatory GBDs as performed for F–G. (F) JNLA pretreated with either DMSO (solvent control) or CK869 for 30 min were put on TCR stimulatory GBDs and subjected to live-cell microscopy. Shown are representative still images from the spinning-disk confocal microscope from the time the cells fall on the coverslips until after contact with the stimulatory surface, with acquisition every 30 s. Arrows indicate the nuclear F-actin (NFA), whereas arrowheads point to the F-actin at PM. Quantification of (G) nuclear actin filaments (NFA) and plasma membrane F-actin ring (AR) polymerization is shown, respectively, upon contact with TCR stimulatory surface. Data points indicate mean ± SD values from three independent experiments where 40–60 cells were analyzed per condition in each experiment. (H) Schematic representation of the experimental/live cell imaging setup with P/I activation as performed for I and J. Relates to Figure 1—figure supplement 1A–E. (I) JNLA cells pretreated with either DMSO (solvent control) or CK869 for 30 min were put on poly-lysine-coated GBDs and subjected to live-cell microscopy, which was then followed by addition of P/I. Shown are representative still images from the spinning-disk confocal microscope forming NFA after P/I addition. Arrows indicate the NFA. (J) Quantification of nuclear actin polymerization upon addition of P/I was performed. In (C, D, G, J), each data point indicates the mean value of an independent experiment with 40–60 cells analyzed per condition with indicated mean ± SD from three independent experiments. Scale bar, 3 µm. NFA is denoted as yellow filaments within nucleus, whereas plasma membrane f-actin is denoted as black filaments across all experimental schematics shown. Statistical significance based on the calculation of mean ± SD from three independent experiments using Welch’s t-test was performed. *p≤0.0332, **p≤0.0021, and ns: not significant. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 1—figure supplement 1
CD3 expression in CK869-treated cells upon PMA + ionomycin (PI) stimulation.
(A) Representative dot plots show the percentage of CD3-FITC-positive Jurkat cells upon P/I stimulation in the presence or absence of CK869 treatment. Jurkat cells were pretreated with DMSO or CK869 just as described in Figure 1H for 30 min prior to stimulating them with PI for either 5 min or 30 min, respectively, followed by staining with anti-CD3-FITC antibody on ice for 15 min before fixing them and measuring the expression by flow cytometry. (B and C) describe the total frequency and mean fluorescence intensity (MFI) of the CD3-positive cells 5 min post P/I stimulation in the presence or absence of CK869. The bar graph represents the mean of three independent experiments with the dots showing frequency (in B) or MFI (in C) of CD3-positive population, respectively, from each independent experiment. (D and E) describe the total frequency and MFI of the CD3-positive cells 30 min post P/I stimulation in the presence or absence of CK869. The bar graph represents the mean of three independent experiments with the dots showing frequency (in B, D) or MFI (in C, E) of CD3-positive population, respectively, from each independent experiment. Error bars are calculated as mean ± SD of three independent experiments with statistical significance calculated using ordinary one-way ANOVA with Tukey’s multiple-comparison test. *p=0.032 and ns: not significant.
Figure 2 with 1 supplement
Heterogeneous expression of ARP2/3 isoforms in CD4 T cells.
(A) Expression of all the subunits of the Arp2/3 complex along with the respective isoforms of ARPC1 and ARPC5 across Jurkat cell line and primary human CD4 T cells from two representative healthy donors were verified using western blotting. Representative immunoblots compare the protein levels of each subunit and their isoforms in CD4 T cells. Additional comparisons for expression of these proteins in Resting (R) and Activated (A) CD4 T cells from donors 3 and 4 are shown, respectively. Black arrowheads indicate the specific bands. Note that the ARPC5L antibody also detects ARPC5 (marked by red asterisk). The numbers indicated below each row represents the mean ± SD values from three independent experiments of the densitometric quantification of the bands compared to Jurkat protein levels (which is set to 1). Saturated exposure of the ARPC5 immunoblot is shown for better visualization of the ARPC5 levels in the JNLA cell line. (B, C) Single-cell RNA-sequencing analysis of Jurkat CD4 T cells (B) and primary CD4 T cells (C). Expression of selected genes in UMAP embedded cells with adjacent histograms of their frequency distributions. See Figure 2—figure supplement 1C for UMAP embedding of (C). Dashed line represents threshold for frequency quantification at 1 TPM. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 2—figure supplement 1
Heterogeneous expression of ARP2/3 isoforms in CD4 T cells.
(A, B) qRT-PCR-derived mRNA expression of all the subunits of the Arp2/3 complex along with the isoforms of ARPC1 and ARPC5 across Jurkat cell line and primary human CD4 T. The heatmap in (A) indicates the absolute differences in gene expression by comparing the Ct mean values obtained from technical triplicates per sample for each subunit/isoform, across Jurkat and primary human CD4 T cells. Color code for the heatmap: yellow (high expression, low Ct mean values) and black-white (low expression, high Ct mean values). Heatmap in (B) shows the relative mRNA expression of each of the human Arp2/3 complex subunits and their isoforms when normalized to the respective GAPDH levels of the cell line and primary CD4 levels and plotted as fold change (FC, as log of base2). Color code for the heatmap: yellow (high expression, lowest difference after GAPDH normalization) and black-white (low expression, higher difference after GAPDH normalization). D1–D5 indicate CD4 T cells isolated from five different healthy human donors. Comparison of gene expression between RNA isolated from resting human primary CD4 T cells (denoted here as Resting ‘R’) and from activated CD4 T cells (72 hr co-culture with anti-CD3+CD28 Dynabeads, denoted here as Activated ‘A’). Analysis of scRNA-seq data (C–E). (C) UMAP embedding of primary CD4 T cells from lymph nodes, obtained from publicly available dataset GEO accession no. GSE126030. Identity of cell clusters assigned based on markers in (D). (E) Cell-cycle-dependent expression of Arp2/3 complex subunits in Jurkat CD4 T cells. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 3 with 1 supplement
ARPC5 isoforms differentially regulate nuclear and plasma membrane actin polymerization.
(A) Representative immunoblots show knockdown of ARPC1 and ARPC5 isoforms in bulk JNLA cells treated with indicated shRNAs. Black arrowheads indicate the specific bands, and black asterisks mark unspecific bands. Note that the ARPC5L antibody also detects ARPC5 (marked by red asterisk). The numbers indicated below the respective blots represent the mean ± SD values from four independent experiments, based on the densitometric quantification of the bands, normalized to GAPDH and compared to the non-targeting control (NTC) protein levels (which is set to 1). (B) Representative spinning-disk confocal still images of JNLA cells treated with indicated shRNA show stills post activation with PMA/ionomycin (P/I). Arrows point to the nuclear F-actin (NFA). Relates to Figure 3—figure supplement 1A,B. Scale bar, 3 µm. (C) Quantification of NFA formation in shRNA-treated cells relative to the scrambled control-treated cells. Mean ± SD of four independent experiments where 30 cells were analyzed per condition per experiment. Each dot represents the mean of each independent experiment. (D) Representative immunofluorescence images indicate averaged intensity projections of Phalloidin-647-stained F-actin ring (AR) formation in JNLA cells treated with indicated shRNA upon activation on coverslips coated with anti-CD3+CD28 antibodies. Arrowheads point to the F-actin ring at the PM. (E) Quantification of Phalloidin-stained AR formation in shRNA-treated cells relative to the control-treated cells. In (C, E), each data point indicates the mean value of an independent experiment consisting of two technical replicates with at least 100 cells analyzed per condition with indicated mean ± SD from four independent experiments. One-way ANOVA with Kruskal–Wallis test was used to determine statistical significances, where *p≤0.0332, **p≤0.0021, and ns: not significant. Scale bar, 5 µm. See also related Figure 3—figure supplement 1C-F. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 3—figure supplement 1
ARPC5 knockdown cells exhibit filopodia and lamellipodia-like morphotypes upon TCR activation.
(A) shRNA-mediated knockdown of scrambled (control), ARPC5 or ARPC5L in JNLA cells was put on TCR stimulatory GBDs and subjected to live-cell microscopy. Shown are representative still images from the spinning-disk confocal microscope indicate the time of cells forming nuclear F-actin (NFA) after falling and contacting the GBDs. Movies were acquired every 30 s for a total of 6 min. Arrows indicate the NFA. Scale bar, 4 µm. (B) Quantification of nuclear actin filaments (NFA) was performed upon contact with TCR stimulatory surface. Data points indicate mean values from two independent experiments where 40–60 cells were analyzed per condition in each experiment. (C) Representative bigger field of view of average intensity projections of confocal images showing Phalloidin-647-stained F-actin ring (AR) formation in JNLA cells, treated with indicated shRNA upon activation on coverslips coated with anti-CD3+CD28 antibodies. Scale bar, 15 µm. (D) Representative confocal still images (average intensity projection) of JNLA cells upon activation for 5 min on stimulatory coverslip showing formation of distinct morphologies of actin ring formed. Cells were fixed, permeabilized, and stained for F-actin (with Phalloidin-647) and counterstained with DAPI. Scale bar, 10 µm. (E, F) Cells with knockdown, exhibiting different morphologies (bars in different colors, stacked) based on classification shown above in (D), upon TCR activation, were quantified as % of cells of the total 100 cells quantified per condition is represented in (E). (F) shows the fold change in the different morphotypes exhibited by the cells upon knockdown relative to the control cells starts forming (top panel) or has fully formed into a classical actin ring structure (bottom).
Figure 4 with 3 supplements
Effects observed on nuclear and plasma membrane F-actin dynamics upon ARPC5/C5L knockout and its impact on proximal TCR signaling and cytokine production.
(A) Shown are representative maximum intensity projections of confocal still images of the indicated KO JNLA cells overexpressing mCherry (control) or mCherry fusion proteins of the respective ARPC5 isoforms, post activation with either anti-CD3+CD28 antibodies (top panel) or with PMA/ionomycin (P/I) (bottom panel). Arrows point to the nuclear F-actin (NFA, bottom). Scale bar, 3 µm. Arrowheads point to the F-actin ring (top). Scale bar, 5 µm. See related Figure 4—figure supplement 1A-D and Figure 4—figure supplement 2A for western blots of KO and overexpression and Figure 4—figure supplement 2B and D for NFA data. (B) Quantification of F-actin ring (AR) formation in the PM, stained with Phalloidin-647, is compared to the NFA formation visualized with NLA-GFP in the respective KO or KO+ARPC5 isoform expressing cells was performed relative to the non-targeting control (NTC)-treated cells. ‘mCherry’ alone was used as vector backbone control for the overexpression study. Bars indicate mean from three independent experiment where 30–40 cells was analyzed per condition. One-way ANOVA with Kruskal–Wallis test was used to determine statistical significances, where **p≤0.0021 and ns: not significant. See related Figure 4—figure supplement 2C,E. (C, F) Representative confocal images of JNLA.GFP cells with indicated knockout or control (NTC) upon 5 min of activation on coverslips coated with anti-CD3+CD28 antibodies. Cells were fixed and stained for F-actin (with Phalloidin 488) and pTyr or pSLP-76 (Alexa Fluor 647), respectively. (D and G) show quantification of the total number of pTyr or pSLP-76 clusters/cell in KO condition relative to control cells analyzed using the ‘Spot Detector’ Fiji plugin. Data presented here are mean ± SD from three independent experiments in which two technical replicates were measured per sample. (E, H) Dot plots represent the changes in overall intensity of pTyr or pSLP-76 clusters per cell where each dot represents intensity of clusters/cell analyzed manually using Fiji. In (B, D, E), each data point indicates the mean value of an independent experiments with at least 80 cells analyzed per condition with the indicated mean ± SD from three independent experiments. One-sample t-test was used to determine statistical significances, where *p≤0.033, **p≤0.0021, ***p≤0.0002 and ns: not significant. Scale bar, 5 µm. (I, J) Cytokine production of A30.1 cells treated with the indicated shRNAs in response to P/I. Bars show intracellular levels of TNFα or IL-2, 4 hr or 16 hr of post activation relative to cells treated with the scrambled shRNA control. One-way ANOVA with Tukey’s multiple-comparison test was used to determine statistical significances ( **p≤0.005, ***p≤0.0002, ****p≤0.0001, and ns: not significant). Relates to Figure 4—figure supplement 3A–E.
Figure 4—figure supplement 1
Expression of Arp2/3 subunits upon knockout (KO) of respective ARPC5 isoforms and validation of the overexpression of C5 isoforms in the bulk culture.
(A) Representative immunoblots show levels of each of the Arp2/3 complex subunits in JNLA cells with the indicated KO of each of the ARPC5 isoforms. Black arrowheads indicate the specific bands, and black asterisks mark unspecific bands. Immunoblots are representative of three independent experiments. The numbers indicated below the respective immunoblots (only the blots where differences were observed are indicated) represent the mean ± SD values from three independent experiments, based on the densitometric quantification of the bands, normalized to GAPDH and compared to the nontargeting control (NTC) protein levels (which is set to 1). (B, C) Shown are representative immunoblots confirming the successful overexpression of each of the ARPC5 isoforms in JNLA cells on the indicated KO of each of the ARPC5 isoforms compared to the NTC cells. Note that the ARPC5L antibody also detects ARPC5 (marked by red asterisk). (D) Representative immunoblots (from n = 3) show expression of respective subunits of the Arp2/3 complex when immunoblotted against each subunit antibody from mCherry-expressing and mCherry-C5/C5L-expressing JNLA cells. JNLA cells stably expressing either mCherry or mCherry-C5/C5L were lysed and 500 µg of cell lysates were immunoprecipitated with 25 µl RFP-TRAP beads overnight before pulling down on the mCherry-bound fraction from all the samples. All samples were run in denaturing condition on a 4–12% gradient SDS-PAGE with fractions loaded as total cell lysate (TCL), flow through (FT), or unbound fraction and bound or immunoprecipitated fraction. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 4—figure supplement 2
Rescue of the nuclear F-actin (NFA) and F-actin ring (AR) upon overexpression of the ARPC5 isoforms in JNLA knockout (KO) expanded from single KO clones.
(A) Shown are representative immunoblots confirming the successful overexpression of each of the ARPC5 isoforms in JNLA cells on the indicated KO clones of each of the ARPC5 isoforms compared to the clone where no KO was observed (referred to as negative clone). (B, C) Shown are representative maximum intensity projections of confocal still images of the indicated KO clones overexpressing mCherry fusion proteins of the respective ARPC5 isoforms, post activation with either PMA + ionomycin (P/I) as shown in (B, scale bar, 3 µm) or on anti-CD3+CD28 antibody-coated stimulatory coverslips (as shown in C, scale bar, 15 µm). Arrows point to the NFA, whereas arrowheads point to the AR. (D, E) Quantification of NFA or AR formation in the respective KO clones or KO clones + ARPC5/C5L isoform-expressing cells was performed indicating the % of cells forming NFA or AR. Bars indicate mean from two independent experiment where 30–40 cells was analyzed for NFA and 100 cells were analyzed for AR assay per condition in each experiment. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 4—figure supplement 3
Intracellular staining and detection of TNFa and IL-2 in A.301 cells with ARPC5 isoform knockdown.
(A) Schematic of the experimental timeline for generating knockdown of ARPC5 isoforms and PMA + ionomycin (P/I) stimulation of the transduced cells. (B) The bar graph represents the mean of three independent experiments showing the relative mRNA expression (fold change) of ARPC5 and ARPC1 isoforms along with ARP3, between control and ARPC5 isoform KD cells, 72 hr post transduction with their respective shRNAs. Dots represent the mean of each independent experiment run in a technical triplicate for each sample, and error bars represent the mean ± SD of three independent experiments. Two-way ANOVA with Tukey’s multiple-comparison test was performed to calculate statistical significance with *p=0.032, **p=0.0075, ***p=0.0005, ****p≤0.0001, and ns: not significant. (C) Representative histogram of control and respective ARPC5 isoform KD cells, fixed, permeabilized, and stained with ARPC5 or ARPC5L-FITC showing the normalized count (mode), 72 hr post transduction with their respective shRNAs. In gray is the isotype control for each antibody based on which the gating was done, in red is the shRNA control cells, and in orange is the C5/C5L shRNA-treated cells. (D) Representative dot plots of intracellular TNFα in A.301 WT (parental/unmodified cells), control shRNA-treated cells, and ARPC5 isoform KD cells show the percentage of TNFα-positive cells in unstimulated and P/I-stimulated conditions. A.301 WT and sh_Control cells were stimulated with P/I in the presence of DMSO or CK869 for 4 hr plus monensin, before being fixed, permeabilized, and stained with TNFα-BV421. Whereas ARPC5 isoform KD cells were stimulated only in the presence or absence of DMSO and monensin, before being fixed, permeabilized, and stained with TNFα-BV421. (E) Representative dot plots of intracellular IL-2-stained control shRNA-treated and ARPC5 isoform KD A.301 cells show the percentage of IL2-positive cells in unstimulated and P/I-stimulated conditions. sh_Control cells and ARPC5 isoform KD cells were stimulated with P/I in the presence of DMSO for 16 hr, with monensin added only in the last 4 hr before being fixed, permeabilized, and stained with IL2-APC. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 5 with 1 supplement
Cellular distribution of ARPC5 isoforms.
(A) Shown are representative spinning-disk confocal images (maximum projection) of ARPC5.mCherry and ARPC5L.mCherry distribution in unstimulated JNLA cells. White arrows point to the respective C5 or C5L punctae seen in the nucleus. Also see related Figure 5—figure supplement 1A and B. (B) Subcellular distribution of the ARPC5 subunit and its isoform ARPC5L was determined by biochemical fractionation of JNLA cells with respective knockout of either C5 or C5L in the bulk culture. Representative immunoblots reveal levels of ARPC5 isoforms in the whole cell extract (WCE), cytoplasmic (C), and nuclear (N) fractions in the indicated JNLA knockout cells post fractionation. GAPDH and hnRNPL were used as markers for cytoplasmic and nuclear compartments, respectively. (C) Representative, deconvoluted, and segmented stimulated emission depletion (STED) single-plane images show endogenous nuclear actin filaments (stained with Phalloidin-647N) and ARPC5.mCherry/ARPC5L.mCherry (signal enhanced with anti-mCherry with secondary antibody in atto-594 channel) in A3.01 T cells, stimulated with PMA/ionomycin (P/I) for 30 s. Arrows (in white) point to the colocalization events. Percent colocalization is mentioned as mean ± SD (in white bar, top right) for each of the isoforms from three independent experiments. Scale bar, 500 nm. (D) The dot plot shows the frequency of colocalization of ARPC5 and ARPC5L with nuclear F-actin (from representative STED-deconvolved and segmented super-resolved images shown in Figure 5C) in A3.01 cells post 30 s of stimulation with PMA + ionomycin. Each dot represents colocalization events per cell that was analyzed. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 5—figure supplement 1
Subcellular distribution of ARPC5 isoforms.
(A) Representative maximum intensity projection of confocal images showing respective ARPC5/ARPC5L antibody staining (on the left) of the endogenous ARPC5 isoforms expressed in the JNLA cells in unstimulated condition, where cells were fixed on poly-lysine-coated coverslips. Additional, Phalloidin-stained channel (on the right) is also shown for each image. Scale bar, 3 µm. (B) Representative maximum intensity projection of confocal images showing respective ARPC5/ARPC5L antibody staining of the endogenous ARPC5 isoforms, Phalloidin staining as well as merged view of DAPI, phalloidin, and ARPC5/C5L antibody staining are shown in the JNLA cells upon TCR activation on coverslips coated with anti-CD3+CD28 antibodies. The high background observed in C5 antibody-stained channel is unavoidable as the CD3/28 antibodies coated on the coverslips and the ARPC5 antibody are of the same species (mouse). Scale bar, 5 µm. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 6 with 1 supplement
Differential role of ARPC5 isoforms in replication stress-mediated nuclear F-actin (NFA) formation.
(A) Schematic of experimental setup showing timeline of knockout (KO) generation and induction of replication stress in the JNLA KO cells using aphidicolin (APH). See related Figure 6—figure supplement 1A. (B) Shown are representative spinning disk confocal still images (maximum projection) of the APH pretreated KO or control cells. The movies were acquired for 5 hr with acquisition every 15 min post pretreatment of cells with APH. The stills at the indicated time points are representative of the time point where the maximal NFA burst has been observed in each condition. (C) Stacked bar graph (denoted by three different colors for each condition) shows the kinetics of NFA burst throughout 5 hr of live-cell imaging duration, with maximum NFA burst observed within the first 2 hr. (D) Quantification of the % of cells with NFA bursts (within the first 2 hr of imaging) post replication stress induction in control and KO cells. Each data point indicates the mean value of an independent experiments with at 40–60 analyzed per condition with indicated mean ± SD from three independent experiments. Statistical significance was calculated using one-way ANOVA (Kruskal–Wallis test). Also see related Figure 6—figure supplement 1C for single-cell tracks. (E) JNLA cells transduced with either mCherry (control) or CAMBP4.NLS-mCherry were pretreated with solvent control (DMSO) and were either activated by PMA + ionomycin (P/I) or treated with APH for induction of replication stress for 3 hr prior to live-cell imaging. Shown are maximum projection of representative spinning-disk confocal still images (showing the time frame where maximum NFA burst was observed) in the DMSO control compared with either P/I or APH-mediated NFA bursts (white arrows) in the presence and absence of nuclear calmodulin. Movies for visualizing replication stress were acquired for 5 hr with acquisition every 15 min post pretreatment of cells. Whereas movies for visualizing P/I activation-induced NFA were acquired for 5 min with acquisition every 15–30 s. Also see related Figure 6—figure supplement 1E and F. (F) Quantification of NFA in the abovementioned conditions was performed; each data point indicates the mean value of an independent experiment with at least 30 cells analyzed per condition with indicated mean ± SD from three independent experiments. Statistical significance was calculated using Welch’s t-test. *p≤0.0332, **p≤0.0021, ***p≤0.0002, and ns: not significant. Scale bar, 3 µm. Also see related Figure 6—figure supplement 1B.
Figure 6—figure supplement 1
Nuclear F-actin (NFA) formation induced by aphidicolin (APH) is not dependent on calcium signaling in CD4 T cells.
(A) Dots represent the mean of each independent experiment, and the bar graph represents the mean of three experiments, showing % of cells forming NFA upon replication stress induction using increasing concentrations of APH. (B) Representative immunoblots show induction of phospho levels of DNA damage sensor CHK-1 in JNLA cells upon replication stress induction by APH (15 µM, APH) for 3 hr. Membranes were first probed with phospho-specific antibodies, followed by stripping and reprobing with antibodies against total protein and GAPDH. Immunoblots are representative of three independent experiments where the numbers indicated below the blots represent the mean ± SD intensity values of each condition compared to mCherry as control (set to 1). Intensity values from densitometric analysis for both phospho and total protein levels were normalized to GAPDH before further comparisons were done. (C) Single-cell tracking of 10 cells per condition (denoted by different colors for NTC, C5, or C5L KO) for the entire time frame of 5 hr post pretreatment with APH shows the APH-mediated NFA kinetics in KO and control JNLA cells. (D) shows relative comparison (fold change, FC) of cells forming either NFA or F-actin ring (AR), respectively, in control and KO JNLA cells upon two different modes of T cell activation, that is, activation with P/I or on anti-CD3/28-coated coverslips. Dots represent the mean of each independent experiment, and the bar graph represents the mean of three experiments with error bars calculated from mean ± SD of three independent experiments where at least 30 cells were analyzed per condition per experiment for NFA quantification and more than 100 cells per condition per experiment were analyzed for AR quantification. Statistical significance was calculated using one-way ANOVA (Kruskal–Wallis test) where ***p≤0.0002, ****p≤0.000021, and ns: not significant. (E, F) Scatter plots represent the number of filaments per cell (E) and the mean fluorescence intensity (MFI) per cell forming NFA (F) upon replication stress induction with APH comparing cells that express mCherry or nuclear-specific CAMBP4-mCherry in JNLA cells. 26 single cells were analyzed manually using Fiji from each of the experimental conditions. (G) Blocking of the calcium signaling pathway downstream of calmodulin using inhibitors STO609, KN93, KN62, and cyclosporin A (CsA), respectively, on JNLA cells, followed by induction of replication stress with APH does not impair the replication stress-mediated NFA burst observed. 30 cells/condition were analyzed in each experiment. Bar graph represents the mean from three independent experiments with each dot representing the mean from each independent experiment. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 7 with 1 supplement
Differential involvement of class I nucleation-promoting factors (NPFs) in T cell activation and replication stress-mediated nuclear F-actin (NFA) formation.
(A) Representative immunoblots show knockout (KO) of NWASP, WASHC5, and WAVE2 class I NPFs, respectively, in JNLA cells. Identical amounts of cell lysates were loaded per lane and signal intensity judged based on the loading control (GAPDH or Tubulin). Black arrowheads or asterisks mark specific and unspecific bands, respectively, as identified based on signal reduction in the KO cell line. The numbers indicated below the respective blots represent the mean ± SD values from three independent experiments, based on the densitometric quantification of the bands, normalized to the loading control and compared to the non-targeting control (NTC) protein levels (which is set to 1). (B) Representative spinning-disk confocal still images (maximum projection) of JNLA cells with indicated NPF KO showing NFA formation post activation with PMA/ionomycin (P/I). Movies were acquired for 5 min post PI addition with acquisition every 30 s. Arrows point to the NFA. Scale bar, 3 µm. (C) Quantification of NFA formation in respective NPF KO cells relative to the NTC-treated cells. Each data point indicates the mean value of an independent experiments with 30 analyzed per condition with the indicated mean ± SD from three independent experiments. (D) Representative confocal images indicate averaged intensity projections of Phalloidin-647-stained F-actin ring (AR) formation in fixed/permeabilized JNLA cells with respective NPF KO upon activation on coverslips coated with anti-CD3+CD28 antibodies. Arrowheads point to the AR at the PM upon TCR activation, and the dotted box in white shows the cell in zoomed view in the inset (top right). Scale bar, 5 µm. (E) Quantification of Phalloidin-stained AR formation in KO cells relative to the NTC-treated cells. Each data point indicates the mean value of an independent experiment with at least 100 cells analyzed per condition with indicated mean ± SD from three independent experiments. (F) Shown are representative spinning-disk confocal still images (maximum projection) of the aphidicolin (APH)-treated NPF KO or control cells, respectively. The movies were acquired for 5 hr with acquisition every 15 min post pretreatment of cells with APH. The stills at the indicated time points are representative of the time point where the maximal NFA burst has been observed in each condition. (G) Quantification of the % of cells with NFA bursts (within first 2 hr of imaging) post replication stress induction in control and KO cells. Each data point indicates the mean value of an independent experiment with 40–60 cells analyzed per condition with indicated mean ± SD from three independent experiments. One-way ANOVA with Kruskal–Wallis test was used to determine statistical significances, where *p≤0.0332 and ns: not significant. Also see related Figure 7—figure supplement 1A-F. Source data is avaialble at https://doi.org/10.11588/data/YVYEO8.
Figure 7—figure supplement 1
Molecular characterization of Arp2/3 complex upon nucleation-promoting factor (NPF) knockout (KO) in JNLA cells.
(A–C) Representative immunoblots show levels of ARP3, ARPC1, and ARPC5 subunits in JNLA.GFP cells with the indicated KO of respective class I NPFs. Black arrowheads indicate the specific bands, and black asterisks mark unspecific bands. Note that the ARPC5L antibody also detects ARPC5 (marked by red asterisk). Immunoblots are representative of three independent experiments. The numbers indicated below the respective immunoblots represent the mean ± SD values from three independent experiments, based on the densitometric quantification of the bands, normalized to either GAPDH or Tubulin and compared to the non-targeting control (NTC) protein levels (which is set to 1). (D, E) Effects of NWASPi on NFA in A3.01 T cells expressing nuclear lifeact.GFP. (D) Representative images upon stimulation with PMA/ionomycin (P/I). (F) Quantification with statistical (t-test, *p≤0.05). Dots represent the mean of each independent experiment, and the bar graph represents the mean of three experiments with error bars calculated from mean ± SD of three independent experiments where at least 30 cells were analyzed per condition per experiment. (F) Stacked bar graph represents the frequency of JNLA cells (%) with respective class I NPF KO, exhibiting different morphologies based on classification shown in Figure 3D, upon TCR activation, were quantified as % of cells of the total 100 cells quantified per condition.
Figure 8
Graphical summary of our findings.
Schematic model for Arp2/3-dependent differential regulation of actin dynamics induced upon TCR engagement (left) compared to the induction of replication stress by aphidicolin (APH) (right).
Videos
Video 1
Live imaging of an immune synapse (IS) formation between DMSO-treated JNLA (in gray) and Staphylococcus enterotoxin E (SEE)-treated B cells (in magenta).
Video 2
Live nuclear F-actin (NFA) and F-actin ring (AR) formation in DMSO-treated Jurkat CD4 T cells upon falling on a stimulatory surface.
Video 3
Live imaging of an immune synapse (IS) formation between CK869-treated JNLA (in gray) and Staphylococcus enterotoxin E (SEE)-treated B cells (in magenta).
Video 4
Live nuclear F-actin (NFA) and F-actin ring (AR) formation in CK869-treated Jurkat CD4 T cells upon falling on a stimulatory surface.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HEK293T cell line | Tsopoulidis et al., 2019 | RRID:CVCL_0063 | |
| Cell line (H. sapiens) | Jurkat Tag (JTag) cells clone E6-1, stably expressing nuclear lifeact.GFP | Tsopoulidis et al., 2019 | Source cells-Jurkat Tag; RRID :CVCL_C831 | |
| Cell line (H. sapiens) | CEM-derived A3.01 cell line | Tsopoulidis et al., 2019 | RRID:CVCL_6244 | |
| Cell line (H. sapiens) | Raji B cell line | Tsopoulidis et al., 2019; Kaw et al., 2020 | RRID:CVCL_0511 | |
| Recombinant DNA reagent | Construct pLVX-mCherry-siRES-hARPC5L (Human) plasmid | Abella et al., 2016 | Kind gift from Michael Way’s lab | Lentiviral construct to express the mCherry-tagged ARPC5L. |
| Recombinant DNA reagent | Construct pLVX-mCherry-siRES-hARPC5 (Human) plasmid | Abella et al., 2016 | Kind gift from Michael Way’s lab | Lentiviral construct to express the mCherry-tagged ARPC5. |
| Recombinant DNA reagent | Construct pLVX-puro-mCherry (Human) plasmid | Abella et al., 2016 | Kind gift from Michael Way’s lab | Lentiviral construct to express the mCherry |
| Recombinant DNA reagent | pLKO.1-Puro-shRNA | Tsopoulidis et al., 2019, Sigma-Aldrich | RRID:Addgene_10878 | Lentiviral construct to express the shRNAs |
| Antibody | Anti-human ARP3 (mouse monoclonal) | Sigma-Aldrich | Clone FMS338: Cat# A5979; RRID:AB_476749 | WB (1:10,000) |
| Antibody | Anti-human p16 ARC/ARPC5, (mouse monoclonal) | Synaptic Systems | Cat# 305011; RRID:AB_887896 | WB (1:500) |
| Antibody | Anti-human ARPC5L (rabbit polyclonal) | GeneTex | Cat# GTX120725; RRID:AB_11172404 | WB (1:1000) |
| Antibody | Anti-human ARPC1A (rabbit polyclonal) | Sigma-Aldrich | Cat# HPA004334 | WB (1:500) |
| Antibody | Anti-human ARPC1B (mouse monoclonal ) | Santa Cruz Biotechnology | Cat# sc-137125; RRID:AB_2289927 | WB (1:500) |
| Antibody | Anti-human WASL (rabbit polyclonal) | Sigma-Aldrich | Cat# HPA005750; RRID:AB_1854729 | WB (1:500) |
| Antibody | Anti-human WASHC5 (rabbit polyclonal) | Sigma-Aldrich | Cat# HPA070916 | WB (1:250) |
| Antibody | Anti-human WAVE2 (mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-373889; RRID:AB_10917394 | WB (1:500) |
| Antibody | Anti-mCherry (rabbit polyclonal) | Abcam | Cat# ab167453; RRID:AB_2571870 | WB (1:1000) IF (1:500) |
| Antibody | Anti-mCherry (mouse monoclonal) | Novus | Cat# NBP1-96752SS; RRID:AB_11008969 | WB (1:1000) IF (1:500) |
| Antibody | Anti-pTyr (rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc-18182; RRID:AB_670513 | IF (1:100) |
| Antibody | Anti-human pSLP76 (rabbit polyclonal) | Abcam | Cat# ab75829; RRID:AB_2136886 | IF (1:1000) |
| Antibody | Brilliant Violet 421 anti-human TNF-α antibody (mouse monoclonal) | BioLegend | Cat# 502932; RRID:AB_10960738 | Flow cytometry (1:100) |
| Antibody | APC anti-human IL-2 antibody (rat monoclonal) | BioLegend | Cat# 500311; RRID:AB_315098 | Flow cytometry (1:100) |
| Antibody | FITC mouse anti-human CD3 antibody (mouse monoclonal ) | BD Biosciences | Cat# 561802; RRID:AB_10893003 | Flow cytometry (1:100) |
| Sequence-based reagent | ARPC5_F | Primer Bank, MGH-PGA | PCR primers | TGGTGTGGATCTCCTAATGAAGT |
| Sequence-based reagent | ARPC5_R | Primer Bank, MGH-PGA | PCR primers | CACGAACAATGGACCCTACTC |
| Sequence-based reagent | ARPC5L_F | Primer Bank, MGH-PGA | PCR primers | TCTCCCGTCAACACCAAGAAT |
| Sequence-based reagent | ARPC5L_R | Primer Bank, MGH-PGA | PCR primers | GCCTGCTCAATCTCACTGCT |
| Sequence-based reagent | ARPC1A (human) | Sigma-Aldrich | shRNA target sequence | CCCTGGTGATCCTGAGAATTA |
| Sequence-based reagent | ARPC1B (human) | Sigma-Aldrich | shRNA target sequence | GCTGACCTTCATCACAGACAA |
| Sequence-based reagent | ARPC5 (human) | Sigma-Aldrich | shRNA target sequence | GTTCAATCTCTGGACAAGAAT |
| Sequence-based reagent | ARPC5L (human) | Sigma-Aldrich | shRNA target sequence | GAAAGTGCTCACAAACTTCAA |
| Sequence-based reagent | ARPC5 (Human) | Synthego | sgRNA sequences | sgRNA1: GCAGUGCUAUGUUACUGCAA sgRNA2: CAAUGCUGCCUGCCCGGUCC sgRNA3: UGACUCUUGGUGUUGAUAGG |
| Sequence-based reagent | ARPC5L (human) | Synthego | sgRNA sequences | sgRNA1: UCGUCUGCAGGAGCGAGCCC sgRNA2: ACUGCGCUGCUAUUUUCUGU sgRNA3: AUUCGUCGAUGUCCACCCGG |
| Commercial assay or kit | WesternBright Sirius Chemiluminescent Detection Kit | Advansta | Cat# K-12043-D20; RRID:SCR_013577 | ECL-based detection of proteins |
| Commercial assay or kit | RFP-Trap Magnetic Agarose | ChromoTek Proteintech | Cat# rtma-100; AB_2631363 | For immunoprecipitation of mCherry-tagged proteins |
| Peptide, recombinant protein | Alt-R S.p. Cas9 Nuclease V3 | IDT Germany | Cat# 1081059 | For CRISPR-Cas9 nucleofection reaction |
| Chemical compound, drug | PMA | Sigma-Aldrich | Cat# P1585-1MG | |
| Chemical compound, drug | Ionomycin | Sigma-Aldrich | Cat# I0634-1MG | |
| Chemical compound, drug | CK-869 ≥ 98% (HPLC) | Sigma-Aldrich | Cat# C9124 | |
| Chemical compound, drug | Aphidicolin, Ready Made Solution - 1 ml | Sigma-Aldrich | Cat# A4487 | |
| Software, algorithm | Fiji/ImageJ | Fiji/ImageJ | RRID:SCR_002285; PMID:22743772 | Image processing |
| Software, algorithm | FlowJo | BD Biosciences | RRID:SCR_008520 | Software for flow cytometry data analysis |
| Software, algorithm | Prism 8 | GraphPad | RRID:SCR_002798 | Data analysis and quantification |
| Software, algorithm | Illustrator CC | Adobe | RRID:SCR_010279 | Vector graphics and assembly |
| Software, algorithm | bioRENDER | bioRENDER (paid license) | RRID:SCR_018361 | Graphical illustrations |
| Other | 4D Nucleofector -Core+X unit | Lonza Biosciences | Cat# AAF-1003X | For nucleofection |
| Other | Spinning-disk confocal microscope | Nikon Ti PerkinElmer UltraVIEW VoX | As used in Tsopoulidis et al., 2019 | Live-cell imaging |
| Other | SLM 2D/3D STED/RESOLFT | Abberior Instruments GmbH, Göttingen, Germany | As used in Tsopoulidis et al., 2019 | Super-resolution microscopy |
| Other | Leica SP8 TCS DLS Confocal and SPIM | Leica Microsystems | Confocal microscopy | |
| Other | FACS Celesta | BD Biosciences | Flow cytometry |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
ARPC5 isoforms and their regulation by calcium-calmodulin-N-WASP drive distinct Arp2/3-dependent actin remodeling events in CD4 T cells
eLife 12:e82450.
https://doi.org/10.7554/eLife.82450
